Abstract
Circular RNAs (circRNAs) have garnered attention for their potential involvement in the regulation of cellular aging processes. Exploring the role and mechanism of circRNAs in cellular senescence may help to identify new anti-aging therapeutic targets. In the present study, we investigated the role and regulatory mechanism of hsa_circ_0127071 in renal aging. We employed high-throughput sequencing to assess circRNA expression differences in kidney tissues from young and old groups. qRT-PCR confirmed that the expression of hsa_circ_0127071 in kidney tissue of the old group was significantly higher than that of the young group. Cellular senescence was evaluated using SA-β-Gal staining and Masson’s trichrome staining. Using RNA Immunoprecipitation (RIP), RNA Pull-Down Assay (RNA pull down), and Western Blot (WB) to study the interaction between hsa_circ_0127071 and aging related pathway proteins. In this study, we found that the expression of hsa_circ_0127071 in kidney tissue of the old group was significantly higher than that of the young group. Silencing of EIF4A3, a protein involved in the JAK2/STAT5 signaling pathway, was found to delay the aging process. On the basis of silencing EIF4A3 expression, the JAK2/STAT5 signaling pathway was activated by Erythropoietin (EPO) processing, and the senescence of Human glomerular mesangial cells (HGMCs) increased. After treatment with Losartan (LOS), the activity of JAK2/STAT5 pathway was decreased and the aging process of HGMCs was delayed. Our findings demonstrate that hsa_circ_0127071 promotes renal aging through the EIF4A3/JAK2/STAT5 signaling axis, highlighting a novel potential therapeutic target for the management of renal aging and associated disorders.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-024-79284-4.
Keywords: Human glomerular mesangial cells, Signaling pathway, Renal aging, Regulatory mechanism
Subject terms: Long non-coding RNAs, Gene expression, Gene regulation, Genetic association study, Sequencing, RNA, Senescence, Non-coding RNAs, Transcription, Transcriptomics, Kidney diseases, Kidney, Kidney diseases, Cell biology, Molecular biology, Diseases, Molecular medicine, Nephrology
Introduction
With advancements in healthcare, public health measures, and improved living conditions, human life expectancy has markedly increased over recent decades1. The increase in age may lead to the accumulation of senescent cells in aging organisms, leading to a gradual loss of tissue and organ function. Notably, the regenerative capacity of kidney tissue diminishes with age2. Aging is significantly related to changes in renal structure and function: at the macro structural level, the volume of renal cortex decreased with age, the surface roughness increased, and the number and size of simple renal cysts increased; at the microstructural level, histological changes of renal sclerosis, such as arteriosclerosis, global glomerulosclerosis, interstitial fibrosis and tubular atrophy all increase with age3. These pathological changes are closely associated with an elevated incidence of end-stage kidney disease. The structure and function of aging kidneys gradually undergo changes, mainly presented as cell cycle arrest, telomere shortening, renal interstitial fibrosis, renal tubular atrophy, and glomerulosclerosis4. Understanding the molecular mechanisms underlying kidney cell aging, identifying effective molecular therapeutic targets, and delaying renal aging processes are vital for enhancing the quality of life in patients with age-related renal decline.
Circular RNAs (circRNAs) are endogenous transcripts characterized by a covalently closed loop structure, where the 3’ and 5’ ends are joined together. CircRNAs are generated by the connection between downstream splicing donors and upstream splicing receptors. Compared to linear RNAs, circRNAs exhibit greater stability, tissue specificity, and evolutionary conservation5. CircRNA was first discovered in plant viroid by electron microscopy in 1976. Researchers have found that circRNAs are widely expressed at different stages of tissue development in many species and participate in many important pathophysiological processes6,7. Recent studies have demonstrated that circRNAs play regulatory roles in various organ diseases and injuries, including cardiovascular diseases, kidney diseases, liver diseases, and central nervous system (CNS) injuries8. CircRNAs have become anti-aging therapeutic targets by regulating cellular senescence related features. During renal aging, dysregulated circRNAs are most enriched in endoplasmic reticulum stress-related pathways; for example, circNpas2 influences cell aging by regulating the expression of TCCK-19. We identified a Hsa_circ_0127071 that was significantly up-regulated in aging renal tissues by high-throughput sequencing of circRNA. Located at chromosome 4: 83,601,859–83,626,566, there are currently no reports on its biological function. This study explored the role of hsa_circ_0127071 in renal aging, providing a potential therapeutic target for the prevention of renal aging.
EIF4A3 greatly modulates transcription factor-to-transcription factor responses by binding to transcription factors, thereby inhibiting transcription factor phosphorylation, dimerization, and nuclear translocation10. EIF4A3 is an RNA binding protein that binds to RNA to produce an exon ligating complex that mediates exon splicing. EIF4A3 can be recruited by long non-coding RNAs, thereby affecting the translation of target genes in tumors11. In addition, studies have shown that EIF4A3 plays a crucial role in pre-mRNA splicing, inducing the formation of circRNAs by binding to the upstream regions of certain specific mRNA12. It has been demonstrated that EIF4A3 promotes the biogenesis and stability of circTOLLIP, thereby activating the epithelial-mesenchymal transition (EMT) pathway and promoting tumor progression in liver cancer13. However, it has not been reported whether EIF4A3 can adjust the generation process of hsa_circ_0127071.
