| Gene (Aequorea coerulescens) |
venus |
RIKEN BRC; Nagai et al., 2002
|
|
|
| Strain, strain background (Escherichia coli) |
DH5α |
Thermo Fisher Scientific |
EC0112 |
competent cells |
| Genetic reagent (F’ Episome) |
ccdB |
Thermo Fisher Scientific |
V79020 |
pcDNA3.1 (+) Mammalian Expression Vector |
| Cell line (Homo sapiens) |
FreeStyle 293 |
Thermo Fisher Scientific |
R79007 |
|
| Transfected construct (M. musculus) |
Antibody expression vector |
This paper |
|
Plasmid construct to transfect and express the antibody. |
| Biological sample (M. musculus) |
Mouse splenocytes |
This paper |
CLEA Japan, Inc. |
|
| Antibody |
Anti-CD43 MicroBeads (Mouse monoclonal) |
Miltenyi Biotec, Inc. |
130-049-801 |
Add 10 μL of Anti-CD43 (Ly-48) MicroBeads (mouse) per 10⁷ total cells (1:1000 dilution) |
| Recombinant DNA reagent |
pcDNA3.4-mIgG1 (plasmid) |
This paper |
|
To obtain a large amount of secretory antibodies |
| Recombinant DNA reagent |
pcDNA3.4-kappa (plasmid) |
This paper |
|
To obtain a large amount of secretory antibodies |
| Sequence-based reagent |
BsaI_IL6sp_L |
This paper |
PCR primers |
CTAGGGTCTCAAGCAGATGAACTCCTTCTCCACAAGCG
|
| Sequence-based reagent |
mC_G_new2_BsaI |
This paper |
PCR primers |
TCCTAGGTCTCCCACACACAGGGGCCAGTGGATAGAC
|
| Peptide, recombinant protein |
Anti-HA antibodies |
This paper |
|
Nine cross reactive antibodies |
| Commercial assay or kit |
BsaI-HFv2 |
New England Biolabs |
NEB #R3733 |
|
| Commercial assay or kit |
T4 DNA ligase |
New England Biolabs |
M0202T |
|
| Chemical compound, drug |
AddaVax |
InvivoGen |
vac-adx-10 |
adjuvant |
| Software, algorithm |
BONSCI |
in-house software |
|
Ig database construction and visualization of the Ig repertoire |
| Other |
CM5 sensor chip |
GE Healthcare Technologies |
BR100530 |
3 sensor chips |
