Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2024 Oct 13;102:skae309. doi: 10.1093/jas/skae309

The impact of exogenous vasoactive intestinal polypeptide on inflammatory responses and mRNA expression of tight junction genes in lambs fed a high-grain diet

Golam K Mia 1, Emma Hawley 2, Mustapha Yusuf 3, Samat Amat 4, Alison K Ward 5, Wanda L Keller 6, Glenn Dorsam 7, Kendall C Swanson 8,
PMCID: PMC11537799  PMID: 39396104

Abstract

This study assessed the impact of administering vasoactive intestinal polypeptide (VIP) on inflammation and intestinal VIP and tight junction mRNA expression in lambs fed grain-based finishing diets. Sixteen wether lambs (69.6 ± 1.9 kg) were individually housed, adapted to a corn-based diet containing no forage, and randomly assigned to 2 treatment groups. Lambs were intraperitoneally injected every other day for 28 d with either saline (0.9% NaCl) with no VIP (n = 8; control) or saline with VIP (n = 8; 1.3 nmol/kg BW). Blood samples were collected weekly for analysis of cytokine concentrations, and on days 0 and 28 for lipopolysaccharide (LPS), and LPS-binding protein (LBP) concentrations. Upon completion of the treatment period, lambs were euthanized and gastrointestinal tissues, including rumen, jejunum, cecum, and colon samples, were collected for analysis of the expression of tight junction mRNA (claudin-1, claudin-4, occludin, and ZO-1), endogenous VIP, and VIP receptor (VPAC-1). No treatment effects (P ≥ 0.38) were observed for VIP and VPAC-1 mRNA expression in the colon. Supplementation with VIP did not influence (P ≥ 0.28) the expression of claudin-1, claudin-4, occludin, and ZO-1 tight junction mRNA in the rumen, jejunum, cecum, and colon. Lambs treated with VIP had greater (P ≤ 0.01) plasma concentrations of the anti-inflammatory cytokines, IL-10 and IL-36RA. There were treatment-by-day interactions observed (P ≤ 0.02) for concentrations of the pro-inflammatory cytokines, MIP-1α and MIP-1β. Lambs that did not receive VIP had greater serum concentrations of LPS (P = 0.05) than the lambs receiving VIP. These data suggest that VIP administration may not influence tight junction mRNA expression but may decrease LPS concentrations and thus inflammation in lambs fed a grain-based diet.

Keywords: cytokines, high concentrate diet, inflammation, LPS, tight junctions, VIP


This research suggests that negative consequences of feeding grain-based diets such as inflammation could potentially be reduced with VIP treatment. Potential outcomes from this research could be the development of feeding and management strategies targeted at optimizing the natural production of VIP or the establishment of techniques to deliver VIP therapeutically.

Introduction

Grains are often the major component of finishing diets for ruminants due to their high starch concentration and energy density, thus resulting in improved growth performance. However, feeding high concentrations of starch can lead to an increase in acid production and a subsequent decrease in ruminal pH (Hungate, 1975). Additionally, feeding grain-based diets can reduce chewing time and saliva production, resulting in decreased buffering capacity (Zebeli et al., 2008; Yang and Beauchemin, 2009; Lechartier and Peyraud, 2010). These factors collectively can result in the increased incidence of ruminal acidosis, a condition that can have negative health and growth performance implications.

The vasoactive intestinal polypeptide (VIP), a neuropeptide and gut hormone, has been shown to reduce inflammation in piglets infected with enterotoxigenic Escherichia coli by modulating toll-like receptors (Xu et al., 2014). Additionally, VIP was found to alleviate acute lung injury in mice induced by lipopolysaccharide (LPS) by inhibiting the activation of the NLRP3 inflammasome (Zhou et al., 2020). These findings suggest that increasing VIP in animals undergoing immune challenges, such as ruminal acidosis, could help alleviate the associated negative effects on growth performance. Recent results from our laboratory have shown that lambs fed a grain-based diet and treated with VIP had greater average daily gain (ADG) compared to those not treated with VIP (Mia et al., 2024). Although the anti-inflammatory effects of VIP are well documented in nonruminant and laboratory animals, research on its role in ruminants is still limited. Additionally, the mechanisms by which VIP increases weight gain in lambs-fed grain-based diets need further clarification.

At low pH, gram-negative bacterial species can be lysed through disruption of bacterial structural proteins (Goto et al., 1990; Maurer et al., 2005), denaturation of the membrane lipid bilayer (Hyldgaard et al., 2012; Royce et al., 2013), and disruption of metabolic processes (Krebs et al., 1983). This results in the release of endotoxins, such as LPS, which can result in gastrointestinal toxicity and inflammation (Netea et al., 2002; Lorenzo et al., 2019). The toxicity of LPS can be attenuated by binding with LPS-binding protein (LBP; Lamping et al., 1998), depending on its concentration in the circulation (Gutsmann et al., 2001). Therefore, LPS and LBP can be indicators of inflammation status in animals. Moreover, by activating toll-like receptor 4, LPS induces the release of cytokines, which can have pro-inflammatory roles (Wang et al., 2009). Furthermore, the intestinal barrier in the gastrointestinal tract functions to limit the absorption of endotoxins, such as LPS, from entering the circulation and thus inhibits the spread of inflammation throughout the body (Ghosh et al., 2020; Tommaso et al., 2021; Portincasa et al., 2022). Intestinal barrier function largely depends on tight junctions, which serve as the primary barrier to entry of LPS to the circulation (Guo, et al., 2015). Claudin-1, claudin-4, occludin, and ZO-1 are the predominant proteins that make up tight junctions (Mariscal et al., 2003). Disruption or altering of the localization of these tight junction proteins can impair the integrity of the intestinal barrier in animals fed grain-based diets (Sharma et al., 2010; Chen et al., 2011; Lai et al., 2022).

A healthy gastrointestinal tract is important for effective nutrient absorption and immune function (Ghosh et al., 2020; Tommaso et al., 2021). Poor gut health can lead to increased stress and disease susceptibility, impacting overall well-being and growth performance (Fu et al., 2022). Given the unique characteristics of the ruminant digestive tract and the accompanying risks associated with feeding grain-based finishing diets, an examination of the anti-inflammatory role of VIP along with its impact on gut tight junctions is needed. A better understanding of these mechanisms should increase our understanding of how VIP influences growth performance in ruminants.