The JAK/STAT signaling pathway has emerged as a prominent target for drug development and cancer therapy due to its crucial role in tumor cell survival, proliferation, and invasion14. The JAK2/STAT5 pathway is critical for many biological processes, including cell differentiation, proliferation, apoptosis, immunity and hematopoietic function15,16. Activation of the JAK2/STAT5 pathway enhances cell viability and reduces apoptosis in PC12 neural disease cell models17. JAK2 is an important cytoplasmic tyrosine kinase, located downstream of the cytokine receptors, which promotes the proliferation of normal and tumor cells. It activates major downstream targets, including STAT5, phosphoinositide 3-kinase (PI3K), and extracellular signal-regulated kinases (ERKs). Together with STAT5, JAK2 is considered to be a key mediator for tumor cell growth and survival18,19. At present, the regulatory mechanisms between hsa_circ_0127071, EIF4A3 and JAK2/STAT5 signaling pathways have not been reported.
Advanced glycation end products (AGEs) are formed through a series of non-enzymatic reactions between reducing sugars and amino groups of proteins20. With the increase of age, AGEs will gradually accumulate in biological tissues, and this accumulation process will lead to the decline in the biological function of various systems21. Known as aging products, AGEs may contribute to the development of chronic kidney disease (CKD) and CKD-related complications by increasing reactive oxygen species production, inducing inflammation, and promoting fibrosis22.
Human glomerular mesangial cells (HGMCs) are one of the most important endogenous cells in the kidney, which play an important role in maintaining the metabolic balance of extracellular matrix in the glomerular mesangial region. Changes in their phenotype and function are important in the aging process of the kidney. Our team has confirmed that high glucose/AGEs/AngII induction can induce senescence of HGMCs, and STAT5 is involved in the senescence process of HGMCs by inhibiting autophagy23. Whether hsa_circ_0127071 plays a role in this process is unknown. Therefore, in this study, AGEs-induced HGMCs senescence was used to construct an in vitro HGMCs senescence cell model to explore the regulatory effects of hsa_circ_0127071, EIF4A3 and JAK2/STAT5 signaling pathways on renal cell senescence. This study aims to provide targets and a molecular basis for the treatment of kidney aging by uncovering the underlying molecular regulatory mechanisms.
Materials and methods
Human tissue samples
This study was reviewed and approved by the Medical Science Research Ethics Committee of the First Affiliated Hospital of China Medical University. All experiments were performed in accordance with relevant guidelines and regulations. We confirm that informed consent was obtained from all subjects and/or their legal guardian(s).
We collected a total of 76 discarded renal tissue samples from patients who underwent radical nephrectomy for urological tumors or trauma at the First Affiliated Hospital of China Medical University between March 12, 2018, and August 15, 2018. The inclusion criteria were defined as follows: ①. Radical nephrectomy for urinary tumor or trauma; ②. Informed consent signed by subject or family member; ③. The distance between the specimen and the tumor was not less than 5 cm; ④. The normal human kidney tissue was identified as non-cancer adjacent tissue by pathological examination.The exclusion criteria were defined as follows:①. Obstructive nephropathy; ②. Renal insufficiency or combined with other kidney diseases; ③. Diabetes, hypertension, proteinuria, or other systemic diseases; ④. All patients had received radiotherapy or chemotherapy before the operation; ⑤. All patients had a long history of taking medication.
From the collected samples, 10 patients were selected based on these criteria. Among them, five patients were aged ≥ 65 years (specimen numbers: CY7, CY24, CY44, CY49, CY59), and five patients were aged < 40 years (specimen numbers: CY26, CY52, CY54, CY72, CY76). The clinicopathological parameters are summarized in Table 1. Renal cortex samples, located more than 5 cm away from the tumor margin or injury site, were obtained from the resected specimens. The renal cortex specimens obtained during the operation were proved to be normal renal tissue by pathological examination. Immediately after collection, the specimens were placed in normal saline, kept on ice at 4 °C, and transferred aseptically to the laboratory. The samples were rinsed with precooled 4 ° C sterile PBS to remove the residual blood and tissue fluid. The specimens were further trimmed using tweezers and ophthalmic scissors; the renal capsule was removed, and surrounding tissues were separated. According to the follow-up design, the subjects were divided into two groups: young-kidney group (aged < 40, n = 5) and Aged‐kidney group (aged ≥ 65, n = 5).
Table 1.
