REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rat anti-PDPN (NZ-1)	AngioBio	Cat# 11-009
Cocktail Anti Hu CD3 FITC/(CD16 + 56) PE Cktl	BioLegend	Cat# 319101, RRID:AB_314999
Anti-human CD3 PE/Cy7	Thermo Fisher Scientific	Cat# 25-0037-42, RRID:AB_2573326
Anti-human CD56 PE	Thermo Fisher Scientific	Cat# 12-0567-42, RRID:AB_10598200
Human TruStain FcXTM (Fc Receptor Blocking Solution)	BioLegend	Cat# 422302, RRID:AB_2818986
FITC Streptavidin	BioLegend	Cat#405202
Anti-p-Tyr (PY20) HRP	BD Biosciences	Cat# 610012, RRID:AB_397433
Hrizon V450 streptavidin	BD Biosciences	Cat#560797
Rabbit Anti-AKT	Cell Signaling Technology	Cat# 9272, RRID:AB_329827
Rabbit Anti-p-AKT	Cell Signaling Technology	Cat# 9271, RRID:AB_329825
Rabbit Anti-p44/42 MAPK (ERK1/2)	Cell Signaling Technology	Cat# 4695, RRID:AB_390779
Rabbit Anti-phospho ERK1/2	Cell Signaling Technology	Cat# 4370, RRID:AB_2315112
Goat Anti-rabbit IgG, HRP	Cell Signaling Technology	Cat# 7074, RRID:AB_2099233
Anti-rabbit IgG Fab2 Alexa 555	Cell Signaling Technology	Cat# 4413, RRID:AB_10694110
Anti-mouse IgG Fab2 Alexa 647	Cell Signaling Technology	Cat# 4410, RRID:AB_1904023
Anti-Rat IgG-HRP	Proteintech	Cat# SA00001-15, RRID:AB_2864369
Goat TrueBlot anti-goat Ig HRP	Rockland	Cat# 18-8814-31, RRID:AB_2610843
Anti-human p75/AIRMI(Siglec-7)-biotin	Thermo Fisher Scientific	Cat# 13-5759-80, RRID:AB_763630
Anti-mouse IgG HRP	Cytiva	Cat# NA931, RRID:AB_772210
Rabbit Anti-MUC13	IMGENEX	Cat# IMG-6250A, RRID:AB_1930301
Anti-mouse IgG Alexa 488	Thermo Fisher Scientific	Cat# A-21206, RRID:AB_2535792
Phalloidin Alexa 647	Invitrogen	Cat# A22287
Anti-p-Tyr (4G10) HRP	Millipore	Cat# 16-105, RRID:AB_310779
Rabbit Anti-SHP-1	Millipore	Millipore Cat# 07-419, RRID:AB_310601
Goat polyclonal Anti-Siglec-7/CD328	R and D Systems	Cat# AF1138, RRID:AB_2189416
Mouse Anti-PODXL (3D3)	Santa Cruz Biotechnology	Cat# sc-23904, RRID:AB_2166006
4′,6-diamidino-2-phenylindole (DAPI)	Sigma-Aldrich	Cat#D9542
Mouse monoclonal Anti-β-Actin	Sigma-Aldrich	Cat# A1978, RRID:AB_476692
Anti-human IgG (Fc specific) FITC	Sigma-Aldrich	Cat# F9512, RRID:AB_259808
PE anti-human IgG Fc	BioLegend	Cat# 410708, RRID:AB_2565786
Anti-mouse IgG FITC	Sigma-Aldrich	Cat# F0257, RRID:AB_259378
ABC standard kit Elite	Vector	Cat#PK-6100
Anti-GD3 monoclonal antibody	kindly provided by Dr. L. J. Old (Memorial Sloan Kettering Cancer Center)	N/A
Purified anti human CD328 (Siglec-7) (Blocking Antibody)	BioLegend	Cat# 347702, RRID:AB_2189411
Mouse IgG1 Isotype Control	R and D Systems	Cat# MAB002, RRID:AB_357344
Peanut Agglutinin (PNA), biotinylated	Sigma	Cat# L6135
7-AAD Viability Staining Solution	BioLegend	Cat# 420404
APC Annexin V	BioLegend	Cat# 640920
Biological samples
Human PBMC (Lot No. 22TL227189)	Lonza	Cat# CC-2704
Chemicals, peptides, and recombinant proteins
ECL select	Amersham	Cat# RPN2235
ITS Premix Universal Culture Supplement	Corning	Cat# 354351
ITS Liquid Media Supplement (100x)	Sigma	Cat# I3146
Matrigel	Corning	Cat# 356234
transwell filter (8-μm pore)	Corning	Cat# 3422
Ficoll-Paque PLUSTM	Cytiva	Cat# 17-1440-02
EDTA3Na	DOJINDO	Cat# 342-01875