Thus, the current study aimed to assess the influence of supplementary VIP on inflammation and expression of intestinal tight junction mRNA in lambs fed grain-based finishing diets. Additionally, we aimed to determine if endogenous expression of VIP mRNA and its receptor (VPAC-1) are affected by exogenous VIP treatment. We hypothesized that VIP, due to its anti-inflammatory properties, plays a role in mitigating the negative effects associated with feeding grain-based diets to ruminants.

Materials and Methods

Animals, experimental design, and sample collection

The experimental design and animal management procedures were reviewed and approved by the North Dakota State University Institutional Animal Care and Use Committee (IACUC #20210010). Details of animals and experimental design were described previously (Mia et al., 2024). Briefly, 16 Dorset wether lambs (BW = 69.6 ± 1.9 kg) were housed in individual pens and assigned to 4 blocks based on initial BW. Lambs were adapted to the experimental diets over 16 d by introducing increasing proportions of corn and decreasing proportions of hay, and lambs were fed the final diet containing no forage for a minimum of 5 d before the treatment period began. Feed was offered for ad libitum intake once daily in the morning. After adaptation to the experimental diet, lambs were grouped (n = 4) by body weight, and lambs within each group were randomly assigned to control (n = 8) or VIP (n = 8) treatment. Lambs in the VIP group received intraperitoneal (IP) injection with VIP (lyophilized VIP from ABclonal Technologies, Woburn, MA; 1.3 nmol/kg BW in 0.9% NaCl solution), whereas lambs in the control group received 0.9% NaCl every second day over the 28 d of the experiment. The injection route and dose were selected based on research in non-ruminants as described in Mia et al. (2024).

Blood samples were collected weekly before feeding via jugular venipuncture throughout the treatment period into 10-mL tubes (Becton Dickinson, Rutherford, NJ, USA) containing either an anti-clotting agent (lithium heparin) for plasma collection or a clotting agent (silicon coated) for serum collection. After centrifugation (3,000 × g at 4 °C) for 20 min, serum and plasma were separated and stored at -20 °C until analysis. At the end of the 28-d treatment period, all lambs were euthanized via captive bolt stunning and exsanguination. Tissue samples from the rumen (ventral sac), jejunum (mid-point of the small intestine; mucosa scraped with a microscope slide), cecum (mid-point), and colon (midpoint) were collected, flash-frozen in liquid N2, and stored at −80 °C until analysis. Tissue samples from rumen and intestines were used for tight junction mRNA expression analysis. Expression of VIP and VPAC-1 mRNA was analyzed only in the colon, as past research from our research group reported high mRNA expression in the lamb colon (Hawley et al., 2022).

RNA extraction, cDNA (complementary DNA) synthesis, and RT-qPCR

Extraction of RNA and cDNA synthesis followed the procedures outlined by Hawley et al. (2022), with adherence to the MIQE guidelines described by Bustin et al. (2009). Extraction of RNA was performed using a universal mini-RNA extraction kit (Qiagen, Germantown, MD, USA). The NanoDropTM One-C (Waltham, MA, USA) was used for RNA quantification and purity assessment, measuring absorbance at 230, 260, and 280 nm. The integrity of RNA was assessed using a Qubit 4 fluorometer (ThermoFisher Scientific, Waltham, MA, USA), with an IQ score between 7.0 and 10.0 (Supplementary Tables 1 and 2) considered acceptable. Samples of RNA (0.7 µg) were treated with DNase I (ThermoFisher) in 10x Reaction Buffer containing MgCl2 at 37 °C for 30 min, followed by a 10-min deactivation step at 70 °C with a final concentration of 5 mM EDTA. The FIREScript RT cDNA synthesis kit (SolisBioDyne, Tartu, Estonia) was used following the manufacturer’s protocol for cDNA synthesis. Reverse transcriptase reactions were incubated at 25 °C for 10 min and 60 °C for 30 min. Finally, a temperature of 85 °C was applied for 5 min to deactivate the reverse transcriptase.

A CFX96 thermocycler (BioRad, Hercules, CA, USA) was used to perform reverse transcription quantitative PCR (RT-qPCR) using SYBR green dye with 96-well plates prepared in accordance with the manufacturer’s instructions. The reactions were set up with 5 µL of 1:10 diluted cDNA samples, volumes brought to 20 µL final volume with nuclease-free water, and final concentrations of 1X HOT FIREPol EvaGreen qPCR Supermix (SolisBiodyne) and 200 nmol of forward and reverse primers specific for the gene of interest (Table 1). Primers that had been previously used for sheep samples by Chen et al. (2023) were used, including claudin-1, claudin-4, occludin, and ZO-1, as well as those used by Hawley et al. (2022) for VIP, VPAC-1, beta-2-microglobulin (B2M), and peptidyl-prolyl cis–trans isomerase A (PPIA). Primer efficiencies for all reactions were between 97% and 102%, respectively, as recommended by MIQE (Table 1, Supplementary Figure 1; Bustin et al., 2009). Genes were amplified using the following parameters: 95 °C (10 min) hot start + [95 °C (15 s) denaturation + 57 °C (30 s) annealing] × 40 cycles. All PCR reactions used melt curves with 5 s intervals between 65 and 95 °C, and primer pairs exhibiting a single amplicon PCR product were employed. The quantification cycle (Cq) values were measured using the regression determination method of BioRad Manager 3.1 software. Relative quantification was calculated using the 2−ΔΔCq method (Ye et al., 2012). All reactions were carried out in duplicate, and Cq values of less than 36 were considered above the detection limit. For normalization, 2 reference genes, B2M and PPIA, were utilized in accordance with the Genorm calculation (Livak and Schmittgen, 2001). The coefficient of variation [(standard deviation/mean) 100] of inter-assay controls was ≤1.05% (Supplementary Table 3). No template and no reverse transcriptase controls were used to assess the extent of genomic DNA contamination for each sample.

Table 1.

