Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | IGF2BP2 | UniProt | Q9Y6M1 | |
| Strain, strain background (Escherichia coli) |
BL21 (Rosetta DE3) | MilliporeSigma | Cat#: 70954 | Competent cells to produce proteins |
| Strain, strain background (Escherichia coli) |
DH5α | New England Biolabs | Cat#: C2988J | Competent cells for plasmid amplification |
| Strain, strain background (orthoflavivirus) | ZIKVH/PF/2013 | European Virus Archive Global | 001v-EVA1545 | Accession:KJ776791. 2Asian lineage |
| Strain, strain background (orthoflavivirus) | ZIKV MR766 | European Virus Archive Global | 001v-EVA143 | African lineage Accession:DQ859059.1 |
| Strain, strain background (orthoflavivirus) | DENV1 HAWAII | Provided by Tom Hobman (University of Alberta, Canada) |
Serotype 1 Accession: KM204119.1 |
|
| Strain, strain background (orthoflavivirus) | DENV2 NGC | Provided by Tom Hobman (University of Alberta, Canada) |
Serotype 2Taxonomy ID11065 |
|
| Strain, strain background (orthoflavivirus) | DENV3 H87 | Provided by Tom Hobman (University of Alberta, Canada) |
Serotype 3Taxonomy ID408870 |
|
| Strain, strain background (orthoflavivirus) | DENV4 H241 | Provided by Tom Hobman (University of Alberta, Canada) |
Serotype 4 Taxonomy ID408686 |
|
| Strain, strain background (orthoflavivirus) | WNV NY99 | European Virus Archive Global | 003V-02107 | Taxonomy ID1968826 |
| Strain, strain background (betacoronavirus) | SARS-CoV-2 (Canada/QC-LSPQ-L00214517/2020) |
Provided by the Public Health Laboratory of Quebec (INSPQ-LSPQ, Canada) |
GISAID: EPI_ISL_535728 | |
| Genetic reagent (Homo sapiens) | pcDNA3-GFP-IMP2-2 | Addgene | RRID:Addgene_42175 | DNA used for IGF2BP2-HA cloning |
| Genetic reagent (Homo sapiens) | VCP (wt)-EGFP | Addgene | RRID:Addgene_23971 | DNA used for VCP-HA cloning |
| Cell line (Homo sapiens) | Huh7.5 | Provided by Patrick Labonté (INRS, Canada) | RRID:CVCL_7927 | Human hepatocarcinoma cells line, derived from Huh7 |
| Cell line (Homo sapiens) | NHA-hTERT | DOI:10.1038/ncomms12700 | ||
| Cell line (Homo sapiens) | JEG-3 | ATCC | HTB-36 | |
| Cell line (Homo sapiens) | Huh7-Lunet-T7 | DOI: 10.1016/j.celrep.2020.107859 | Derived from Huh7-Lunet cells (CVCL_U459); maintained in zeocin-containing medium |
|
| Cell line (Homo sapiens) | HEK-293T | Provided by Frederick-Antoine Mallette (University of Montreal, Canada) |
||
| Cell line (Cercopithecus aethiops) | Vero E6 | ATCC | CRL-1586 | |
| Cell line (Homo sapiens) | HeLa | Provided by Frederick-Antoine Mallette (University of Montreal, Canada) |
||
| Cell line (Homo sapiens) | Huh7.5 IGF2BP2-HA | This paper | Cell line maintained in puromycin containing medium |
|
| Cell line (Homo sapiens) | Huh7.5 VCP-HA | This paper | Cell line maintained in puromycin containing medium |
|
| Transfected construct | pLKO.1-puro-shNT (plasmid) | Sigma-Aldrich | SHC002 | Lentiviral construct to produce control non-target shRNA (shNT)-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shRHA/DHX9 (plasmid) | MilliporeSigma | TRCN0000001212 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shYBX1 (plasmid) | MilliporeSigma | TRCN0000007952 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shDDX6 (plasmid) | MilliporeSigma | TRCN0000074696 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shDDX21 (plasmid) | MilliporeSigma | TRCN0000051200 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shC1QPB (plasmid) | MilliporeSigma | TRCN0000057106 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shDDX5 (plasmid) | MilliporeSigma | TRCN0000001130 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shYBX2 (plasmid) | MilliporeSigma | TRCN0000107507 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shDDX3 (plasmid) | MilliporeSigma | TRCN0000000003 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shLARP1 (plasmid) | MilliporeSigma | TRCN0000152624 | Lentiviral construct to produce shRNA-expressing viruses |
