Reagents and tools table
| Reagent/Resource | Reference or Source | Identifier or Catalog Number |
|---|---|---|
| Experimental Models | ||
| CHCHD10 G58R mouse | Shammas et al, 2022 | MGI:7532640 |
| CHCHD10 S59L mouse | Liu et al, 2020 | |
| CHCHD2/CHCHD10 DKO mouse | Liu et al, 2020 | |
| OMA1 KO mouse | Quirós et al, 2012 | MGI:5426689 |
| Dele1 KO mouse | This study | |
| OPA1 ∆s1 mouse | This study | |
| OPA1 ∆s1 primary neonatal fibroblasts | This study | |
| Ckmm-cre mouse | Brüning et al, 1998 | JAX stock #006475 |
| Tfamfl/fl mouse | Hamanaka et al, 2013 | JAX stock #026123 |
| Recombinant DNA | ||
| OMA1 ASOs and control ASOs |
Shammas et al, 2022 Ionis Pharmaceuticals |
|
| Antibodies | ||
| Mouse monoclonal anti-OPA1 | BD Bioscience | 612606 |
| Mouse monoclonal anti-OMA1 | Santa Cruz | SC-515788 |
| Rabbit polyclonal anti-HSP90 | Proteintech | 13171-1-AP |
| Mouse monoclonal anti-β-ACTIN | Sigma | A2228 |
| Rabbit monoclonal anti-eIF2α | Cell Signaling | 5324 |
| Rabbit monoclonal anti-p-eIF2α | Cell Signaling | 3597 |
| Rabbit polyclonal anti-MTHFD2 | Proteintech | 12270-1-AP |
| Mouse monoclonal anti-Puromycin | Sigma | MABE343 |
| IRDye 800CW Goat anti-Rabbit IgG (H + L) | LI-COR Biosciences | 926-32211 |
| IRDye 680RD Goat anti-Mouse IgG (H + L) | LI-COR Biosciences | 926-68070 |
| IRDye 800CW Goat anti-Mouse IgG2a-Specific | LI-COR Biosciences | 926-32351 |
| Mouse monoclonal anti-P62 | Abcam | AB56416 |
| Mouse monoclonal anti-ubiquitinylated proteins antibody, clone FK2 | Sigma | 04-263 |
| Rabbit monoclonal anti-Ubiquitin FK2 | StressMarq | SMC-550D |
| Rabbit polyclonal anti-Laminin | Abcam | AB11575 |
| Mouse monoclonal anti-Dystrophin, exons 31/32. | DSHB | MANDYS1, 3B7/ AB_528206 |
| Mouse monoclonal anti-Myosin heavy chain (slow, alpha- and beta-) (type 1) | DSHB | BA-F8/ AB_10572253 |
| Mouse monoclonal anti- Myosin heavy chain Type IIA | DSHB | SC-71/AB_2147165 |
| Mouse monoclonal anti- Myosin heavy chain Type IIB | DSHB | 10F5/AB_1157896 |
| Alexa 488 Goat anti-Mouse IgG1 | Invitrogen | A-21121 |
| Alexa 647 Goat anti-Mouse IgG2a | Invitrogen | A-21241 |
| Alexa 555 Goat anti-Rabbit IgG (H + L) | Invitrogen | A-32732 |
| Alexa 488 Goat anti-mouse IgM | Invitrogen | A-21042 |
| Alexa 488 Goat anti-mouse IgG2a | Invitrogen | A-21131 |
| Alexa 488 Goat anti-mouse IgG2b | Invitrogen | A-21141 |
| Alexa 647 Goat anti-mouse IgG1 | Invitrogen | A-21240 |
| Alexa 647 Goat anti-rabbit (H + L) | Invitrogen | A-32728 |
| Alexa 555 Goat anti-mouse IgG1 | Invitrogen | A-21127 |
| Oligonucleotides and other sequence-based reagents | ||
| Genotyping primer 1 of Dele1 KO mice | This study | TGATGGTGTGACTGTCCCTT |
| Genotyping primer 2 of Dele1 KO mice | This study | GGTTGTCTGAGACCCATCTGA |
| Genotyping primer 1 of OPA1 ∆s1 mice | This study | CGTGCACCCCACTTACTTTT |
| Genotyping primer 2 of OPA1 ∆s1 mice | This study | ATGCAAAGTCCCAGGAAAGA |
| Chemicals, Enzymes and other reagents | ||
| Paraformaldehyde 16% aqueous, EM grade | Electron Microscopy Sciences | 15710 |
| Glutaraldehyde 50% aqueous, EM grade | Electron Microscopy Sciences | 16320 |
| Phosphate Buffered Saline | Lonza, Fisher, or Corning | |
| Sodium Cacodylate Buffer, 0.2 M, pH 7.4 | Electron Microscopy Sciences | 11653 |