List of primer sequences and their efficiencies for RT-qPCR analyses1

Gene GeneBank accession # Primer sequence (5ʹ-3ʹ) bp GC, % E,
%
Slope R2 Tm °C References
Occludin XM_018065677.1 F: CCATACCACTCCTCCTCCGTA
R: GTGGACTTTCAAAAGGCCTGG
212 57.1
52.4
97.2 −3.39 0.99 60.1
59.6
Chen et al., 2023
Claudin-1 XM_005675123.3 F: CTGCCCCAGTGGAAGGTTTA
R: GTTGCTTGCAGAGTGCTGTTC
161 55.0
52.4
97.5 −3.38 0.99 59.6
60.0
Chen et al., 2023
Claudin-4 XM_005697785.2 F: AAGGTGTACGACTCGCTGCT
R: GACGTTGTTAGCCGTCCAG
237 55.0
57.9
100 −3.31 0.99 58.6
58.6
Chen et al., 2023
ZO-1 XM_018066114.1 F: CGACCAGATCCTCAGGGTAA
R: AATCACCCACATCGGATCCT
161 55.0
50.0
98.5 −3.35 0.99 58.2
58.4
Chen et al., 2023
VIP NM_001126368.1 F: CACTGACAACTACACACGCC
R: GACTCTCCTTCGCTGCTTCTC
93 55.0
57.1
98.3 −3.36 0.99 59.1
60.4
Hawley et al., 2022
VPAC-1 XM_042235879.1 F: ATCCTTGCCTCCATCTTGGTG
R: GCTGTCACTCTTCCCGACAT
99 52.4
55.0
101 −3.29 0.99 60.1
59.8
Hawley et al., 2022
B2M NM_001009284.2 F: CTGCTGCAAGGATGGCTGTCT
R: GGACCTCTGGAATACGCTGGAT
93 57.1
54.6
102 −3.25 1.00 59.1
58.5
Hawley et al., 2022
PPIA NM_001308578.1 F: GCCAAGACTGAGTGGTTGGAT
R: TTGCTGGTCTTGCCATTCCT
113 52.4
50.0
99.3 −3.33 0.99 57.3
57.2
Hawley et al., 2022

1bp, base pair; E, Efficiency; F, Forward; R, Reverse; R2, The coefficient of determination; Tm, melting temperature.

Enzyme-Linked Immunosorbent Assay (ELISA)

Serum LPS and LBP concentrations were determined using commercial competitive ELISA kits (Sheep LPS SL0275, Sheep LBP SL0216; Kendall Scientific, Lincolnshire, IL, USA) according to the manufacturer’s protocol with modifications: undiluted serum was used for LPS analysis, serum was diluted 1:8 with water for LBP analysis, standard and serum sample absorbances were corrected for the plate blank, the standard curves were calculated using 4-parameter logistic regressions with 1/Y2 weighting, and additional standards of 25 ng/mL for the LPS assay and 0.5 ng/mL for the LBP assay were included. The results reported are averages of the technical replications. For both assays, the intra-assay CV and inter-assay CV were <11% and <8%, respectively.

Cytokine analysis

Plasma samples were sent to EveTechnologies (Calgary, AB, Canada) for ovine cytokine analysis using the Luminex 200 system (Luminex, Austin, TX, USA). The concentration of anti-inflammatory (IL-10 and IL-36RA), pro-inflammatory (IL-1α, IL-1β, IL-8, MIP-1α, MIP-1β, TNFα, IP-10, and IL-17A), and pleiotropic (IL-6, INFγ, and VEGF-A) cytokines were measured simultaneously using a multiplex immunoassay (the ovine-specific 14-plex Discovery Assay, MilliporeSigma, Burlington, MA, USA) following the manufacturer’s protocol. Before analysis, plasma samples were diluted 1:2 with phosphate-buffered saline (pH 7.5). The range of detection was from 0.04 to 2,000 pg/Ml, and intra-assay CV was ≤18%. The anti-inflammatory cytokine, IL-4, was below the detection limit and, therefore not reported.

Statistical analysis

Data were analyzed as a randomized complete block design (block = BW group; n = 4 blocks). Tight junction, VIP, and VPAC-1 expression, and LPS and LBP concentration data were analyzed using the MIXED procedure in SAS (SAS 9.4, SAS Institute Inc., Cary, NC, USA), with treatment and block as fixed effects. Day 0 concentrations of LPS and LBP were used as a covariate in the model to account for possible differences in basal concentrations between treatments. Cytokine data were analyzed using repeated measures and the MIXED procedure of SAS, with treatment and block included as fixed effects and day 0 concentrations used as a covariate. Five covariance structures (autoregressive 1, compound symmetry, toeplitz, variance components, and unstructured) were compared for each cytokine and unstructured was selected based on having the lowest fit statistics, as detailed by Wang and Goonewardene (2004). When the treatment-by-day interaction was significant, interactive means were compared using the least significant difference method. Results were considered significant when P ≤ 0.05 and tended to be different when P > 0.05 and P ≤ 0.10.

Results

Exogenous treatment with VIP did not influence (P ≥ 0.38) the endogenous mRNA expression of VIP or VPAC-1 in the colon (Figure 1). Treatment with VIP did not influence (P ≥ 0.28) the mRNA expression of claudin-1, claudin-4, occludin, and ZO-1 in the rumen, jejunum, cecum, and colon (Figure 2).

Figure. 1.

Figure. 1.

Effect of vasoactive intestinal polypeptide (VIP) treatment on the endogenous mRNA expression of colonic VIP and the receptor of VIP (VPAC-1) in lambs fed a grain-based diet.

Figure. 2.

Figure. 2.

Effect of vasoactive intestinal polypeptide (VIP) treatment on ruminal, jejunal, cecal, and colonic relative tight junction (claudin-1, claudin-4, occludin, and ZO-1) mRNA expression in lambs fed a grain-based diet.

Serum LPS and LBP concentrations were less (P ≤ 0.05) in VIP-treated lambs than in control lambs (Figure 3). In addition, LPS and LBP concentration was greater (P ≤ 0.05) on day 28 than on day 0 in control lambs while LPS and LPB did not differ (P ≥ 0.73) between days 0 and day 28 in VIP-treated lambs (Supplementary Table 4).

