Protocol for detection of tRNA-derived fragments in cells, tissues, and plasma

Summary

tRNA-derived fragments (tRFs) are frequently dysregulated in cancers, and approaches for the detection of tRFs within biological samples are vital for their expression analysis and functional exploration. Here, we present a protocol for detecting tRFs using a modified TaqMan quantitative real-time PCR (qRT-PCR)-based technique, Dumbbell-PCR (Db-PCR). We describe steps for primer and adapter design, adapter-RNA ligation, and RNA detection. This protocol streamlines and enhances the precision of tRF quantification in cells, tissues, and plasma, facilitating a time-efficient and reliable assessment of their presence.

For complete details on the use and execution of this protocol, please refer to Yu et al.¹ and Sun et al.²

Graphical abstract

Highlights

• •Protocol for accurate and reliable detection of tRFs in biological samples
• •Instructions for optimized primer design and sample preparation
• •Steps for adapter-RNA ligation and RNA detection

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

tRNA-derived fragments (tRFs) are frequently dysregulated in cancers, and approaches for the detection of tRFs within biological samples are vital for their expression analysis and functional exploration. Here, we present a protocol for detecting tRFs using a modified TaqMan quantitative real-time PCR (qRT-PCR)-based technique, Dumbbell-PCR (Db-PCR). We describe steps for primer and adapter design, adapter-RNA ligation, and RNA detection. This protocol streamlines and enhances the precision of tRF quantification in cells, tissues, and plasma, facilitating a time-efficient and reliable assessment of their presence.

Before you begin

tRFs are a class of small non-coding RNAs (ncRNAs) that are abundant and conserved across most organisms, with lengths ranging from 14 to 50 nucleotides. The biogenesis of tRFs appears to be governed by a set of highly conservative and precise site-specific cutting mechanisms. These can be broadly classified into six categories based on the cleavage positions on pre- and mature tRNAs. 1-tRFs are produced by removing 3′-trailer sequences from pre-tRNA during tRNA maturation. 5′-tRFs are produced by cleavage of the 5′end in the D-loop of mature tRNAs and 3′-tRFs are produced through cleavage of the 3′end in the T-loop of mature tRNAs, both are 14–30 nt in length. 5′- and 3′-tRNA-derived stress-induced RNAs (tiRNAs; >30 nt) are generated by specific cleavage in the anticodon loops of mature tRNAs under stress conditions. Internal tRFs (i-tRFs) originate from the cleavage occurring at internal locations within mature tRNAs.^3,4,5,6 A single tRNA can generate tRFs of varying lengths, with differences that may be as minor as a single nucleotide,² hence the detection of tRFs demands high methodological precision.

Currently, there are two main assays for tRF detection. The first is Northern blotting, but it has several disadvantages: lower accuracy and sensitivity, the need for a large amount of RNA, and complicated experimental procedures. The second method is quantitative real-time PCR (qRT-PCR), which suffers from lower precision, making it challenging to distinguish differences at the single-base resolution. Db-PCR, a modified TaqMan qRT-PCR-based method, was originally designed to detect microRNAs.⁷ This protocol builds upon Db-PCR, with stricter primer design standards. As a result, it is more suitable for tRF detection in tissues and plasma, allowing distinct quantification of 5′ and 3′ end variants of tRFs at a single-base resolution.

Institutional permissions

The tissues and plasma samples used in this study were obtained from the tissue bank of Sir Run Run Shaw Hospital of Zhejiang University (Hangzhou, China). All samples were collected with permission at the time of diagnosis, prior to any treatment being administered. The study protocol was approved by the Institutional Review Boards of the hospital. Anyone who uses this protocol to detect tRFs in human samples should acquire permissions from the relevant institutions.

Primer design

Timing: within 1 day

• 1.
  The primers of 3′-Db-PCR for detection of 5′-tRFs (Figure 1).

  • a.
    3′-Db-adapter: /5Phos/XTCAGTGCAGGGTCCGAGGTATTCGCACTGAYN₁N₂N₃N₄N₅N₆.

    Note: X and Y are paired bases.

    CRITICAL: X should avoid the same base as the (n + 1) position of the target 5′-tRF. For example, if the sequence of the target 5′-tRF GlyGCC_29 is GCATGGGTGGTTCAGTGGTAGAATTCTCG, and the sequence of GlyGCC_30 is GCATGGGTGGTTCAGTGGTAGAATTCTCGC, then to increase the specificity, X should be G/A/T instead of C.