| Calcium Chloride, 2 M | Quality Biological, Inc. | 351-130-721 |
| Osmium Tetroxide 4% aqueous solution | Electron Microscopy Sciences | 19150 |
| Potassium hexacyanoferrate (II) trihydrate | Sigma-Aldrich | P3289-100G |
| Sodium Acetate Trihydrate | Electron Microscopy Sciences | 21120 |
| Uranyl Acetate | Electron Microscopy Sciences | 22400 |
| Ethyl Alcohol, 200 proof | The Warner-Graham Co. | 6505001050000 |
| Embed 812 Embedding Kit with Dmp-30 | Electron Microscopy Sciences | 14120 |
| BanII Endonuclease | NEB | R0119S |
| BSA fraction V | MP Biomedicals | 02160069 |
| BCA kit | Thermo Scientific | 23225 |
| Direct-zol RNA Miniprep Kit | Zymo | R2051 |
| RNeasy Fibrous Tissue Mini Kit | QIAGEN | 74704 |
| RNeasy Lipid Tissue Mini Kit | QIAGEN | 74804 |
| Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) | Sigma-Aldrich | C2759-100MG |
| Dimethyl Sulfoxide (DMSO) | Corning | 25-950-CQC |
|
NEBNext® Ultra™ II Directional RNA Library Prep Kit |
New England Biolabs | E7660 |
| RIPA buffer |
Cell Signaling Technology |
9806 |
| Protease/Phosphatase Inhibitor Cocktail |
Cell Signaling Technology |
5872 |
| ProLong Diamond Antifade Mountant | Invitrogen | P36965 |
| Triton X-100 | Sigma-Aldrich | X100-5ML |
| Dithiothreitol (DTT) | Bio-Rad Laboratories | 1610611 |
| 4x Laemmli Sample Buffer | Bio-Rad Laboratories | 1610747 |
| Dry milk powder | Dot Scientific | DSM17200-1000 |
| 4–15% Criterion TGX Precast Midi Protein Gel | Bio-Rad Laboratories | 5671084 |
| 7.5% Criterion TGX Precast Midi Protein Gel | Bio-Rad Laboratories | 5671024 |
| MyTaq Red Mix, | Bioline | BIO-25044 |
| SYBR Safe DNA Gel Stain | Invitrogen | S33102 |
| Clariom S Mouse microarray | Affymetrix/Applied Biosystems | 902931 |
| Seahorse XF Pro M FluxPak Mini | Agilent Technologies | 103777-100 |
| Software | ||
| Adobe Illustrator 2023 | Adobe | |
| Adobe Photoshop 2023 | Adobe | |
| Fiji/ImageJ | NIH | RRID:SCR_002285 |
| Cellpose 2.0 | Pachitariu and Stringer, 2022 | |
| LabelsToROIs of FIJI plugin | Waisman et al, 2021 | |
| Transcriptome Analysis Console Software, version 4.0.1 | Affymetrix | RRID:SCR_018718 |
| Perseus | MaxQuant | RRID:SCR_015753 |
| Image Studio, v5.2 | LI-COR | RRID:SCR_0157 95 |
| GraphPad Prism, version 10.1.0 (264) | https://www.graphpad.com | RRID:SCR_0027 98 |
| Miniconda3 | https://docs.anaconda.com/miniconda/ | |
| Empanada-napari | Conrad and Narayan, 2023, Cell Systems 14, 58-71 | |
| MitoNet plugin | Conrad and Narayan, 2023, Cell Systems 14, 58-71 | |
|
Proteome Discoverer 2.4 |
Thermo Fisher Scientific | |
| Binner | Kachman et al, 2020 | |
| MetaboAnalyst 6.0 | https://www.metaboanalyst.ca/MetaboAnalyst/ | |
| g:Profiler |
Raudvere et al, 2019 |
|
| Other | ||
| Mouse Heart Slicer Matrix, 1 mm coronal section | Zivic Instruments | HSMS001-1 |
| Grip strength instrument | BIOSEB | EB1-BIOGS3 |
| 1.5H coverslips | Thorlabs | CG15KH |
| Confocal laser scanning microscope | Olympus | FLUOVIEW FV3000 |
| Seahorse XF Pro Analyzer | Agilent Technologies | |
| UltiMate 3000 high pressure liquid chromatography instrument | Thermo Fisher Scientific | |
| Orbitrap Lumos mass spectrometer | Thermo Fisher Scientific | |