Figure. 3.

Figure. 3.

Effect of vasoactive intestinal polypeptide (VIP) treatment on serum lipopolysaccharide (LPS) and LPS-binding protein (LBP) concentrations in lambs fed a grain-based diet.

There were treatment-by-day interactions for MIP-1α and MIP-1β (P ≤ 0.02, Table 2) because the effects of VIP were not consistent across the day. Plasma concentrations of the anti-inflammatory cytokines, IL-36RA and IL-10, were greater (P ≤ 0.01), and the concentration of the pro-inflammatory cytokine, IL-1β, tended to be lower (P = 0.06) in VIP-treated lambs compared to control lambs. Additionally, plasma concentrations of the pro-inflammatory cytokine, IL-8, decreased (P = 0.001) as the days progressed. However, plasma concentrations of other pro-inflammatory (IL-1α, TNFα, IP-10, and IL-17A) and pleiotropic (IL-6, INFγ, and VEGF-A) cytokines were not influenced (P ≥ 0.15) by VIP treatment.

Table 2.

Effects of VIP treatment on plasma anti-inflammatory, pro-inflammatory, and pleiotropic cytokines in lambs fed a grain-based diet1

Cytokines,
pg/mL
Treatment2 SEM3 P-value
Control VIP
Day Day
7 14 21 28 7 14 21 28 Trt day Trt × day
Anti-inflammatory IL-36RA 60.2 76.6 78.7 52.2 79.0 118.4 124.0 118.0 15.1 0.006 0.40 0.71
IL-10 98.4 120.0 98.2 138.8 183.0 149.8 201.4 206.7 27.1 0.01 0.88 0.80
Pro-inflammatory IL-1α 5.80 6.54 5.40 6.62 4.96 4.51 5.43 6.15 1.38 0.55 0.93 0.94
IL-1β 96.4 124.4 123.5 178.1 109.7 83.1 81.0 93.4 20.3 0.06 0.51 0.52
IL-8 1581 1069 1319 821.1 1049 1155 959.6 859.7 223.8 0.39 0.001 0.13
MIP-1α 176.9a 183.1a 170.9a 170.1a 165.7a 135.6b 169.3a 188.1a 37.7 0.74 0.05 0.004
MIP-1β 6.87a 5.74a 3.30b 3.26b 5.34a 4.42a 4.49a 6.16a 1.99 0.87 0.04 0.02
TNFα 491.2 588.2 477.1 549.4 712.9 531.8 723.1 718.3 162.5 0.38 0.81 0.47
IP-10 555.8 541.6 959.6 464.4 619.8 665.5 605.2 529.8 124.2 0.83 0.43 0.50
IL-17A 7.24 6.97 6.59 6.17 5.70 4.74 4.00 4.96 1.70 0.28 0.33 0.43
Pleiotropic IL-6 78.0 115.6 43.5 64.4 51.2 49.8 47.0 54.4 16.2 0.15 0.21 0.42
INFγ 1.46 1.47 2.49 1.17 1.57 1.18 1.23 1.07 0.40 0.35 0.11 0.58
VEGF-A 52.0 43.8 36.9 37.2 44.7 42.3 44.0 39.4 4.78 0.98 0.14 0.27

1VIP, vasoactive intestinal polypeptide; Trt, treatment.

2Treatments consisted of Control (treated with 0.9%NaCL) and VIP (treated with VIP).

3Standard error of the mean (SEM, n = 8). Pairs of least squares mean with different superscripts (a, b, c, d) differ when P ≤ 0.05 and a tendency to differ when P > 0.05 and P ≤ 0.10.

Discussion

Feeding high-grain diets can result in an immune response because of decreased ruminal pH, the prevalence of pathogenic bacteria (Bains et al., 2019), and endotoxin release (Iwasaki et al., 2019), which ultimately can result in a detrimental effect on overall growth performance. In the companion study (Mia et al., 2024), we observed that exogenous VIP treatment increased ADG in the same lambs as used in this study. This increase in ADG occurred without differences in nutrient intake, digestibility, or the activity of intestinal digestive enzymes. Consequently, the mechanism by which VIP promotes weight gain in lambs fed a concentrate-based diet remains unclear. It is plausible that VIP may mitigate inflammation induced by the high concentrated diet, which may allow for more energy and nutrients to be partitioned to weight gain rather than inflammatory and immune responses. Therefore, further investigation is needed to explore whether VIP supplementation can alleviate inflammation by regulating endotoxins or modulating their passage into the circulatory system from the gut by affecting gut-tight junctions. Additionally, it is important to better understand if VIP supplementation influences the natural endogenous mRNA expression of VIP and its receptor in lambs.

Our previous research in lambs and steers indicated differences in mRNA expression of VIP and VIP receptors among different tissues, with higher mRNA expression observed in the cecum and colon with little or no expression observed in small intestinal or rumen tissues (Hawley et al., 2022). Therefore, we focused on analyzing the mRNA expression of VIP and VIP receptors in the cecum and colon. The findings indicate that VIP treatment did not affect the mRNA expression of VIP or VPAC-1, suggesting that exogenous VIP does not downregulate the endogenous production of VIP or VPAC-1.

In the current study, VIP did not influence mRNA expression of tight junction genes in the gastrointestinal tract. However, past research has suggested that VIP enhances intestinal barrier function in mice (Wu et al., 2015), and reduces the severity of intestinal inflammation that occurs in mice with colitis (Conlin et al., 2009). Furthermore, studies in rat models of acute pancreatitis have shown that VIP can protect the gut barrier by lowering the intestinal mucosal inflammatory response (Zhonkari et al., 2012). By activating cAMP signaling pathways, VIP increases MUC2 mRNA expression in gut epithelial cell lines, thereby enhancing the formation of mucous layers in the gut barrier and serving as a strong protective layer against inflammatory bowel disease (Hokari et al., 2005). Therefore, our present observation suggests that, unlike in nonruminant animals, the effects of VIP may be because of other factors than effects on the gut barrier. However, TJ proteins must be accurately localized at the apical junctions of epithelial cells for the barrier to function properly (Brander, 2009). Therefore, gut permeability may be influenced more by changes in the localization of TJ proteins within the cell than by significant variations in mRNA expression. To better understand the effects of VIP on intestinal barrier function in ruminants, measurement of the localization of TJ proteins is needed.