    Note: N represents the complementary pair of the last six bases at the 3′end of the target 5′-tRF sequence.

  • b.
    Gene specific primer (GSP) for reverse transcription reaction:
    XTCAGTGCGAATACCTCGGACCCT
  • c.
    TaqMan qRT-PCR primers and probes: The design should follow the general principles of primer design. Troubleshooting 1.

    Note: The probe should span the junction between the adapter and the target sequence. The optimal probe length is 13–18 bp, with a melting temperature (Tm) value between 65°C–70°C. The GC content should be between 40% and 70%, with a higher proportion of C bases compared to G bases.

• 2.
  The primers of 5′-Db-PCR for 3′-tRFs (Figure 2).

  • a.
    5′-Db-adapter: MMMMMMCTCAGTGCATGGGAGGGTGTGTGGTCTTGCTTGGTGTGCACTGrArG

    Note: M represents the complementary pair of the last six bases at the 5′end of the target 3′-tRF sequence.

    Note: rA and rG represent RNA bases.

  • b.
    Gene specific primer (GSP) for reverse transcription reaction: It can be the same as the reverse primer for qPCR.
  • c.
    TaqMan qRT-PCR primers and probes: The design should follow the general principles of primer design. Troubleshooting 1.

    Note: The probe should span the junction between the adapter and the target sequence. The optimal probe length is 13–18 bp, with a Tm value between 65°C–70°C. The GC content should be between 40% and 70%, with a higher proportion of C bases compared to G bases.

Figure 1.

Schematic diagram of primer design for 3′-Db-PCR to detect 5′-tRFs

Taking ArgTCG-3-1_19 as an example, the diagram illustrates its integrated sequence (purple), the structure of adapter (blue), TaqMan probe (dark yellow) and primers (black). GSP: Gene specific primer for reverse transcription reaction.

Figure 2.

Schematic diagram of primer design for 5′-Db-PCR to detect 3′-tRFs

Taking CAT1¹ as an example, the diagram illustrates its integrated sequence (purple), the structure of adapter (blue), TaqMan probe (dark yellow) and primers (black).

Sample preparation

Timing: within 1 day

• 3.For cultured cells or tissue samples, total RNA can be isolated using TRIzol reagent, following the general procedures. Troubleshooting 2.

Optional: It is recommended to pretreatment using an rtStar tRF&tiRNA Pretreatment Kit according to the manufacturer’s instructions to remove 3′-aminoacyl and 3′-cP ends, 5′-OH end phosphorylation, and demethylation of m1A, m1G, and m3C (https://www.arraystar.com/rtstar-trfandtirna-pretreatment-kit/as-fs-005/?F_Keyword=AS-FS-005).

• 4.
  For plasma samples, total RNA can be isolated using TRI Reagent BD reagent.

  • a.
    Add 200 μL plasma to 750 μL of TRI Reagent BD, supplemented with 20 μL of 5 N acetic acid.

    Note: Any reagent suitable for the extraction of total RNA from a liquid sample is acceptable, not limited to TRI Reagent BD.

  • b.
    Vortex to mix and incubate for 5 min at room temperature.
  • c.
    Add 5 μL of 200 nM exogenous control (e.g., cel-miR39-3p) into the mixture.
  • d.
    Add 200 μL of chloroform and vortex for 15 s, incubate for 5 min at room temperature, then centrifuge at 4°C, 12,000 g for 15 min.
  • e.
    Transfer the supernatant to a new tube and add 500 μL of isopropanol. Invert gently to mix thoroughly and incubate for 10 min at room temperature, then centrifuge at 4°C, 12,000 g for 8 min.
  • f.
    Discard the supernatant, and wash the pellet with 1 mL of 70% ethanol, then centrifuge at 4°C, 7500 g for 5 min.
  • g.
    Discard the supernatant, air-dry the pellet, and then dissolve it in 6–10 μL of nuclease-free water.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Biological samples
Tumor tissues and their corresponding adjacent non-tumor tissues	Tissue bank of Sir Run Run Shaw Hospital of Zhejiang University	N/A
Plasma specimens of NSCLC patients and healthy controls	Tissue bank of Sir Run Run Shaw Hospital of Zhejiang University	N/A
Chemicals, peptides, and recombinant proteins
TRIzol reagent	Thermo Scientific	Cat#15596018CN
TRI Reagent BD	Molecular Research Center	Cat#TB126-100
T4 RNA ligase 2 (T4 Rnl2)	New England Biolabs	Cat#M0239L
Annealing buffer for RNA oligos (5X)	Beyotime	Cat#R0051
HiScript II 1st strand cDNA synthesis kit	Vazyme	Cat#R211
Premix Ex Taq (probe qPCR) reaction solution	Takara	Cat#RR390A
Critical commercial assays
rtStar tRF&tiRNA pretreatment kit	Arraystar	Cat#AS-FS-005
Experimental models: Cell lines
Human: A549	ATCC	CCL-185
Human: Calu1	ATCC	HTB-54
Other
PCR amplification instrument	Thermo Fisher Scientific	ProFlex
Real-time PCR system	Thermo Fisher Scientific	QuantStudio 5

