Skip to main content
. 2024 Nov 7;12:RP93232. doi: 10.7554/eLife.93232

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Arabidopsis thaliana) RBCS2B TAIR AT5G38420
Gene (A. thaliana) VHP1 TAIR AT1G15690
Gene (A. thaliana) TOC64-III TAIR AT3G17970
Gene (A. thaliana) ATG8a TAIR AT4G21980
Gene (A. thaliana) ATPC1 TAIR AT4G04640
Gene (A. thaliana) KEA1 TAIR AT1G01790
Genetic reagent (A. thaliana) atg5-1 ABRC SAIL_129_B07
Genetic reagent (A. thaliana) atg7-2 ABRC GABI_655B06
Genetic reagent (A. thaliana) atg2-1 ABRC SALK_076727
Genetic reagent (A. thaliana) atg10-1 ABRC SALK_084434
Genetic reagent (A. thaliana) drp5b (arc5-2) ABRC SAIL_71_D11
Genetic reagent (A. thaliana) sid2-2 ABRC CS16438
Genetic reagent (A. thaliana) NahG atg5-1 10.1105/tpc.109.068635
Genetic reagent (A. thaliana) sid2-2 atg5-1 10.1105/tpc.109.068635
Genetic reagent (A. thaliana) Pro35S:CT-GFP 10.1126/science.276.5321.2039
Genetic reagent (A. thaliana) Pro35S:CT-DsRed 10.1093/pcp/pcab084
Genetic reagent (A. thaliana) ProRBCS:RBCS-GFP 10.1104/pp.108.122770
Genetic reagent (A. thaliana) ProVHP1:VHP1-mGFP 10.1105/tpc.114.127571
Genetic reagent (A. thaliana) ProUBQ:GFP-ATG8a 10.1093/pcp/pcaa162
Genetic reagent (A. thaliana) ProTOC64:TOC64-mRFP 10.26434/chemrxiv-2023-kx6gp
Genetic reagent (A. thaliana) ProRBCS:RBCS-EYFP This paper See ‘Plant materials’ in Materials and methods
Genetic reagent (A. thaliana) ProRBCS:RBCS-mRFP This paper See ‘Plant materials’ in Materials and methods
Genetic reagent (A. thaliana) ProRBCS:RBCS-tagRFP This paper See ‘Plant materials’ in Materials and methods
Genetic reagent (A. thaliana) ProATPC1:ATPC1-tagRFP This paper See ‘Plant materials’ in Materials and methods
Genetic reagent (A. thaliana) ProKEA1:KEA1-mRFP This paper See ‘Plant materials’ in Materials and methods
Antibody Anti-RFP (Mouse, monoclonal) MBL M204-3 (1:2000)
Antibody Anti-cFBPase (Rabbit, polyclonal) Agrisera AS04043 (1:5000)
Recombinant DNA reagent ProRBCS:RBCS-EYFP This paper See ‘Plant materials’ in Materials and methods
Recombinant DNA reagent ProRBCS:RBCS-mRFP This paper See ‘Plant materials’ in Materials and methods
Recombinant DNA reagent ProRBCS:RBCS-tagRFP This paper See ‘Plant materials’ in Materials and methods
Recombinant DNA reagent ProATPC1:ATPC1-tagRFP This paper See ‘Plant materials’ in Materials and methods
Recombinant DNA reagent ProKEA1:KEA1-mRFP This paper See ‘Plant materials’ in Materials and methods
Sequence-based reagent ATPC1_F This paper PCR primers (cloning) CACCCATGGAGAGGGCTCGTACCTTAC
Sequence-based reagent ATPC1_R This paper PCR primers (cloning) AACCTGTGCATTAGCTCCAG
Sequence-based reagent KEA1_F This paper PCR primers (cloning) AGGAACCAATTCAGTCGACTCATGATCATAACAAGTCTC
Sequence-based reagent KEA1_R This paper PCR primers (cloning) AAAGCTGGGTCTAGATATCCGATTACGACTGTGCCTCCTTC
Commercial assay or kit Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit Invitrogen A22188
Chemical compound, drug Concanamycin A Santa Cruz sc-202111
Software, algorithm ZEN Carl Zeiss RRID:SCR_013672 Image processing and quantification (microscopy)
Software, algorithm NIS-Elements C Nikon RRID:SCR_020318 Image processing and quantification (microscopy)
Software, algorithm LAS X Leica RRID:SCR_013673 Image processing and quantification (microscopy)
Software, algorithm Imaris Bitplane RRID:SCR_007370 Image processing and quantification (microscopy)
Software, algorithm Image lab Bio-Rad RRID:SCR_014210 Image processing and quantification (western blot)
Software, algorithm JMP14 SAS RRID:SCR_022199 Statistics