In our companion study, we reported that ruminal pH for both VIP-treated and control lambs was approximately 5.1 at the end of the treatment period (Mia et al., 2024), a level sufficiently low to likely disrupt bacterial cell walls and release LPS (Alakomi et al., 2000; Helander et al., 2001). Since no significant differences were observed in ruminal pH or mRNA expression of gastrointestinal tight junction mRNA in the current study, it is inferred that intestinal bacterial lysis would be similar, resulting in an expected lack of difference in serum LPS concentrations in the circulation between VIP-treated and saline-treated lambs during the 28-d treatment period. However, in this investigation, LPS concentrations were greater in control lambs than in VIP-treated lambs. This observation supports prior findings of the downregulatory role of VIP on LPS (Gutierrez-Canas et al., 2006). Therefore, VIP-treated lambs may experience less gut inflammation than untreated lambs, as higher LPS concentrations are associated with gastrointestinal inflammation (Netea et al., 2002; Lorenzo et al., 2019). Additionally, the secretion of LBP typically increases with rising LPS concentrations (Djuric, 2017). This may explain why lower serum LBP concentrations were measured in VIP-treated lambs compared to control lambs. Nevertheless, the average concentration of LBP was less than LPS. The maximum detoxification effect of LBP is thought to occur when the binding ratio of LBP to LPS is one-to-one (Goldblum et al., 1994; Viriyakosol et al., 2001). However, LPS detoxification by LBP can be magnified in the presence of soluble CD14 (Goldblum et al., 1994). Further investigation is necessary to determine the presence and activity of soluble CD14 to better understand the toxicity of LPS in these experimental lambs. Also, it is crucial to consider that acidic conditions in the gut not only compromise the gut barrier but also disrupt gut tissue, allowing toxins like LPS to translocate across the intestinal lining into the underlying tissues, which then triggers an immune response (Ge et. al., 2000). Besides measuring free LPS in the blood, assessing LPS concentrations within intestinal tissue may help to improve our understanding of the overall inflammatory status of the experimental lambs.

Cytokines are categorized into pro-inflammatory, anti-inflammatory, and pleiotropic based on their role in inflammation (Su et al., 2012). Consequently, the inflammation status of the animal is largely influenced by the activity of various cytokines. In this study, treatment with VIP increased anti-inflammatory cytokines in grain-fed lambs. These findings align with previous in vivo studies on mice (Zhang et al., 2019; Zhou et al., 2020) and in vitro studies on human pancreatic beta cells (Erendor et al., 2021). Moreover, IL-1β recognized as a pro-inflammatory cytokine (Shen et al., 2020), tended to be lower in lambs treated with VIP vs. control. This finding is consistent with previous findings by Temerozo et al. (2021) where VIP suppressed SARS-CoV-2 inflammation, which supports the role of VIP as a pro-inflammatory suppressor. However, pro-inflammatory mediators are not always harmful. The pro-inflammatory cytokines IL-1β and IL-18 support host defense mechanisms by promoting inflammation, recruiting immune cells, and activating both innate and adaptive immunity, enabling the body to effectively respond to infections and tissue damage (Netea et al., 2010). Therefore, the administration of VIP could dampen these essential immune responses, potentially leading to immunosuppression, which may increase susceptibility to infections.

The current study demonstrated a treatment-by-day interaction for pro-inflammatory cytokines, including MIP-1α and MIP-1β, suggesting that VIP treatment may have a time-dependent effect (Vasyukova et al., 2023), with more pronounced differences emerging later in the treatment period. This observation contradicts previous findings by Temerozo et al. (2021). Additionally, the role of VIP in regulating the pro-inflammatory cytokine IL-8 may differ between ruminant and nonruminant animals. In the current study, IL-8 decreased as the day progressed with no treatment or treatment-by-day interaction. This is different from the earlier mice study and the hypothesis by Zhou et al. (2020), who suggested that VIP binding to its receptors could suppress IL-8 by stimulating cAMP, decreasing reactive oxygen species production, or deactivating the NF-κB complex, thereby mitigating the NLRP3 inflammasome. The other measured pro-inflammatory (IL-1α, TNFα, IP-10, and IL-17A) and pleiotropic (IL-6, INFγ, and VEGF-A) cytokines were largely unaffected by VIP treatment. Therefore, more research into the role of VIP in regulating pro-inflammatory and pleiotropic cytokines in grain-fed ruminants is necessary, particularly in the context of inflammation.

Conclusions

In the present study, VIP treatment decreased circulating concentrations of LPS, but this likely was not mediated by changes in the mRNA expression of tight junction genes in the gastrointestinal tract. Additionally, VIP-treated lambs had increased concentrations of anti-inflammatory cytokines. These inflammation-suppressive roles of VIP may contribute to the enhanced growth performance observed in VIP-treated lambs as observed in the companion study by Mia et al. (2024). By suppressing inflammation, VIP-treated lambs likely require less nutrients and energy for inflammatory responses, thereby allowing for a higher proportion of nutrients and energy to be available for growth. However, the role of VIP in regulating inflammation remains unclear, as VIP may have a dual role in modulating pro-inflammatory cytokines, acting either as a stimulator (for MIP-1α and MIP-1β) or as an inhibitor (for IL-1β). Moreover, further investigation is needed to better understand how VIP influences gut microbiota, pathogenicity, and gastrointestinal function. Also, a more comprehensive analysis of energy and nutrient use and flux is needed to better understand energy and nutrient partitioning towards growth versus immune and other physiological systems.

Supplementary Material

skae309_suppl_Supplementary_Tables_S1-S4_Figure_S1

Acknowledgments

This is collaborative research between the Departments of Animal Sciences and Microbiological Science at North Dakota State University, Fargo, ND 58108-6050, USA. This project was funded by the State Board of Agricultural Research & Education (SBARE). In addition, we would like to thank the employees of the Animal Nutrition and Physiology Center and the Nutrition Laboratory in the Departments of Animal Sciences at North Dakota State University (Fargo, ND) for assistance with the project.