Step-by-step method details

Ligation of adapter to tRFs

Timing: 1 day

In this step, target tRF will be attached to a specific adapter to enhance the specificity of the subsequent TaqMan qRT-PCR detection.

• 1.Prepare the ligation reaction mixture A (10 μL) in an RNase-free centrifuge tube on ice as follows:

Reagent	Amount
Annealing Buffer for RNA Oligos (5×)	2 μL
Total RNA	1 μg
Nuclease-free water	up to 10 μL

Add the reagents in the order listed above and mix gently.

Note: The recommended amount of total RNA is 1 μg, but it can fluctuate between 100 ng and 1 μg. If the expression of target tRF is high, the initial amount of total RNA might be less than 100 ng. However, in this case, a high success rate cannot be guaranteed.

• 2.Denaturation: Transfer the aforementioned 10 μL ligation reaction mixture A into a PCR amplification apparatus. Heat at 95°C for 3 min to denature the RNA structure and facilitate the binding of the adapter to target tRF.
• 3.Annealing: Promptly shut down the PCR amplification apparatus to allow the sample to undergo natural cooling for a period of 2 h, facilitating the annealing process.

Note: Make sure the ambient temperature in the room is maintained at an appropriate level, ideally around 25°C, to facilitate a gradual and controlled cooling process.

• 4.Ligation: Prepare the ligation reaction mixture B (20 μL) in an RNase-free centrifuge tube on ice as follows:

Reagent	Amount
Ligation reaction mixture A	10 μL
T4 Rnl2 Reaction Buffer (10×)	1 μL
T4 Rnl2	1 U
Nuclease-free water	up to 20 μL

Add the reagents in the order listed above and mix gently.

• 5.The ligation reaction mixture B (20 μL) was incubated on a PCR amplification apparatus at 37°C for 1 h, followed by incubation at 4°C for 12–16 h.

Pause point: Ligated RNAs can be stored at −20°C and used within six months; for long-term storage, it is recommended to aliquot and store at −80°C.

Reverse transcription by gene specific primer (GSP)

Timing: 25 min

This step synthesizes cDNA from RNA that has been ligated with specific adapters.

• 6.Prepare the first-strand cDNA synthesis reaction mixture in an RNase-free centrifuge tube on ice as follows:

Reagent	Amount
2 × RT Mix	10 μL
HiScript II Enzyme Mix	2 μL
Target tRF GSP (10 μM)	0.4 μL
GSP for reference gene (10 μM)	0.4 μL
Ligated RNA	4 μL
Nuclease-free water	up to 20 μL

Note: The 2 × RT Mix is a buffer system containing dNTPs; if the buffer system used does not include dNTPs, additional supplementation is required.

Note: If the initial amount of total RNA for ligation is less than 1 μg, the amount of ligated RNA for cDNA synthesis can be increased proportionally.

Note: For cells or tissues sample, U6 can be used as an endogenous reference gene. For plasma samples, the GSP should be suitable for the exogenous control added into the sample before extraction.

• 7.Conduct the first-strand cDNA synthesis reaction under the following conditions:

Temperature	Time
25°C	5 min
50°C	15 min
85°C	5 min
4°C	keeping

Pause point: The product can be stored at 4°C and used within 1 week, or −20°C and used within six months. For long-term storage, it is recommended to aliquot and store at −80°C.

TaqMan qRT-PCR for target tRF amplification

Timing: 1 h

This step detects target tRF by PCR amplification using a specific probe. Troubleshooting 4; Troubleshooting 5.

