Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Percp-Cy5.5 anti-mouse CD45.2 (104) | BioLegend | Cat# 109828; RRID: AB_893350 |
| FITC anti-mouse CD45.1 Antibody (A20) | BioLegend | Cat# 110706; RRID: AB_313495 |
| Brilliant Violet 711 anti-mouse CD326 (Ep-CAM) (G.8) | BioLegend | Cat# 118233; RRID: AB_2632775 |
| PerCP/Cyanine5.5 anti-mouse CD31 (MEC13.3) | BioLegend | Cat# 102522; RRID: AB_2566761 |
| Brilliant Violet 785™ anti-mouse CD90.2 (Thy1.2) (30-H12) | BioLegend | Cat# 105331; RRID: AB_2562900 |
| Brilliant Violet 605™ anti-mouse Ly-6A/E (Sca-1) (D7) | BioLegend | Cat# 108134; RRID: AB_2650926 |
| PE/Cyanine7 anti-mouse CD26 (DPP-4) (H194-112) | BioLegend | Cat# 137810; RRID: AB_2564312 |
| Biotin anti-mouse CD9 (MZ3) | BioLegend | Cat# 124804; RRID: AB_2275863 |
| FITC anti-mouse I-A/I-E (M5/114.15.2) | BioLegend | Cat# 107606; RRID: AB_313321 |
| PE/Cyanine7 anti-mouse CD11c (N418) | BioLegend | Cat# 117318; RRID: AB_493568 |
| Brilliant Violet 605 anti-mouse Ly6C (HK1.4) | BioLegend | Cat# 128036; RRID: AB_2562353 |
| Brilliant Violet 421 anti-mouse Ly-6G (1A8) | BioLegend | Cat# 127628; RRID: AB_2562567 |
| Brilliant Violet 785 anti-mouse/human CD11b (M1/70) | BioLegend | Cat# 101243; RRID: AB_2561373 |
| APC anti-mouse CD64 (FcγRI) (X54-5/7.1) | BioLegend | Cat# 139306; RRID: AB_11219391 |
| PE anti-human/mouse CD49f (Itga6) (GoH3) | BioLegend | Cat# 313612; RRID: AB_893373 |
| Brilliant Violet 605™ anti-mouse CD103 (2E7) | BioLegend | Cat# 121433; RRID: AB_2629724 |
| APC anti-mouse/human CD207 (Langerin) (4C7) | BioLegend | Cat# 144206; RRID: AB_2561998 |
| Biotin anti-βIII-tubulin (TUJ1) | BioLegend | Cat# 801212; RRID: AB_2721321 |
| PE anti-mouse F4/80 (BM8) | BioLegend | Cat# 123110; RRID: AB_893486 |
| APC anti-mouse CD172a (SIRPα) (P84) | BioLegend | Cat# 144014; RRID: AB_2564061 |
| FITC anti-mouse Ly-6G/Ly-6C (Gr-1) (RB6-8C5) | BioLegend | Cat# 108406; RRID: AB_313371 |
| Rabbit mAb anti-HA-Tag (C29F4) | Cell Signaling | Cat# #3724; RRID: AB_1549585 |
| Alexa Fluor 647 Mouse anti-Ki67 (B56) | BD Biosciences | Cat# 558615; RRID: AB_647130 |
| FITC mouse anti-Cytokeratin 14 (LL002) | Invitrogen | Cat# MA5-28125; RRID: AB_2745108 |
| Goat anti-mouse Spp1 polyclonal | R&D Systems | Cat# AF808; RRID: AB_2194992 |
| Fixable Viability Dye eFluor™ 780 | Fisher Scientific | Cat# 65-0865-18 |
| Rabbit Anti c-Fos (9F6) | Cell Signaling | Cat# 2250; RRID: AB_2247211 |
| Alexa Flour 647 Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Ab | Invitrogen | Cat# A21245; RRID: AB_2535813 |
| Alexa Flour 647 Donkey anti-Goat IgG (H+L) Highly Cross-Adsorbed Ab | Invitrogen | Cat# A-21447; RRID: AB_2535864 |
| Alexa Fluor® 488 AffiniPure™ Goat Anti-Guinea Pig IgG (H+L) | Jackson ImmunoResearch | Cat# 106-545-003; RRID: AB_2337438 |
| Guinea pig anti-TRPV1 | Invitrogen | Cat # PA1-29770; RRID: AB_1958678 |
| TotalSeq™-A0301 anti-mouse Hashtag 1 | BioLegend | Cat # 30-F11; RRID: AB_2750032 |
| TotalSeq™-A0302 anti-mouse Hashtag 2 | BioLegend | Cat #155803; RRID: AB_2750033 |
| InVivoMAb anti-mouse Ly6G (1A8) | BioXCell | Cat # BE0075-1; RRID: AB_1107721 |
| InVivoMAb Anti-Spp1 neutralizing antibody (100D3) | BioXCell | Cat # #BE0372; RRID: AB_2927509 |
| InVivoMAb anti-mouse CSF1R (AFS98) | BioXCell | Cat # BE0213; RRID: AB_2687699 |
| Chemicals, peptides, and recombinant proteins | ||