Glossary

Abbreviations

ADG

average daily gain

BW

body weight

cDNA

complementary DNA

ELISA

Enzyme-Linked Immunosorbent Assays

LBP

LPS-binding protein

LPS

lipopolysaccharides

NRT

no reverse transcriptase

NTC

no template controls

OD

optical density

RT-qPCR

reverse transcription quantitative polymerase chain reaction

VIP

vasoactive intestinal polypeptide

Contributor Information

Golam K Mia, Departments of Animal Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Emma Hawley, Departments of Microbiological Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Mustapha Yusuf, Departments of Animal Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Samat Amat, Departments of Microbiological Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Alison K Ward, Departments of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, SK, S7N 5B4, Canada.

Wanda L Keller, Departments of Animal Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Glenn Dorsam, Departments of Microbiological Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Kendall C Swanson, Departments of Animal Sciences, North Dakota State University, Fargo, ND 58108-6050, USA.

Conflict of interest statement

The authors have no financial or nonfinancial conflict of interest or personal interest that may impact the subject matter or materials discussed in this paper.

Author Contributions

Md Mia (Formal analysis, Investigation, Methodology, Writing—original draft), Emma Hawley (Formal analysis, Investigation, Methodology, Writing—review & editing), Mustapha Yusuf (Formal analysis, Methodology, Writing—review & editing), Samat Amat (Formal analysis, Methodology, Writing—review & editing), Alison Ward (Formal analysis, Methodology, Writing—review & editing), Wanda Keller (Formal analysis, Methodology, Writing—review & editing), Glenn Dorsam (Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration), and Kendall Swanson (Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Supervision, Writing—review & editing)