| Transfected construct (Homo sapiens) |
pLKO.1-puro-shIGF2BP2 (plasmid) | MilliporeSigma | TRCN0000148565 | Lentiviral construct to produce shRNA-expressing viruses |
| Antibody | Anti-VCP (Mouse monoclonal) | Abcam | Cat#: ab11433 RRID:AB_298039 |
WB (1:10,000) |
| Antibody | Anti-IGF2BP3 (Rabbit monoclonal) | Abcam | Cat#: ab177477 RRID:AB_2916041 |
WB (1:2000) IF (1:200) |
| Antibody | Anti-YBX1 (Rabbit polyclonal) | Abcam | Cat#: ab12148 RRID:AB_2219278 |
WB (1:5000) IF(1:100) |
| Antibody | Anti-DENV NS4B (Rabbit polyclonal) | Genetex | Cat#: GTX124250 RRID:AB_11176998 |
WB (1:2000) |
| Antibody | Anti-ZIKV NS4B (Rabbit polyclonal) | Genetex | Cat#: GTX133311 RRID:AB_2728825 |
WB (1:2000) |
| Antibody | Anti-ZIKV NS3 (Rabbit polyclonal) | Genetex | Cat#: GTX133309 RRID:AB_2756864 |
WB (1:2000) |
| Antibody | Anti-ZIKV NS5 (Rabbit polyclonal) | Genetex | Cat#: GTX133312 RRID:AB_2750559 |
WB (1:5000) |
| Antibody | Anti-ZIKV NS4A (Rabbit polyclonal) | Genetex | Cat#: GTX133704 RRID:AB_2887067 |
WB (1:1000) |
| Antibody | Anti-DENV NS5 (Rabbit polyclonal) | Genetex | Cat#: GTX124253 RRID:AB_11169932 |
WB (1:1000) |
| Antibody | Anti-DENV NS3 (Mouse monoclonal) | Genetex | Cat#: GTX629477 RRID:AB_2801283 |
WB (1:1000) |
| Antibody | Anti-DENV2 16681 NS3 (Rat polyclonal) | MedimabsDOI:10.1111/cmi.13302 | Custom made. Previously described. | WB (1:2000) IF (1:1000) |
| Antibody | Anti-dsRNA (Mouse monoclonal) | Cedarlane | Cat#: 10010200 RRID:AB_2651015 |
IF (1:100) |
| Antibody | Anti-LARP1 (Rabbit polyclonal) | Thermo Fisher Scientific | Cat#: A302-087A RRID:AB_1604274 |
WB (1:2000) IF (1:100) |
| Antibody | Anti-ATL2 (Rabbit polyclonal) | Thermo Fisher Scientific | Cat#: A303-332A RRID:AB_10971492 |
WB (1:1000) |
| Antibody | Anti-Actin (Mouse monoclonal) | MilliporeSigma | Cat#: A5441 RRID:AB_476744 |
WB (1:10,000) |
| Antibody | Anti-HA (Mouse monoclonal) | MilliporeSigma | Cat#: H3663 RRID:AB_262051 |
WB (1:5000) IF (1:1000) |
| Antibody | Anti-IGF2BP2 (Rabbit monoclonal) | Cell Signaling | Cat#: 14672S RRID:AB_2798563 |
WB (1:1000) IF (1:100) |
| Antibody | Anti-IGF2BP1 (Rabbit monoclonal) | Cell Signaling | Cat#: 8482S RRID:AB_11179079 |
WB (1:2000) IF (1:200) |
| Antibody | Anti-mouse, rabbit or rat Alexa Fluor (488, 568, or 647)-conjugated secondary antibodies |
Thermo Fisher Scientific | Cat#: A21208 Cat#: A11029 Cat#: A-11034 Cat#: A-11031 Cat#: A-21209 Cat#: A-21247 Cat#: A-31573 Cat#: A11036 Cat#: A-21236 |
Secondary antibodies used for immunofluorescence staining. Dilution: 1:10,000 |
| Other | DAPI stain | Life Technologies | D1306 | Dilution: 1:10,000 |
| Recombinant DNA reagent | pWPI | Addgene | RRID:Addgene_12254 | Lentiviral construct to transfect and express IGF2BP2-HA and VCP-HA (cloned into AscI/SpeI cassette) |
| Recombinant DNA reagent | VCP (wt)-EGFP (plasmid) | Addgene | Plasmid# 23971 RRID:Addgene_23971 |
For VCP-HA cloning into pWPI via PCR |
| Recombinant DNA reagent | pcDNA3-GFP-IMP2-2 (plasmid) | Addgene | Plasmid# 42175 RRID:Addgene_42175 |
For IGF2BP2-HA cloning into pWPI via PCR |
| Transfected construct (Homo sapiens) |
pIRO-Z (plasmid) | DOI:10.1016/j.celrep.2020.107859 | Transfected in Lunet-T7 cells | |
| Transfected construct (Homo sapiens) |
