Table 2.
Reagent information
| Antibodies used for immunocytochemistry/flow cytometry/western blot | ||||
|---|---|---|---|---|
| Antibody | Dilution | Company cat # | RRID | |
| Pluripotency marker | Goat anti-OCT3/4 | 1:200 | R and D Systems, Cat# AF1759 | RRID:AB_354975 |
| Pluripotency marker | Rabbit anti-NANOG | 1:500 | ReproCELL Incorporated, Cat# RCAB004P-F, | RRID:AB_1560380 |
| Pluripotency marker | DyLight 550 Mouse anti-SSEA-4 | 1:125 | Stemgent, Cat# 09–0097 | RRID:AB_2784538 |
| Pluripotency marker | Alexa Fluor 488 Mouse anti-TRA-1–60 | 1:125 | BioLegend, Cat# 330,613 | RRID:AB_2295395 |
| Differentiation marker (Ectoderm) | Mouse anti-TUJ1 | 1:250 | R and D Systems, Cat# MAB1195 | RRID:AB_357520 |
| Differentiation marker (Mesoderm) | Mouse anti-SMA | 1:250 | R and D Systems, Cat# MAB1420 | RRID:AB_262054 |
| Differentiation marker (Endoderm) | Mouse anti-AFP | 1:200 | R and D Systems, Cat# MAB1368 | RRID:AB_357658 |
| Secondary antibody for immunocytochemistry | Donkey anti-goat IgG Alexa Flour 546 | 1:200 | Thermo Fisher Scientific, Cat# A-11056 | RRID:AB_2534103 |
| Secondary antibody for immunocytochemistry | Goat anti-Rabbit IgG Alexa Flour 555 | 1:500 | Thermo Fisher Scientific, Cat# A-21428 | RRID:AB_2535849 |
| Secondary antibody for immunocytochemistry | Donkey anti-mouse IgG Alexa Fluor 488 | 1:500 | Thermo Fisher Scientific, Cat# A-21202 | RRID:AB_141607 |
| Primers | ||||
| Target | Size of band | Forward/reverse primer (5′-3′) | ||
| Mycoplasma detection | Nested-PCR, 1st step PCR (MCGpF11/MCGpR1) | 350–850 bp |
ACACCATGGGAG(C/T)TGGTAAT/ CTTC(A/T)TCGACTT(C/T)CAGACCCAAGGCAT |
|
| Mycoplasma detection | Nested-PCR, 2nd step PCR (R16–2/MCGpR21) | 200–750 bp |
GTG(C/G)GG(A/C)TGGATCACCTCCT/ GCATCCACCA(A/T)A(A/T)AC(C/T)CTT |
|
| Episomal vector detection | EBNA1 (genomic qPCR) | 61 bp | ATCAGGGCCAAGACATAGAGATG / GCCAATGCAACTTGGACGTT | |