Literature Cited

  1. Alakomi, H. L., Skytta E., Saarela M., Mattila-Sandholm T., Latva-kala K., and Helander I. M... 2000. Lactic acid permeabilizes gram-negative bacteria by disrupting the outer membrane. Appl. Environ. Microbiol. 66:2001–2005. doi: 10.1128/AEM.66.5.2001-2005.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bains, M., Laney C., Wolfe A. E., Orr M., Waschek J. A., Ericsson A. C., and Dorsam G. P... 2019. Vasoactive intestinal peptide deficiency is associated with altered gut microbiota communities in male and female c57bl/6 mice. Front. Microbiol. 10:2689. doi: 10.3389/fmicb.2019.02689 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brander, J. M. 2009. Tight junctions and tight junction proteins in mammalian epidermis. Eur. J. Pharm. Biopharm. 72:289–294. doi: 10.1016/j.ejpb.2008.08.007 [DOI] [PubMed] [Google Scholar]
  4. Bustin, S. A., Benes V., Garson J. A., Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M. W., Shipley G. L.,. et al. 2009. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. J. Clin. Chem. 55:611–622. doi: 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
  5. Chen, X., Oshima T., Tomita T., Fukui H., Watari J., Matsumoto T., and Miwa H... 2011. Acidic bile salts modulate the squamous epithelial barrier function by modulating tight junction proteins. Am. J. Physiol. Gastrointest. Liver Physiol. 301:G203–G209. doi: 10.1152/ajpgi.00096.2011 [DOI] [PubMed] [Google Scholar]
  6. Chen, M., Xie W., Zhou S., Ma N., Wang Y., Huang J., Shen X., and Chang G... 2023. A high-concentrate diet induces colonic inflammation and barrier damage in Hu sheep. J. Dairy Sci. 106:9644–9662. doi: 10.3168/jds.2023-23359 [DOI] [PubMed] [Google Scholar]
  7. Conlin, V. S., Wu X., Nguyen C., Dai C., Vallance B. A., Buchan A. M. J., Boyer L., and Jacobson K... 2009. Vasoactive intestinal peptide ameliorates intestinal barrier disruption associated with Citrobacter rodentium-induced colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 297:G735–G750. doi: 10.1152/ajpgi.90551.2008 [DOI] [PubMed] [Google Scholar]
  8. Djuric, Z. 2017. Obesity-associated cancer risk: the role of intestinal microbiota in the etiology of the host proinflammatory state. Transl. Res. 179:155–167. doi: 10.1016/j.trsl.2016.07.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Erendor, F., Sahin E. O., Sanlioglu A. D., Balci M. K., Griffith T. S., and Sanlioglu S... 2021. Lentiviral gene therapy vectors encoding VIP suppressed diabetes-related inflammation and augmented pancreatic beta-cell proliferation. Gene Ther. 28:130–141. doi: 10.1038/s41434-020-0183-3 [DOI] [PubMed] [Google Scholar]
  10. Fu, Y., He Y., Xiang K., Zhao C., He Z., Qiu M., Hu X., and Zhang N... 2022. The role of rumen microbiota and its metabolites in subacute ruminal acidosis (SARA)-induced inflammatory diseases of ruminants. Microorganisms. 10:1495. doi: 10.3390/microorganisms10081495 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ge, Y., Ezzell R. M., and Warren H. S... 2000. Localization of endotoxin in the rat intestinal epithelium. J. Infect. Dis. 182:873–881. doi: 10.1086/315784 [DOI] [PubMed] [Google Scholar]
  12. Ghosh, S. S., Wang J., Yannie P. J., and Ghosh S... 2020. Intestinal barrier dysfunction, LPS translocation, and disease development. J. Endocr. Soc. 4:bvz039. doi: 10.1210/jendso/bvz039 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Goldblum, S. E., Brann T. W., Ding X., Pugin J., and Tobias S... 1994. Lipopolysaccharide (LPS) binding protein and soluble CD14 function as accessory molecules for LPS-induced changes in endothelial barrier function, in vitro. J. Clin. Invest. 93:692–702. doi: 10.1172/JCI117022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Goto, Y., Calciano L. J., and Fink A. L... 1990. Acid-induced folding of proteins. Proc. Natl. Acad. Sci. USA 87:573–577. doi: 10.1073/pnas.87.2.573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Guo, S., Nighot M., Al-Sadi R., Alhmoud T., Nighot P., and Ma T. Y... 2015. Lipopolysaccharide regulation of intestinal tight junction permeability is mediated by TLR4 signal transduction pathway activation of FAK and MyD88. J. Immunol. 195:4999–5010. doi: 10.4049/jimmunol.1402598 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gutierrez-Canas, I., Juarranz Y., Santiago B., Arranz A., Martinez C., Galindo M., Paya M., Gomariz R. P., and Pablos J. L... 2006. VIP down-regulates TLR4 expression and TLR4-mediated chemokine production in human rheumatoid synovial fibroblasts. Rheumatology. 45:527–532. doi: 10.1093/rheumatology/kei219 [DOI] [PubMed] [Google Scholar]
  17. Gutsmann, T., Müller M., Carroll S. F., MacKenzie R. C., Wiese A., and Seydel U... 2001. Dual role of lipopolysaccharide (LPS)-binding protein in neutralization of LPS and enhancement of LPS-induced activation of mononuclear cells. Infect. Immun. 69:6942–6950. doi: 10.1128/IAI.69.11.6942-6950.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hawley, E., Mia K., Yusuf M., Swanson K. C., Doetkott C., and Dorsam G. P... 2022. Messenger RNA gene expression screening of VIP and PACAP neuropeptides and their endogenous receptors in ruminants. Biology. 11:1512. doi: 10.3390/biology11101512 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Helander, I. M., Nurmiaho-Lassila E. L., Ahvenainen R., Rhoades J., and Roller S... 2001. Chitosan disrupts the barrier properties of the outer membrane of Gram-negative bacteria. Int. J. Food Microbiol. 71:235–244. doi: 10.1016/s0168-1605(01)00609-2 [DOI] [PubMed] [Google Scholar]
  20. Hokari, R., Lee H., Crawley S. C., Yang S. C., J. R.S.Gum-Miura, Jr, and Kim Y. S... 2005. Vasoactive intestinal peptide upregulates MUC2 intestinal mucin via CREB/ATF1. Am. J. Physiol. Gastrointest. Liver Physiol. 289:G949–G959. doi: 10.1152/ajpgi.00142.2005 [DOI] [PubMed] [Google Scholar]
  21. Hungate, R. E. 1975. The rumen microbial ecosystem. Annu. Rev. Ecol. Syst. 6:39–66. doi: 10.1146/annurev.es.06.110175.000351 [DOI] [Google Scholar]
  22. Hyldgaard, M., Sutherland D. S., Sundh M., Mygind T., and Meyer R. L... 2012. Antimicrobial mechanism of monocaprylate. Appl. Environ. Microbiol. 78:2957–2965. doi: 10.1128/AEM.07224-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Iwasaki, M., Akiba Y., and Kaunitz J. D... 2019. Recent advances in vasoactive intestinal peptide physiology and pathophysiology: Focus on the gastrointestinal system. J. F1000Res. 8:1629. doi: 10.12688/f1000research.18039.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Krebs, H. A., Wiggins D., Stubbs M., Sols A., and Bedoya F... 1983. Studies on the mechanism of the antifungal action of benzoate. Biochem. J. 214:657–663. doi: 10.1042/bj2140657 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lai, Z., Lin L., Zhang J., and Mao S... 2022. Effects of high-grain diet feeding on mucosa-associated bacterial community and gene expression of tight junction proteins and inflammatory cytokines in the small intestine of dairy cattle. J. Dairy Sci. 105:6601–6615. doi: 10.3168/jds.2021-21355 [DOI] [PubMed] [Google Scholar]
  26. Lamping, N., Dettmer R., Schröder N. W. J., Pfeil D., Hallatschek W., Burger R., and Schumann R. R... 1998. LPS-binding protein protects mice from septic shock caused by LPS or gram-negative bacteria. J. Clin. Invest. 101:2065–2071. doi: 10.1172/JCI2338 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lechartier, C., and Peyraud J. L... 2010. The effects of forage proportion and rapidly degradable dry matter from concentrate on ruminal digestion in dairy cows fed corn silage-based diets with fixed neutral detergent fiber and starch contents. J. Dairy Sci. 93:666–681. doi: 10.3168/jds.2009-2349 [DOI] [PubMed] [Google Scholar]
