TABLE 1.
Primer (orientation)a | Accession no. of blab | Sequence (5′→3′) | Annealing sitec | Amplicon size (bp)d |
---|---|---|---|---|
OXA-23F (F) | AJ132105 | GATGTGTCATAGTATTCGTCGT | −108 to −87 | 1,058 |
OXA-23R (R) | AF201828 | TCACAACAACTAAAAGCACTGT | +929 to +950 | (OXA-23F/-23R) |
OXA-24F (F) | AJ239129, AF201826 | ATGAAAAAATTTATACTTCCTATATTCAGC | +1 to +30 | 825 |
OXA-24R (R) | AF201827, AF509241 | TTAAATGATTCCAAGATTTTCTAGC | +801 to +825 | (OXA-24F/-24R) |
IMP-F (F) | S71931, AB010417, AF290912 | CATGGTTTGGTGGTTCTTGT | +154 to +173 | 488 |
IMP-R (R) | AB040994, AB074433 | ATAATTTGGCGGACTTTGGC | +582 to +601 | (IMP-1F/-1R) |
VIM-F (F) | AF191564, AF300454, AY165025 | ATTGGTCTATTTGACCGCGTC | +24 to +44 | 780 |
VIM-R (R) | AY524987, AY524988, AY524989 | TGCTACTCAACGACTGAGCG | +784 to +803 | (VIM-2F/-2R) |
Orientation of each primer: F, forward; R, reverse.
β-lactamase genes (bla) used in the multiple sequence alignment for designing each primer pair.
Positions of annealing sites are with respect to the first nucleotide of the coding region (+1).
The primer pair for PCR amplification is indicated in parentheses.