Clinical information of selected patients.
| Project | Young group | Aged group | p value | Statistical significance |
|---|---|---|---|---|
| Number (number) | 5 | 5 | No | |
| Age (years) | 32.2 ± 5,27 | 73.8 ± 4.87 | 0.0000012 | Yes |
| Weight (kg) | 75.13 ± 14.19 | 65.2 ± 13.63 | 0.2918 | No |
| Height (cm) | 166.9 ± 8.02 | 166.89 ± 10.35 | 0.9987 | No |
| Creatinine(umol/L) | 60 ± 13.7 | 77 ± 4.69 | 0.56 | No |
| Urine protein | - | - | 0.173 | No |
| Sex ratio | 1:1.5 | 1:1.5 | 0.221 | No |
Cell culture
The HGMCs used in this study were purchased from ScienCell Research Laboratories with a Catalog Number of 4200. Cell medium was mesangial medium (ScienCell) containing 2% fetal bovine serum (Sigma-Aldrich), 100 U/mL penicillin, and 0.1 mg/ml streptomycin (ScienCell). HGMCs were cultured in a cell incubator at 37 ℃ and 5% CO2. When the cell density was about 80%, cell passage was performed.(The treatment reagents involved in cell culture include EPO(Miragen, 266800), losartan(Merck, 114798-26-4), AG490(Abcam, ab120950)).
High-throughput sequencing of circRNAs
High-throughput sequencing and subsequent bioinformatic analysis of circRNAs were performed on five aged and five young renal tissue samples.Briefly, total RNA was treated using the Ribo-Zero rRNA Removal Kit (Illumina, CA, USA) to remove ribosomal RNA, and the resulting RNA was used to construct RNA libraries using the TruSeq Stranded Total RNA Library Prep Kit (Illumina) according to the manufacturer’s instructions. Libraries were quality-controlled and quantified using the BioAnalyzer 2100 System (Agilent Technologies, CA, USA), then sequenced (150 cycles) on the HiSeq 4000 platform (Illumina). The quality of paired-end reads was checked in terms of the Q30 metric on the HiSeq 4000 platform. High-quality reads were trimmed using Cutadapt software (v1.9.3)24 and aligned to the reference genome or transcriptome using STAR software (v2.5.1b)25. CircRNAs were identified using DCC software (v0.4.4)26 and annotated using the circBase27 and circ2Traits28 databases. Data on the expression of circRNAs were normalized and expression differences between cancerous and healthy tissue analyzed using EdgeR software (v3.16.5)29. The RNA-seq data have been uploaded to the GEO database (accession number: GSE245017).
AGEs induce senescence in HGMCs
In this study, 500 mg of bovine serum albumin (BSA) and 1000 mg of D-glucose were dissolved in 100 mL of sterile phosphate-buffered saline (PBS) and gently mixed on a shaker for 30 min. 0.22 μm sterile filter was used in the ultra-clean table to filter and remove bacteria. The sterile solution was incubated at 37 °C for 90 days, during which it remained clear and free from turbidity. The incubated solution was dialysis, and sterile PBS was used for dialysis for 24 h, and PBS was replaced every 6 h to ensure the removal of residual glucose. The absorbance at 370 nm of the solution remaining in the dialysis bag was measured using a spectrophotometer to determine the concentration of advanced glycation end products–bovine serum albumin (AGEs-BSA). HGMCs cells were treated with 250 mg/L AGEs to induce senescence.
Vector construction and cell transfection
Cell suspensions prepared in MCM culture medium without serum and antibiotics were inoculated into six-well plates at a density of 5 × 105 cells per well in a total volume of 2 mL. When cell density and fusion degree was about 80%, cell transfection was performed. Small hairpin RNA (shRNA) was diluted to 0.5 µg/µL in serum-free and antibiotic-free MCM medium.The sequences of shRNA template are summarized in Table 2. Five microliters of Lipofectamine 3000 transfection reagent were added to 125 µL of serum-free and antibiotic-free MCM medium. The 5 µL shRNA diluent was added to 125 µL serum-free and antibiotic-free MCM medium. Gently shake well and leave at room temperature in dark for 5 min to fully mix. shRNA diluent was mixed with Lipofectamine 3000 transfection reagent and left for 25 min at room temperature away from light. The culture medium in the wells was discarded, and the shRNA-Lipofectamine 3000 complex was added to the cells, along with additional serum-free and antibiotic-free MCM medium. After 24 h culture, transfected cells were treated with fluid change. The fluorescence of cells was observed under fluorescence microscope to evaluate the transfection efficiency.
Table 2.
Sequences of shRNA template.
| Gene | Sequence(5’->3’) |
|---|---|
| Hsa_circ_0127071 | CCAGAGAAACCTACTTCTGCT |
| EIF4A3 | CGCATCTTGGTGAAACGTGAT |
| NC | - |
qRT-PCR (quantitative real-time PCR) assay
Total RNA was extracted from cells and tissues using TRIzol reagent (Life Technologies Corporation, CA, USA). Nanodrop Spectrophotometer (ND-1000, Thermo Fisher Scientific, MA, USA) was used to check the purity and quality of the extracted RNA. To detect the expression level of hsa_circ_0127071, we employed a one-step SYBR PrimeScript RT-PCR kit (Takara, Kyoto, Japan) and the 7500 FAST Real-Time PCR System (Applied Biosystems, Shanghai, China), following the manufacturer’s instructions. The expression level was determined by 2−ΔΔCt with GAPDH as the reference gene.