pFL-ZIKV-R2A (plasmid) | DOI:10.1016/j.chom.2016.05.004 | Molecular clone to produce ZIKV-R2A (FSS13025 strain) |
|
| Recombinant DNA reagent | pFK-sgZIKV-R2A | DOI:10.3390/v10070368 | Molecular clone to produce ZIKV sub-genomes |
|
| Recombinant DNA reagent | pFK-sgZIKV-R2A GAA | DOI:10.3390/v10070368 | Molecular clone to produce ZIKV sub-genomes |
|
| Recombinant DNA reagent | pUC57 (plasmid) | Thermo Fisher | Cat#: SD0171 | Used to in vitro transcribe ZIKV UTR RNA |
| Sequence-based reagent | TNRC6A_F | DOI:10.1016/j.molcel.2019.11.007 | qRT-PCR primers | ACTAACTGTGGAGACCTTCACG |
| Sequence-based reagent | TNRC6A _R | DOI:10.1016/j.molcel.2019.11.007 | qRT-PCR primers | GTTAATGGGAGATGGGCTGCTA |
| Sequence-based reagent | PUM2_F | DOI:10.1016/j.molcel.2019.11.007 | qRT-PCR primers | TTTGCGCAAATACACATACGGG |
| Sequence-based reagent | PUM2 _R | DOI:10.1016/j.molcel.2019.11.007 | qRT-PCR primers | GGTCCTCCAATAGGTCCTAGGT |
| Sequence-based reagent | CIRBP_F | DOI:10.1016/j.molcel.2019.11.007 | qRT-PCR primers | GACCACGAGCCATGAGTTTTC |
| Sequence-based reagent | CIRBP _R | DOI:10.1016/j.molcel.2019.11.007 | qRT-PCR primers | CTCAGAGAAGTGAGTGGGGC |
| Sequence-based reagent | IGF2BP2_F | This paper | qRT-PCR primers | CGGGGAAGAGACGGATGATG |
| Sequence-based reagent | IGF2BP2_R | This paper | qRT-PCR primers | CGCAGCGGGAAATCAATCTG |
| Sequence-based reagent | ZIKV_F | This paper | qRT-PCR primers | AGA TGA ACT GAT TGG CCG GGC |
| Sequence-based reagent | ZIKV_R | This paper | qRT-PCR primers | AGG TCC CTT CTG TGG AAA TA |
| Sequence-based reagent | GAPDH_F | This paper | qRT-PCR primers | GAA GGT GAA GGT CGG AGT C |
| Sequence-based reagent | GAPDH_R | qRT-PCR primers | GAA GAT GGT GAT GGG ATT TC | |
| Sequence-based reagent | AscI-ATG-VCP_F | This paper | VCP cloning primers | CTGCAGGCGCGCCGCCACCATG GCTTCTGGAGCCGATTC |
| Sequence-based reagent | VCP-HA-STOP-SpeI_ R | This paper | VCP cloning primers | ACAAACTAGTTTAGTAATCAGGCACGTCATAGGGGTAACCGCCATACAGGTCATCATCA |
| Sequence-based reagent | AscI-ATG-IGF2BP2_F | This paper | IGF2BP2 cloning primers | CTGCAGGCGCGCCGCCACCATGATGAACAAGCTTTACAT |
| Sequence-based reagent | IGF2BP2-HA-STOP-SpeI_R | This paper | IGF2BP2 cloning primers | ACAAACTAGTTTAGTAATCAGGCACGTCATAGGGGTAACCCTTGCTGCGCTGTGAGGCGA |
| Commercial assay or kit | mMESSAGE mMACHINE T7 transcription Kit |
Thermo Fisher | Cat#: AM1344 | |
| Commercial assay or kit | Invitrogen SuperScript IV VILO Master Mix RT kit |
Thermo Fisher | Cat#: 11756050 | RT-qPCR assays |
| Commercial assay or kit | Applied Biosystems SyBr Green Master mix | Thermo Fisher | Cat#: A25918 | RT-qPCR assays |
| Commercial assay or kit | ViewRNA ISH Cell Assay kit | Thermo Fisher | Cat#: QVC0001 Cat#: QVC0508 Cat#: QVC0509 Cat#: QG0507 Cat#: QVC0700 Cat#: VF4-20142 |
Detection of ZIKV H/PF/2013 RNA in FISH experiments |
| Commercial assay or kit | Monoclonal Anti-HA-Agarose antibody | MilliporeSigma | Cat#: A2095 | |
| Commercial assay or kit | Trizol-LS | Thermo Fisher | Cat#: 10296010 | |
| Chemical compound, drug | NITD-008 | Tocris Small Molecules | Cat#: 6045/1 | |
| Software, algorithm | Prism 10 | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | MaxQuant software v.1.6.17 | MaxQuant | RRID: SCR_014485 | |
| Software, algorithm | Perseus software v.1.6.15 | MaxQuant | RRID: SCR_015753 | |
| Software, algorithm | MO.Affinity Analysis software v.2.1.3 | NanoTemper Technologies GmbH | ||
| Software, algorithm | ImageLab software | Bio-Rad | RRID:SCR_014210 | |
| Software, algorithm | FIJI |
https://imagej.net/software/fiji/
DOI:10.1038/nmeth.2019 |
RRID:SCR_002285 |