  28. Livak, K. J., and Schmittgen T. D... 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  29. Lorenzo, D. F., De Castro C., Silipo A., and Molinaro A... 2019. Lipopolysaccharide structures of Gram-negative populations in the gut microbiota and effects on host interactions. FEMS Microbiol. Rev. 43:257–272. doi: 10.1093/femsre/fuz002 [DOI] [PubMed] [Google Scholar]
  30. Mariscal, L. G., Betanzos A., Nava P., and Jaramillo B. E... 2003. Tight junction proteins. Prog. Biophys. Mol. Biol. 81:1–44. doi: 10.1016/S0079-6107(02)00037-8 [DOI] [PubMed] [Google Scholar]
  31. Maurer, L. M., Yohannes E., Bondurant S. S., Radmacher M., and Slonczewski J. L... 2005. pH regulates genes for flagellar motility, catabolism, and oxidative stress in Escherichia coli K-12. J. Bacteriol. 187:304–319. doi: 10.1128/JB.187.1.304-319.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mia, G. K., Hawley E., Yusuf M., Dorsam G., and Swanson K. C... 2024. Influence of vasoactive intestinal polypeptide on growth performance, nutrient digestibility, nitrogen balance, and digestive enzyme activity in lambs. J. Anim. Sci. 102:skae112. doi: 10.1093/jas/skae112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Netea, M. G., Deuren M. V., Kullberg B. J., Cavaillon J. M., and Van-der-Meer J. W. M... 2002. Does the shape of lipid A determine the interaction of LPS with Toll-like receptors? Trends Immunol. 23:135–139. doi: 10.1016/S1471-4906(01)02169-X [DOI] [PubMed] [Google Scholar]
  34. Netea, M. G., Simon A., Veerdonk F., Kullberg B. J., Van-der-Meer J. W. M., and Joosten L. A. B... 2010. IL-1β processing in host defense: beyond the inflammasomes. PLoS Pathog. 6:e1000661. doi: 10.1371/journal.ppat.1000661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Portincasa, P., Bonfrate L., Khalil M., De Angelis M., Calabrese F. M., Damato M., Wang D. Q. H., and Ciaula A. D... 2022. Intestinal barrier and permeability in health, obesity and NAFLD. Biomedicines. 10:83. doi: 10.3390/biomedicines10010083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Royce, L. A., Liu P., Stebbins M. J., Hanson B. C., and Jarboe L. R... 2013. The damaging effects of short chain fatty acids on Escherichia coli membranes. Appl. Microbiol. Biotechnol. 97:8317–8327. doi: 10.1007/s00253-013-5113-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sharma, R., Young C., and Neu J... 2010. Molecular modulation of intestinal epithelial barrier: Contribution of microbiota. J. Biomed. Biotechnol. 2010:305879. doi: 10.1155/2010/305879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Shen, Y., Malik S. A., Amir M., Kumar P., Cingolani F., Wen J., Liu Y., Zhao E., Farris A. B., Raeman R.,. et al. 2020. Decreased hepatocyte autophagy leads to synergistic IL-1β and TNF mouse liver injury and inflammation. Hepatology 72:595–608. doi: 10.1002/hep.31209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Su, D. L., Lu Z. M., Shen M. N., Li X., and Sun L. Y... 2012. Roles of pro- and anti-inflammatory cytokines in the pathogenesis of SLE. J. Biomed. Biotechnol. 2012:347141. doi: 10.1155/2012/347141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Temerozo, R. J., Sacramento C. Q., Fintelman-Rodrigues N., Pao C. R. R., de-Freitas C. S., Dias S. S. G., Ferreira A. C., Mattos M., Soares V. C., Teixeira L.,. et al. 2021. VIP plasma levels associate with survival in severe COVID-19 patients, correlating with protective effects in SARS-CoV-2-infected cells. J. Leukocyte Biol. 111:1107– 1121. doi: 10.1002/JLB.5COVA1121-626R [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tommaso, D. N., Gasbarrini A., and Ponziani F. R... 2021. Intestinal barrier in human health and disease. Int. J. Environ. Res. Public Health 18:12836. doi: 10.3390/ijerph182312836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Vasyukova, E., Zaikova E., Kalinina O., Gorelova I., Pyanova I., Bogatyreva E., Vasilieva E., Grineva E., and Popova P... 2023. Inflammatory and anti-inflammatory parameters in PCOS patients depending on body mass index: a case-control study. Biomedicines. 11:2791. doi: 10.3390/biomedicines11102791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Viriyakosol, S., Tobias P. S., Kitchens R. L., and Kirkland T. N... 2001. MD-2 binds to bacterial lipopolysaccharide. J. Biol. Chem. 276:38044–38051. doi: 10.1074/jbc.M105228200 [DOI] [PubMed] [Google Scholar]
  44. Wang, Z., and Goonewardene L. A... 2004. The use of MIXED models in the analysis of animal experiments with repeated measures data. Can. J. Anim. Sci. 84:1–11. doi: 10.4141/A03-123 [DOI] [Google Scholar]
  45. Wang, H. D., Lu D. X., and Qi R. B... 2009. Therapeutic strategies targeting the LPS signaling and cytokines. Pathophysiology. 16:291–296. doi: 10.1016/j.pathophys.2009.02.006 [DOI] [PubMed] [Google Scholar]
  46. Wu, X., Conlin V. S., Morampudi V., Ryz N. R., Nasser Y., Bhinder G., Bergstrom K. S., Yu H. B., Waterhouse C. C. M., Buchan A. M. J.,. et al. 2015. Vasoactive intestinal polypeptide promotes intestinal barrier homeostasis and protection against colitis in mice. PLoS One 10:e0125225. doi: 10.1371/journal.pone.0125225 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xu, C., Wang Y., Sun R., Qiao X., Shang X., and Niu W... 2014. Modulatory effects of vasoactive intestinal peptide on intestinal mucosal immunity and microbial community of weaned piglets challenged by an enterotoxigenic Escherichia coli (K88). PLoS One 9:e104183. doi: 10.1371/journal.pone.0104183 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang, W. Z., and Beauchemin K. A... 2009. Increasing physically effective fiber content of dairy cow diets through forage proportion versus forage chop length: Chewing and ruminal pH. J. Dairy Sci. 92:1603–1615. doi: 10.3168/jds.2008-1379 [DOI] [PubMed] [Google Scholar]
  49. Ye, J., Coulouris G., Zaretskaya I., Cutcutache I., Rozen S., and Madden T. L... 2012. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 13:134. doi: 10.1186/1471-2105-13-134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zebeli, Q., Tafaj M., Weber I., Steingass H., and Drochner W... 2008. Effects of dietary forage particle size and concentrate level on fermentation profile, in vitro degradation characteristics and concentration of liquid- or solid-associated bacterial mass in the rumen of dairy cows. Anim. Feed Sci. Technol. 140:307–325. doi: 10.1016/j.anifeedsci.2007.04.002 [DOI] [Google Scholar]
  51. Zhang, Y. F., Zhang J., Sun C. C., Tang C. Y., Sun G. Y., Luo W. J., Zhou Y., and Guan C. X... 2019. Vasoactive intestinal peptide inhibits the activation of murine fibroblasts and expression of interleukin 17 receptor C. Cell Biol. Int. 43:770–780. doi: 10.1002/cbin.11151 [DOI] [PubMed] [Google Scholar]
  52. Zhongkai, L., Jianxin Y., and Weichang C... 2012. Vasoactive intestinal peptide promotes gut barrier function against severe acute pancreatitis. Mol. Biol. Rep. 39:3557–3563. doi: 10.1007/s11033-011-1129-z [DOI] [PubMed] [Google Scholar]
  53. Zhou, Y., Zhang C. Y., Duan J. X., Li Q., Yang H. H., Sun C. C., Zhang J., Luo X. Q., and Liu S. K... 2020. Vasoactive intestinal peptide suppresses the NLRP3 inflammasome activation in lipopolysaccharide-induced acute lung injury mice and macrophages. Biomed. Pharmacother. 121:109596. doi: 10.1016/j.biopha.2019.109596 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

skae309_suppl_Supplementary_Tables_S1-S4_Figure_S1

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES