Table 1. Guide RNA (gRNA) sequences for editing the coding part of exon 3 of the PRF1 gene [gene ID 5551; Homo sapiens chromosome 10, GRCh38.14, NC_000010.11(70597348..70602741, complement].

Only the 20 target-specific nucleotides are shown in the third column (see also Figure S1). The preferred protospacer-adjacent motif (PAM) for Cas 9 is NGG, shown in bold and underlined.

Species	Name	Sequence (5′→3′)	Genome_coordinates[strand]
Human	gPRF1.1	GCGGGGGAGTGTGTACCACA TGG	Chr10:70599156:70599178[+]
Human	gPRF1.2	GGAGCTGGGTGGCCGCATAT CGG	Chr10:70599018:70599040[-]