For the RNase R digestion assay, a reaction mixture was prepared containing 5 µg of total RNA, 2 µL of 10× reaction buffer, 20 U of RNase R (20 U/µL, Thermo Fisher Scientific, MA, USA), and nuclease-free water to a final volume of 20 µL. The reaction buffer system was incubated at 37 °C for 40 min and 70 °C for 10 min. Then, the expression level of hsa_circ_0127071 was detected by qRT-PCR. The primers involved in this study are shown in Table 3.
Table 3.
Primers used for RT-qPCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Hsa_circ_0127071 | 5’-CTGGAGACAGCAGTGCTTGA-3’ | 5’-CAAGTGGAGCAAGCTCATCA-3’ |
| GAPDH | 5’-GGTGAAGGTCGGAGTCAACG-3’ | 5’-CCATGTAGTTGAGGTCAATGAAG-3’ |
Western blot assays
The collected cells were treated with lysate and protease inhibitor, and then lysed on ice for 30 min. The lysate was then sonicated using an ultrasonic homogenizer to ensure complete cell disruption, followed by centrifugation at 12,000 × g for 45 min at 4 °C. The extracted protein concentration was determined using the BCA protein assay kit (Santa Cruz Biotechnology, TX, USA). Equal amounts of protein samples were separated by SDS-PAGE and subsequently transferred onto polyvinylidene difluoride (PVDF) membranes. After electrophoresis, the gel was transferred to the PVDF membrane. After the transfer, the corresponding primary and secondary antibodies were incubated. Follow the instructions to use the ECL Bioluminescence kit (Santa Cruz Biotechnology, TX, USA) for strip coloration. Band intensities were quantified using ChemImager 5500 V2.03 software, with GAPDH used as a loading control to obtain the integral density values (IDVs) of each target protein. The antibodies and brands used in this study are as follows: EIF4A3 (Abcam, ab180573), P16 (Abcam, ab51243), P53 (Abcam, ab32389), P21 (Abcam, ab109520), JAK2 (Abcam, ab32101), STAT5 (Abcam, ab230670), p-STAT5 (Abcam, ab32364) and GAPDH (Abcam, ab8245).
Senescence-associated‐β‐galactosidasestaining (SA-β-Gal) assay
Cells were seeded in 6-well plates at a density of 5 × 10^5 cells per well in 2 mL of medium. SA-β-Gal staining was performed 6 h after seeding. Dilute 10X fixing solution with deionized water to 1X fixing solution. The 10× staining solution was heated in a 37 °C water bath and mixed thoroughly to ensure complete dissolution. Dilute the dissolved 10X staining solution with deionized water to 1X staining solution. The culture medium was discarded from the wells, and the cells were washed with phosphate-buffered saline (PBS). After cleaning, add 1X fixing solution to the well plate and fix at room temperature for 20 min. Discard the fixing solution in the well plate and clean it once with PBS. After cleaning, add dyeing solution to the well plate and dye overnight in dark. Following overnight incubation, the wells were washed three times with PBS pre-warmed to 37 °C. Subsequently, 1 mL of 70% glycerol in PBS was added to each well. Take photos under an inverted fluorescence microscope and calculate the number of stained blue-green cells.
RNA immunoprecipitation (RIP) assay
Collect whole-cell lysates from each group and incubate them overnight with magnetic bead RIP buffer containing anti-human Argonaute 2 (Ago2) antibody (Millipore, Billerica, MA, USA) and anti-human EIF4A3 antibody (Abcam, Cambridge, UK). The negative control group was incubated with normal mouse IgG (Millipore). After incubation, treat the samples with Proteinase K buffer and then isolate the immunoprecipitated RNA. Determine the RNA concentration using a NanoDrop spectrophotometer, and assess RNA quality using a bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Purify the RNA and perform reverse transcription. The RNA enrichment was then detected by quantitative real-time PCR (qRT-PCR).
RNA pull-down assay
An RNA pull-down assay for EIF4A3 and hsa_circ_0127071 was performed using an RNA pull-down kit (Bersinbio, Guangzhou, China). The biotinylated hsa_circ_0127071 probe used to capture EIF4A3 was synthesized by GenePharma. Cells were collected and lysed with lysis buffer. The biotin-labeled probes were incubated with streptavidin-coated magnetic beads to generate probe-coupled magnetic beads. The cell extract (800 µL) was incubated with the probe-coupled magnetic beads or with a negative control (NC) probe. Proteins pulled down by the probes were collected using protein elution buffer. The differential abundance of hsa_circ_0127071-binding proteins was confirmed by western blotting analysis.
Immunohistochemical analysis
Paraffin-embedded tissue sections were dewaxed to water. Antigen retrieval was performed under high pressure for 5 min in citric acid retrieval solution (0.01 mol/L, pH 6.0). After washing with phosphate-buffered saline (PBS) three times, the sections were incubated with 3% hydrogen peroxide at room temperature for 20 min to block endogenous peroxidase activity. The sections were then blocked with normal sheep serum (working solution) at room temperature for 30 min. Primary antibodies were added, and the sections were incubated at 4 °C overnight. After incubation, the sections were washed three times with PBS, each for 5 min. Secondary antibodies were applied to the sections, followed by incubation at 37 °C for 20 min. The sections were washed again three times with PBS for 5 min each. Finally, the tissue sections were counterstained with hematoxylin, dehydrated through graded alcohols, cleared with xylene, and mounted with neutral balsam.