Sodium pyruvate	Gibco	Cat# 11360070
Opti-MEM	Gibco	Cat# 31985070
GlutaMAX spplement	Gibco	Cat# 35-050-061
Penicillin-Streptomycin	Gibco	Cat# 15140122
nProtein A Sepharose 4 Fast Flow 5mL	GE	Cat# 17528001
Lipofectamin 2000TM	Invitrogen	Cat# 11668019
Lipofectamin 3000TM	Thermo Fisher	Cat# L3000001
Acetonitrile LC/MS grade	Kanto Chemical	Cat# 01033-23
Trifluoroacetic acid HPLC grade	Kanto Chemical	Cat# 40578-1B
Acetic acid	Kanto Chemical	Cat# 01021-96
ammonium formate	Kanto Chemical	Cat# 01033-76
3-methyl-1-phenyl-5-pyrazolone	Kanto Chemical	Cat# 32148-30
polyvinyldene fluoride (PVDF) membrane	Millipore	Cat# IPVH00010
N-Acetylneuraminic Acid (Neu5Ac)	Nacarai	Cat# 08371-36
Hind III	New England Biolabs Japan	Cat# R0104
Bam HI	New England Biolabs Japan	Cat# R0136
Trypsin	Promega	Cat# V5280
IL-2	PeproTech	Cat# 200-02
Phenylmethylsulfonyl fluoride	Roche	Cat# 10837091001
ammonium bicarbonate	Sigma	Cat# A6141
GalNAc	Tokyo Chemical Industry	Cat# G0007
Tris	WAKO	Cat# 103133
G418	WAKO	Cat# 076-05962
BSA	WAKO	Cat# 011-27055
Tunicamycin	WAKO	Cat# 202-08241
Kifunensine	Sigma	Cat# K1140
Benzyl-α-GalNAc	MCH	Cat# HY-129389
Nonidet P-40	WAKO	Cat# 21-3277
sodium deoxycholate	WAKO	Cat# 190-08313
sodium lauroylsarcosine	WAKO	Cat# 121-05502
dithiothreitol	WAKO	Cat# 048-29224
iodoacetamide	WAKO	Cat# 091-02153
Triethylamine	WAKO	Cat# 202-02641
Lys-C	WAKO	Cat# 125-05061
D-Galactoce	WAKO	Cat# 071-00032
Methanol	WAKO	Cat# 131-01826
Neuraminidase (Vibrio cholerae)	Roche	Cat# 11080725001
Neuraminidase (Arthrobacter ureafaciens)	Nacarai	Cat# 24229-74
a2-3 Neuraminidase S	Prozyme	Cat# GK80020
a2-3 Neuraminidase S	NEB	Cat# P0743S
Formic acid	WAKO	Cat# 063-04533
Critical commercial assays
QuikChange II XLTM site-directed mutagenesis kit	Agilent	Cat# 200521
Cell proliferation kit	Cytiva	Cat# RPN20
CytoTox 96 Nonradioactive Cytotoxicity AssayTM kit	Promega	Cat# G1780
EZ-Link Sulfo-NHS-LC-Biotin	Thermo	Cat# 21335
Deposited data
Raw and analyzed data	This paper; Mendeley Data	https://doi.org/10.17632/r95br5ndzg.1
Experimental models: cell lines
DLD-1	ATCC	Cat# CCL-221, RRID:CVCL_0248 STR profile: https://doi.org/10.17632/r95br5ndzg.1
Caco-2	ATCC	Cat# HTB-37, RRID:CVCL_0025
WiDr	ATCC	Cat# CCL-218, RRID:CVCL_2760
HCT116	RIKEN BRC	Cat# RCB2979, RRID:CVCL_0291
SW837	JCBR Cell Bank	JCBR9115
MCF7	ATCC	HTB-22, RRID:CVCL_0031
K-562	ATCC	CCL-243, RRID:CVCL_0004
LN319	Kindly provided by Dr. Kato (Tohoku Univ)42	N/A
HEK293T	ATCC	Cat: RCRL-3216 RRID:CVCL_0063
U937-mock	Kindly provided by Dr. Yamaji (Nat. Inst. Infections Diseases)39	N/A
KHYG-1	Kindly provided by Dr. Kimura (Nagoya Univ. Virology), JCRB Cell Bank59	N/A
Oligonucleotides
PDPN extracellular cloning primer Forward 5′-ggaagcttcctccaaccccagattaaatgctgactccgctcgg-3′	See Construction of expression vector in this study	N/A
PDPN extracellular cloning primer Reverse 5′-ggggatccacttacctgtaactgttgtctgtgtgtctc-3′	See Construction of expression vector in this study	N/A
PDPN signal sequence cloning primer Forward 5′-ggaagcttcctccaaccccagattaaatgctgactccgctcgg-3′	See Construction of expression vector in this study	N/A