• 8.Prepare the PCR reaction mixture on ice as follows:

Reagent	Amount
Premix Ex Taq (Probe qPCR) (2×)	5 μL
PCR Forward Primer (10 μM)	0.2 μL
PCR Reverse Primer (10 μM)	0.2 μL
Probe	0.2 μL
cDNA	1 μL
ddH2O	up to 10 μL

Note: For 3′-Db-PCR, the recommended probe concentration is 100 nM. For 5′-Db-PCR, the recommended probe concentration is 400 nM.

• 9.Set up the qRT-PCR detection protocol.

Note: The qRT-PCR cycling conditions can be set according to the requirements of the instruments. Typical conditions might include initial denaturation, annealing, and extension phases, but specific parameters should be optimized for your setup.

Expected outcomes

This protocol allows for the precise detection and quantification of 5′-tRFs and 3′-tRFs at a single-nucleotide resolution (Figure 3). By utilizing a well-defined primer design strategy in conjunction with a specialized detection methodology, this protocol enables the detection of tRF expression across a range of biological samples, including cells, tissues, and plasma. Moreover, the gel imaging and Sanger sequencing of Db-PCR products can be used to further determine the reliability of the approach (Figure 4). Comparing these results to those obtained from Northern blot can also demonstrate its accuracy, as shown in the research of Yu et al., 2023.¹ Additionally, practical applications have shown that 200 μL plasma is enough for the detection of tRFs.¹ Consequently, this technique holds significant potential for the detection of tRFs in biological samples.

Table 1.

Sequences of the three 5′-tRFs and their corresponding adapters and primers

5′-tRF	Name	Sequence (5′→3′)
tRNA35-GlyGCC_29	Integrated sequence	GCAUGGGUGGUUCAGUGGUAGAAUUCUCG
	3′-Db-adapter	/5Phos/GTCAGTGCAGGGTCCGAGGTATTCGCACTGACCGAGAA
	GSP	GTCAGTGCGAATACCTCGGACCCT
	Reverse primer	AGTGCGAATACCTCGGACC
	Forward primer	GCATGGGTGGTTCAGTGGT
	TaqMan probe	/56-FAM/ AGAATTCTCGGTCAGTGC /3MGB/
tRNA35-GlyGCC_30	Integrated sequence	GCAUGGGUGGUUCAGUGGUAGAAUUCUCGC
	3′-Db-adapter	/5Phos/GTCAGTGCAGGGTCCGAGGTATTCGCACTGACGCGAGA
	GSP	GTCAGTGCGAATACCTCGGACCCT
	Reverse primer	AGTGCGAATACCTCGGACC
	Forward primer	GCATGGGTGGTTCAGTGGT
	TaqMan probe	/56-FAM/ AATTCTCGCGTCAGTGC /3MGB/
tRNA4-GlyCCC_31	Integrated sequence	GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCC
	3′-Db-adapter	/5Phos/CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGGCGAG
	GSP	CTCAGTGCGAATACCTCGGACCCT
	Reverse primer	AGTGCGAATACCTCGGACC
	Forward primer	GCATTGGTGGTTCAGTGGT
	TaqMan probe	/56-FAM/AATTCTCGCCCTCAGTGC/3MGB/

Figure 3.

This protocol allows for the precise detection and quantification of 5′-tRFs and 3′-tRFs at single-nucleotide resolution

Taking 5′-tRF as an example, we mixed three chemically synthesized 5′-tRFs in equal proportions: tRNA35-GlyGCC_29 and tRNA35-GlyGCC_30, 29 nt and 30 nt in length respectively, both originating from the same tRNA, and tRNA4-GlyCCC_31, 31 nt in length, from a different tRNA. Using specific adapters and primers for (A) tRNA35-GlyGCC_29, only the group supplemented with tRNA35-GlyGCC_29 showed an amplification signal; (B) for tRNA35-GlyGCC_30, only the tRNA35-GlyGCC_30-supplemented group showed an amplification signal; and (C) for tRNA4-GlyCCC_31, only the tRNA4-GlyCCC_31-supplemented group showed an amplification signal. This demonstrates the approach’s capability for tRFs detection with a resolution down to single-base differences. The sequences of the three 5′-tRFs and their corresponding adapters and primers are listed in Table 1. Error bars indicate standard deviation (SD) of three independent experiments.

Figure 4.