Masson assay
In this study, tissue blocks were obtained using a sterile scalpel and placed in paraformaldehyde fixative. The tissue were dehydrated in ethanol solution with gradient concentration and embedded in wax blocks. The wax blocks were then sectioned into 3-micron slices and mounted onto slides for subsequent Masson’s staining steps. The slices were used PBS to soak the slides 3 times for 3 min each. Masson’s trichrome staining was performed using a reagent kit. Specific procedures were as follows: Weigert iron hematoxylin staining for 8 min, acid ethanol differentiation solution for 10 s, and wash once. Masson bluing solution rebluing for 3 min, wash once. Wash with distilled water for 1 min. Lichun Red fuchsin staining solution for 8 min. Wash with weak acid working solution for 1 min. Wash with phosphomolybdic acid solution for 1 min and with weak acid working solution for 1 min. Stain with aniline blue dye solution for 1 min, followed by a rinse with weak acid working solution for 1 min. Rapid dehydration with 95% ethanol for 2 s and anhydrous ethanol for 3 times for 8s each time. Xylene transparent 3 times, 2 min each time. Mount with neutral balsam and observe under a microscope.
Statistical analysis
All experimental data in this study were statistically analyzed using GraphPad Prism v7.01 software (GraphPad, CA, USA). Data are expressed as mean ± standard deviation (SD). Comparisons between groups were performed by Student’s t test and one-way ANOVA. After image acquisition, IOD was converted into numerical variables using Image Pro Plus 6.0 and MicroChemi 4.2 software.
Results
Hsa_circ_0127071 expression is upregulated in aging kidney tissue
We first conducted a Masson staining experiment to assess potential pathological changes in kidney tissues between the young and aged groups. Compared with the young group, the degree of glomerular sclerosis in the renal cortex was significantly increased in the aged group, indicating that renal senescence had indeed occurred (Fig. S1). Additionally, immunohistochemical staining for the aging-related proteins P21 and P53 in the kidney tissues of both groups confirmed that the expression levels of P21 and P53 were significantly upregulated in the aged group (Fig. S2A-D). The above results indicated that there were significant pathological changes between the young and the aged groups.
Next, we performed high-throughput sequencing on the collected young and aged renal tissue samples to compare the differential expression of circRNAs.Using cut off values of p < 0.05 and | logFC | > 2, we found a total of 307 differentially expressed circRNAs between the young and aged renal tissue samples, including 160 circRNAs that were upregulated in the aged and 147 that were downregulated (Fig. 1A-C). We then validated the differential expression of circRNAs between the two groups using qRT-PCR, which confirmed that hsa_circ_0127071 was significantly upregulated in the aged group compared with the young group (Fig. 1D). hsa_circ_0127071 was generated by back-splicing of exons 2 and 3 of the SCD5 gene (Fig. 1E), and its sequence and back-splicing junction site was GGTGCCATTGATGACATCTT were then confirmed by Sanger sequencing (Fig. 1F). Given that head-to-tail splicing can result from either reverse splicing of cDNA or genomic rearrangements, we designed convergent and divergent primers for hsa_circ_0127071. The results indicated that hsa_circ_0127071 was amplified by the divergent primers only from cDNA but not from gDNA (Fig. 1G). Next, we treated hsa_circ_0127071 and linear SCD5 with RNase R. The results showed that while linear SCD5 was digested, hsa_circ_0127071 remained stable, confirming its RNase R resistance (Fig. 1H-I). We then detected the half-life of hsa_circ_0127071 and linear SCD5 by actinicin (D) treatment. Compared with linear SCD5, the half-life of hsa_circ_0127071 was significantly prolonged (Fig. 1J). Lastly, fluorescence in situ hybridization (FISH) demonstrated that hsa_circ_0127071 was predominantly localized in the cytoplasm (Fig. 1K). Overall, these findings suggested that hsa_circ_0127071 had the typical properties of circRNAs and was significantly upregulated in aging kidney tissues.
Fig. 1.

Hsa_circ_0127071 was upregulated in Aged human kidney tissues. (A) The heatmap of differential expression of circRNAs. (B) The correlations between upregulated and decreased circRNAs. (C) The distribution of the upregulated and decreased circRNAs. (D) The expression level of hsa_circ_0127071 in young and Aged kidney tissues. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. young group. (E) The scheme for hsa_circ_0127071 information. (F) Sanger sequencing validated the sequence on the junction sites of hsa_circ_0127071. (G) Hsa_circ_0127071 was detected in cDNA and gDNA. (H) The expression level of hsa_circ_0127071 in Circ (without RNase R treatment) and RNase R-Circ (with RNase R treatment). Data are presented as mean ± SD (n = 3, each group). (I) The expression level of Liner SCD5 in Liner (without RNase R treatment) and RNase R-Liner (without RNase R treatment). Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. Liner group. (J) The expression level of hsa_circ_0127071 in HGMCs treated with actinomycin D at different time points. (K) The colocalization of has_circ_0127071 in HGMCs. Scale bars = 50 μm.