| Liberase TM Research Grade | Roche/Sigma | Cat # LIBTM-RO |
| Deoxyribonuclease I from bovine pancreas | Sigma | Cat# DN25 |
| Fluoroshield™ with DAPI | Sigma-Aldrich | Cat# F6057 |
| hyaluronidase | Sigma-Aldrich | Cat# H3506 |
| CGRP 8-37 (rat) | Tocris | Cat# 1169 |
| QWF | Tocris | Cat# 6642 |
| R428 | APExBIO | Cat # A8329 |
| Diphtheria Toxin (DT) | Calbiochem /Sigma | Cat# 322326 |
| Clozapine N-oxide | Tocris | Cat# 4936 |
| Critical commercial assays | ||
| BD Cytofix/Cytoperm™ Fixation/Permeabilization Kit | BD Biosciences | Cat # 323100 |
| RNAscope multiplex fluorescent detection kit v2 | ACD | Cat # 323100 |
| TSA Vivid Fluorophore Dyes 520 | ACD | Cat # 323271 |
| TSA Vivid Fluorophore Dyes 650 | ACD | Cat # 323273 |
| Spp1 probe | ACD | Cat # 435191 |
| Lepr probe | ACD | Cat # 402731-C2 |
| In Situ Cell Death Detection Kit, Fluorescein | Roche/Sigma | Cat # 11684795910 |
| Clodrosome | Encapsula Nano Sciences | Cat # CLD-8909 |
| Deposited data | ||
| Raw data | Lie et al.41 | GEO: GSE160513 |
| Mouse 3’-single-cell RNA-seq data (sorted Lin- Thy1+ SCA1+). | This manuscript | GEO: GSE266028 |
| Mouse 3’-single-cell RNA-seq data (sorted CD45+). | This manuscript | GEO: GSE266027 |
| Experimental models: Organisms/strains | ||
| C57BL/6J | Jackson | B6 background |
| BoyJ (CD45.1) | Jackson | B6 background |
| TRPV1Cre | Allen Basbaum, UCSF84 | B6 background |
| B6N;129-Tg(CAG-CHRM3*,-mCitrine)1Ute/J | Jackson 85 | B6 background |
| C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J | Jackson86 | B6 background |
| B6.129P2 Gt(ROSA)26Sortm1(DTA)Lky/J | Jackson 87 | B6 background |
| B6.129(Cg)-Scn10atm2(cre)Jwo/TjpJ | Jackson 75 | B6 background |
| B6.129X1-Twist2tm1.1(cre)Dor/J | Jeffery Bush, UCSF 88 | B6 background |
| B6.129S2(Cg)-Ramp1tm1.1Tsuj/WkinJ | Jackson 18 | B6 background |
| CD64Cre | Russell Vance, UC Berkeley 89 | B6 background |
| B6.129S6(Cg)-Spp1tm1Blh/J | Jackson46 | B6 background |
| Gnas floxed | Guo Huang, UCSF 90 | B6 background |
| C57BL/ 6N-Ramp1<tm1c(EUCOMM)Wtsi>/H | Pierangelo Geppetti, University of Florence, Italy | B6 background |
| Oligonucleotides | ||
| TGG CTA AGG ACC AAG ACC ATC CAA -Fwd (IL6 qPCR) | This paper | N/A |
| AAC GCA CTA GGT TTG CCG AGT AGA- Rev (IL6 qPCR) | This paper | N/A |
| TCTTCTGTCTACTGAACTTCGGGGT- Fwd (TNF qPCR) | This paper | N/A |
| GGCCATAGAACTGATGAGAGGG - Rev (TNF qPCR) | This paper | N/A |
| GACCTGGGCACCATCCAT- Fwd (TGFb1 qPCR) | This paper | N/A |
| CCGCACACAGCAGTTCTT- Rev (TGFb1 qPCR) | This paper | N/A |
| ATC CCT CAA AGC TCA GCG TGT C- Fwd (IL17 qPCR) | This paper | N/A |
| GGG TCT TCA TTG CGG TGG AGA G- Rev (IL17 qPCR) | This paper | N/A |
| TAT CCA GTG TGA AGA TGG TTG TG- Fwd (IL23 qPCR) | This paper | N/A |
| CAC TAA GGG CTC AGT CAG AGT TG- Rev (IL23 qPCR) | This paper | N/A |
| Oligonucleotides for Aurkb, Ccnb1, Ccnb2, Cdca2, Rad51, Prc1 and Cdk1 provided in Figure S3A. | This paper | N/A |
| Software and algorithms | ||
| FlowJo (v.10.6.2) | FlowJo™Software | N/A |
| Prism (GraphPad 9.0.1) | GraphPad Software | N/A |
| CellChat R package (1.6.1) | Jin et al. 67 | https://github.com/sqjin/CellChat |
| CellRanger (version 7.0.0) | Zheng et al.91 | https://github.com/10XGenomics/cellranger |
| Seurat R package (4.0.4) | Hao et al. 92 | https://github.com/satijalab/seurat |
| Scanpy (1.8.2) | Wolf et al. 93 | https://github.com/theislab/scanpy |