Validation of the results of Db-PCR

(A) The gel imaging and Sanger sequencing of 5′-Db-PCR products for 3′-tRF CAT1 detection. Right: secondary structure of the tRNA-Ala-AGC-1-1 that generates 3′-tRF CAT1 (highlighted in red). Figure reprinted and adapted with permission from Yu et al., 2023.¹

(B) The gel imaging and Sanger sequencing of 3′-Db-PCR products for 5′-tRF IleAAT-8-1-L20 detection. Right: secondary structure of the tRNA-IleAAT-8-1 that generates 5′-tRF IleAAT-8-1-L20 (highlighted in red). Figure reprinted and adapted with permission from Sun et al., 2020.²

Quantification and statistical analysis

The data analysis for this protocol should be performed using the 2^−ΔΔCT method, which is the standard approach for calculating relative quantification in qRT-PCR, using U6 as the endogenous control or the corresponding exogenous control (e.g., cel-miR39-3p).

Limitations

This protocol can distinguish differential bases at the end of the tRFs, yet it might not reliably distinguish differences of 1–2 bases at the head of the tRFs. In the case of plasma samples, the detection of tRFs could be challenging if their expression levels are too low, potentially hindered by the constraints of sample volume. Furthermore, our experiments have thoroughly validated the accuracy and precision of this protocol in detecting 5′-tRFs and 3′-tRFs. Considering the characteristics of various types of tRFs, the protocol should also be applicable to the detection of tiRNAs. However, we cannot assert with certainty whether the same detection efficacy will be achieved for 1-tRFs and i-tRFs.

Troubleshooting

Problem 1

The Tm value of suitable probes for TaqMan qRT-PCR might be too low (related to Primer design 1c and 2c).

Potential solution

Use Minor Groove Binder (MGB) as the quenching group to increase the Tm value.

Problem 2

Pretreatment with an rtStar tRF&tiRNA Pretreatment Kit results in a large loss of RNA, with a yield of less than 50% (related to Sample preparation 3).

Potential solution

Prepare at least twice the amount of RNA required. If the modifications of target tRFs are minimal, this step can be omitted.

Problem 3

Cannot find the same reagents or instruments (related to the key resources table).

Potential solution

The key to the success of this protocol lies in the primer design, therefore the brands of reagents and instruments presented in the key resources table are recommended but not irreplaceable. Reagents of the same function can be used.

Problem 4

The CT value in TaqMan qRT-PCR is unusually low (related to Step 8 and 9).

Potential solution

• •Reduce the amount of total RNA or cDNA used.
• •Reduce the concentration of the probe, as a high concentration can lead to nonspecific signal.

Problem 5

The CT value in TaqMan qRT-PCR is unusually high (related to Step 8 and 9).

Potential solution

• •Increase the amount of total RNA or cDNA used.
• •Redesign the primers for TaqMan qRT-PCR.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Yan Lu (yanlu76@zju.edu.cn).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Mengqian Yu (11818122@zju.edu.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate any datasets/code.

Acknowledgments

This work has been supported in part by the National Natural Science Foundation of China (82072857 and 82372870) and the China Postdoctoral Science Foundation (2022M722786). We express our gratitude to Xiaoli Hong and Chao Bi at the Core Facility of Zhejiang University School of Medicine for their technical assistance and the anonymous reviewers for their valuable comments and feedback on the manuscript.

Author contributions

M.Y. developed the protocol with advice from P.L. and Y.L.; M.Y. performed the experiment and drafted the manuscript; P.L. and Y.L. revised the manuscript. All the authors reviewed and approved the final manuscript.

Declaration of interests

We, the authors, disclose that we hold a patent, titled “A tRF Molecule Marker CAT1 and Its Application in the Preparation of Kits for Cancer Diagnosis and Prognosis” (no. ZL 2023 1 1405832.7), which is related to this work. This disclosure is made in the interest of transparency and to avoid any conflict of interest. We affirm that the patent does not influence the scientific integrity of our research findings, and the results presented in our manuscript are based solely on objective data and rigorous scientific methodology.

Furthermore, we confirm that all authors have complied with the guidelines for authorship and have contributed significantly to the work. Any potential financial interests or benefits arising from the patent are not related to the publication of this research and will be managed in accordance with the policies of our respective institutions.

We also wish to acknowledge that the patent information has been disclosed to ensure the transparency of our research and to allow readers to assess any potential impact on the interpretation of our findings. We are committed to maintaining the highest standards of scientific rigor and ethical responsibility in our work.