Knockdown of has_circ_0127071 regulated HGMCs aging by regulating the JAK2/STAT5 signaling pathway
We induced aging in human glomerular mesangial cells (HGMCs) by treating them with 250 mg/L advanced glycation end products (AGEs) for at least 48 h. The induction of AGEs increased the expression of JAK2/STAT5 signaling pathway proteins (JAK2, STAT5, p-STAT5) and aging-related proteins (P16, P53, P21) in HGMCs (Fig. 2A-C).These results suggest that HGMC aging is significantly associated with the JAK2/STAT5 signaling pathway.
Fig. 2.

Knockdown of hsa_circ_0127071 inhibited senescence of HGMCs. (A) Statistical analysis of the expression of JAK2/STAT5 pathway proteins. Data are presented as mean ± SD (n = 3, each group). *P < 0.05, **P < 0.01 vs. AGEs-0 h group. (B)T s. AGEs-0 h group. (C) Statistical analysis of the expression of aging-related proteins. Data are presented as mean ± SD (n = 3, each group). *P < 0.05, **P < 0.01 vs. AGEs-0 h group. (D) The expression level of hsa_circ_0127071. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. hsa_circ_0127071(-)-NC group. (E) The expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins. (F) Statistical analysis of the expression of JAK2/STAT5 signaling pathway proteins. Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. hsa_circ_0127071(-)-NC group; #P < 0.05, ##P < 0.01 vs. hsa_circ_0127071(-) group; &P < 0.05 vs. hsa_circ_0127071(-) + EPO group; ▲P < 0.05, ▲▲P < 0.01 vs. hsa_circ_0127071(-) + LOS group. (G) Statistical analysis of the expression of aging-related proteins. Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. hsa_circ_0127071(-)-NC group; #P < 0.05, ##P < 0.01 vs. hsa_circ_0127071(-) group; &P < 0.05, &&P < 0.01 vs. hsa_circ_0127071(-) + EPO group; ▲P < 0.05, ▲▲P < 0.01 vs. hsa_circ_0127071(-) + LOS group. (I) SA-β-gal staining images showing senescent cells. (H) Statistical analysis of the percentages of senescent cells. Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. hsa_circ_0127071(-)-NC group; #P < 0.05; ##P < 0.01 vs. hsa_circ_0127071(-) group; &P < 0.05, vs. hsa_circ_0127071(-) + EPO group; ▲P < 0.05 vs. hsa_circ_0127071(-) + LOS group.
To explore the potential role of hsa_circ_0127071 in renal aging, we designed a silencing plasmid to reduce its expression in HGMCs. The knockdown efficiency of hsa_circ_0127071 was confirmed by qPCR (Fig. 2D).
Erythropoietin (EPO) is a glycoprotein produced by the kidney that promotes erythrocyte formation in the bone marrow30. The combined action of EPO and stem cell factors can activate the JAK2/STAT5 signaling pathway and synergistically enhance the migration ability of cervical cancer cells31. Additionally, EPO has been shown to activate the JAK2/STAT5 pathway in a variety of hematopoietic cell lines32. Therefore, we chose EPO as a targeted activator of the JAK2/STAT5 pathway in this study. In order to investigate whether hsa_circ_0127071 affect the senescence process of HGMCs by regulating the activity of JAK2/STAT5 signaling pathway, we used EPO and LOS(Losartan, LOS) combined treatment on the basis of silencing hsa_circ_0127071. Changes in the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins were detected (Fig. 2E-G). Compared with the hsa_circ_0127071(-)-NC group, the expression of JAK2/STAT5 signaling pathway protein and aging-related protein were decreased in the hsa_circ_0127071(-) group. These results indicate that knockdown of hsa_circ_0127071 decreases the activity of the JAK2/STAT5 signaling pathway and delays the aging process of HGMCs. Compared with the hsa_circ_0127071(-) group, the expression of JAK2/STAT5 signaling pathway protein and aging-related protein was upregulated in the hsa_circ_0127071(-) + EPO group. This suggests that activation of the JAK2/STAT5 signaling pathway can promote the aging process of HGMCs even after silencing hsa_circ_0127071. Compared with the hsa_circ_0127071(-) group, the expression of JAK2/STAT5 signaling pathway protein and aging-related protein was decreased in the hsa_circ_0127071(-) + LOS group. These findings indicate that LOS treatment can reduce the activity of the JAK2/STAT5 signaling pathway and slow down the aging process of HGMCs following silencing of hsa_circ_0127071. Compared with the hsa_circ_0127071(-) + EPO group, the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins was decreased in the hsa_circ_0127071(-) + EPO + LOS group. These results suggest that LOS treatment can reduce the activity of the JAK2/STAT5 signaling pathway and slow down the aging process of HGMCs, even in the presence of hsa_circ_0127071 silencing and JAK2/STAT5 pathway activation. Compared with the hsa_circ_0127071(-) + LOS group, the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins were upregulated in the hsa_circ_0127071(-) + EPO + LOS group. This indicates that activation of the JAK2/STAT5 signaling pathway can promote the aging process of HGMCs, even when hsa_circ_0127071 is silenced and LOS treatment is applied.