PDPN signal sequence cloning primer Reverse 5′-ggggatccacttacctgttccttctgccaggacccaga-3′	See Construction of expression vector in this study	N/A
hSt3gal1 qPCR primer forward, 5′- GGCACCATTTCCCACACCTA -3′	See Construction of expression vector in this study	N/A
hSt3gal1 qPCR primer reverse 5′- ACAAGTCCACCTCATCGCAG -3′	See Construction of expression vector in this study	N/A
hSt6galnac1 qPCR primer forward 5′- CAAAGCCTTCCAGGCATCAAC -3′	See Construction of expression vector in this study	N/A
hSt6galnac1 qPCR primer reverse 5′- GGCACTGGCTCTGCATAGAT -3′	See Construction of expression vector in this study	N/A
hSt6galnac3 qPCR primer forward 5′- GGCCTGCATCCTGAAGAGAAA -3′	See Construction of expression vector in this study	N/A
hSt6galnac3 qPCR primer reverse 5′- ACCAGGTTGTCCAAAGCAGT -3′	See Construction of expression vector in this study	N/A
hSt8sia6 qPCR primer forward 5′- TCTGAATGAGAAGTCGCTCCA-3′	See Construction of expression vector in this study	N/A
hSt8sia6 qPCR primer reverse 5′- GCATCACAGCAGGAAGCAAG -3′	See Construction of expression vector in this study	N/A
mSt3gal1 qPCR primer forward 5′- ATTGGAGGGAGGGGATGGGA -3′	See Construction of expression vector in this study	N/A
mSt3gal1 qPCR primer reverse 5′- ACGGTATCTTGCCCCTCTGC -3′	See Construction of expression vector in this study	N/A
mSt6galnac1 qPCR primer forward 5′- GGACCAGCCATCCACCATGA -3′	See Construction of expression vector in this study	N/A
mSt6galnac1 qPCR primer reverse 5′- CCTGGGCACTTGCGTCATTC -3′	See Construction of expression vector in this study	N/A
mSt6galnac3 qPCR primer forward 5′- ACCTCAGCACTGGCTGGTTT -3′	See Construction of expression vector in this study	N/A
mSt6galnac3 qPCR primer reverse 5′- CCCCATACGGGGCATGTTCA -3′	See Construction of expression vector in this study	N/A
mSt8sia6 qPCR primer forward 5′- ACTGGCTTCCTGTTGCGATG -3′	See Construction of expression vector in this study	N/A
mSt8sia6 qPCR primer reverse 5′- GTCCACAAAAGGCTGCGACA -3′	See Construction of expression vector in this study	N/A
Recombinant DNA
ST expression vectors	See Table S2 in this study.	N/A
pEE14-Siglec-7-Fc	Zang et al.21	kindly provided by Dr. Crocker at the University of Dundee
pEE14-Siglec-9-Fc	Zang et al.21	kindly provided by Dr. Crocker at the University of Dundee
pcDNA3.1 Siglec-7	kindly provided by Dr. Yamaji (Nat. Inst. Infections Diseases)39	N/A
PDPN (NM_001006624) Human Untagged Clone	OriGENE	Cat#SC301085
pcDNA3.1 PDPN	This paper	N/A
pcDNA3.1 PDPN T52A	This paper	N/A
pEE14-PDPN-Fc	This paper	N/A
pEE14-PDPN T52A-Fc	This paper	N/A
pEE14-Fc	This paper	N/A
Software and algorithms
Analyst TF and LCMS Peptide Reconstruct software tool	Sciex	https://sciex.jp/products/software/analyst-tf-software
ImageJ	NIH	https://ImageJ.nih.gov/ij/
R (4.2.0)	Ihaka, R., and R. Gentleman. 1996.	http://www.R-project.org.
Adobe Photoshop	Adobe Inc., 2023. Adobe Photoshop	https://www.adobe.com/products/photoshop.html
GraphPad Prism version 10.2.3	GraphPad Soft Ware, LLC	https://www.graphpad.com/
Excel for mac	Micro soft	https://www.microsoft.com/ja-jp/microsoft-365/mac/microsoft-365-for-mac
FLUOVIEW Viewer	Olympus	https://www.olympus-lifescience.com