Senescence-associated β-galactosidase (SA-β-Gal) stained positive cells indicatedd senescence cells, which grew larger and became irregular. The cytoplasm is dark blue and the nuclei is unstained. The results of SA-β-Gal staining showed that the positive rate decreased when hsa_circ_0127071 was silenced, indicating a reduction in cellular senescence. After the activation of JAK2/STAT5 signaling pathway, the positive rate of SA-β-Gal staining increased, and the degree of cell senescence was obvious.Following LOS treatment, the positive rate of SA-β-Gal staining decreased, and the degree of senescence was reduced (Fig. 2H-I). These results indicated that the activity of JAK2/STAT5 signaling pathway was decreased after hsa_circ_0127071 silencing, which can delay the aging process. Upon activation of the JAK2/STAT5 signaling pathway with EPO treatment following hsa_circ_0127071 silencing, the senescence of HGMCs increased. After treatment with LOS, the activity of JAK2/STAT5 pathway was decreased and the aging process of HGMCs was delayed.
Overexpression of has_circ_0127071 promoted senescence of HGMCs
To further investigate the regulatory role of hsa_circ_0127071 in renal aging, we constructed a plasmid to overexpress hsa_circ_0127071. As expected, the expression of hsa_circ_0127071 was significantly elevated in the overexpression group (hsa_circ_0127071(+)) compared to the control (hsa_circ_0127071(+)-NC) (Fig. 3A). AG490 is a specific JAK inhibitor that inhibits the phosphorylation and activity of STAT333. AG490 can inhibit the activation of JAK2 and down-regulate phosphorylation of STATs34. AG490 can specifically inhibit the JAK/STAT pathway35. In this study, based on the overexpression of hsa_circ_0127071, AG490 combined with LOS treatment was used to detect the expression changes of JAK2/STAT5 signaling pathway proteins and aging-related proteins. Upon overexpression of hsa_circ_0127071, JAK2/STAT5 pathway activity was upregulated, as evidenced by increased expression of JAK2/STAT5 signaling proteins and aging-related markers, indicating that hsa_circ_0127071 promotes cellular aging through this pathway. These results indicated that overexpression of hsa_circ_0127071(+) can activate the JAK2/STAT5 signaling pathway and promote the aging process. Compared with hsa_circ_0127071(+) group, the expressions of JAK2/STAT5 signaling pathway protein and aging-related protein were decreased in hsa_circ_0127071(+) + AG490 group and hsa_circ_0127071(+) + LOS group, which slowed down the aging process. This suggests that both AG490 and LOS can suppress the JAK2/STAT5 signaling pathway, mitigating the pro-aging effects of hsa_circ_0127071 overexpression. Compared with the hsa_circ_0127071(+) + AG490 group, the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in the hsa_circ_0127071(+) + AG490 + LOS group, which slowed down the aging process. This demonstrates that LOS can further attenuate JAK2/STAT5 pathway activity and delay cellular aging, even in the presence of hsa_circ_0127071 overexpression and JAK2/STAT5 inhibition by AG490 (Fig. 3B-D). Compared with the hsa_circ_0127071(+) + LOS group, the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in the hsa_circ_0127071(+) + AG490 + LOS group, which slowed down the aging process. These results emphasize the potential therapeutic value of targeting the JAK2/STAT5 pathway in the context of renal aging.
Fig. 3.

Overexpression of hsa_circ_0127071 promoted senescence of HGMCs. (A) The expression level of hsa_circ_0127071. Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. hsa_circ_0127071(+)-NC group. (B) The expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins. (C) Statistical analysis of the expression of JAK2/STAT5 signaling pathway proteins. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. hsa_circ_0127071(+)-NC group; #P < 0.05, ##P < 0.01 vs. hsa_circ_0127071(+) group; &&P < 0.01 vs. hsa_circ_0127071(+) + AG490 group; ▲▲P < 0.01 vs. hsa_circ_0127071(+) + LOS group; ■P < 0.05, ■■P < 0.01 vs. hsa_circ_0127071(+) group. (D) Statistical analysis of the expression of aging-related proteins. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. hsa_circ_0127071(+)-NC group; #P < 0.05, ##P < 0.01 vs. hsa_circ_0127071(+) group; &P < 0.05 vs. hsa_circ_0127071(+) + AG490 group; ▲P < 0.05 vs. hsa_circ_0127071(+) + LOS group; ■■P < 0.01 vs. hsa_circ_0127071(+) group. (E) SA-β-gal staining images showing senescent cells. (F) Statistical analysis of the percentages of senescent cells. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. hsa_circ_0127071(+)-NC group; #P < 0.05, ##P < 0.01 vs. hsa_circ_0127071(+) group; &&P < 0.01 vs. hsa_circ_0127071(+) + AG490 group; ▲P < 0.05 vs. hsa_circ_0127071(+) + LOS group; ■■P < 0.01 vs. hsa_circ_0127071(+) group.
SA-β-Gal staining revealed that overexpression of hsa_circ_0127071 led to an increase in SA-β-Gal-positive cells, signifying enhanced cellular aging.The activity of JAK2/STAT5 signaling pathway was inhibited, the positive rate of SA-β-Gal staining was decreased, and the degree of cell senescence was weakened. Following LOS treatment, SA-β-Gal-positive cells decreased, suggesting that senescence was mitigated. These results indicated that overexpression of hsa_circ_0127071 increased the activity of JAK2/STAT5 signaling pathway, which can promote the aging process. With hsa_circ_0127071 overexpression, AG490 inhibition of the JAK2/STAT5 pathway resulted in reduced cell senescence. With LOS treatment, JAK2/STAT5 pathway activity was decreased and cell senescence was delayed (Fig. 3E-F).
Studies have confirmed that circRNAs can act as molecular sponges for microRNAs (miRNAs), regulating processes such as renal interstitial fibrosis36. In order to determine whether hsa_circ_0127071 has spongification adsorption, binding sites between hsa_circ_0127071 and miR-665 were pre-discovered through bioinformatics database in this study (Fig. S3A). We explored the regulatory effect of hsa_circ_0127071 on miR-665 and its impact on cell senescence (Fig. 3B-F).The results show that compared with the hsa_circ_0127071(+) group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased, and the positive rate of SA-β-gal staining was decreased in the hsa_circ_0127071(+) + miR-665 group. These findings indicate that hsa_circ_0127071 functions as a molecular sponge for miR-665, influencing the process of cellular senescence.
The RNA binding protein EIF4A3 promoted the expression of hsa_circ_0127071
Using the Circular Interactome database (https://circi-nteractome.nia.nih.gov/), we identified a potential binding site for the RNA-binding protein EIF4A3 within the hsa_circ_0127071 mRNA region (Fig. 4A). In this study, we investigated whether EIF4A3 regulates the expression of hsa_circ_0127071. To address this, we conducted transfection experiments in HGMCs to establish EIF4A3 silencing and overexpressing cell lines (Fig. 4B-C). Subsequently, we examined the expression changes of hsa_circ_0127071 when EIF4A3 was silenced or overexpressed. hsa_circ_0127071 expression was significantly reduced in EIF4A3-silenced cell lines and elevated in EIF4A3-overexpressing cells (Fig. 4D-E). Then, we used RIP experiments to confirm the interaction between EIF4A3 and hsa_circ_0127071. Compared to the IgG control group, hsa_circ_0127071 enrichment was significantly increased in the anti-EIF4A3 group (Fig. 4F).RNA pull-down experiments confirmed the binding effect of EIF4A3 and hsa_circ_0127071 (Fig. 4G). In summary, this study showed that EIF4A3 promoted its expression by binding hsa_circ_0127071.
Fig. 4.

EIF4A3 promoted the expression of hsa_circ_0127071. (A) The binding site of hsa_circ_0127071 and EIF4A3. (B) The expression level of EIF4A3. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(-)-NC group. (C) The expression level of EIF4A3. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(+)-NC group. (D) The expression level of hsa_circ_0127071. Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. EIF4A3(-)-NC group. (E) The expression level of hsa_circ_0127071. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(+)-NC group. (F) The relative enrichment of hsa_circ_0127071. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. lgG group. (G) The direct binding between EIF4A3 and hsa_circ_0127071.
Silencing EIF4A3 delayed the aging process of HGMCs through JAK2/STAT5 pathway
To investigate the role of EIF4A3 in renal aging, we analyzed the changes in JAK2/STAT5 signaling pathway proteins and aging-related proteins following EIF4A3 silencing (Fig. 5A-C). Compared with EIF4A3(-)-NC group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in EIF4A3(-) group, confirming that the activity of JAK2/STAT5 signaling pathway was decreased after silencing EIF4A3. These findings suggest that EIF4A3 silencing could decrease signaling pathway activity and delay the aging process in HGMCs. Compared with EIF4A3(-) group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were upregulated in EIF4A3(-) + EPO group. This indicates that activating the JAK2/STAT5 signaling pathway can accelerate the aging process of HGMCs even after EIF4A3 silencing. Compared with EIF4A3(-) group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in EIF4A3(-) + LOS group. This demonstrates that LOS treatment can suppress JAK2/STAT5 signaling pathway activity and slow the aging process of HGMCs after EIF4A3 silencing. Compared with EIF4A3(-) + EPO group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in EIF4A3(-) + EPO + LOS group. These findings indicate that LOS treatment can decrease JAK2/STAT5 signaling pathway activity and slow the aging process of HGMCs even when EIF4A3 is silenced and the JAK2/STAT5 pathway is activated.Compared with EIF4A3(-) + LOS group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were upregulated in EIF4A3(-) + EPO + LOS group. These results indicated that the activation of JAK2/STAT5 signaling pathway can promote the aging process of HGMCs based on EIF4A3 silencing and LOS treatment.
Fig. 5.

Silencing EIF4A3 inhibited senescence of HGMCs. (A) The expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins. (B) Statistical analysis of the expression of JAK2/STAT5 signaling pathway proteins. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(-)-NC group; #P < 0.05, ##P < 0.01 vs. EIF4A3(-) group; &P < 0.05 vs. EIF4A3(-) + EPO group; ▲▲P < 0.01 vs. EIF4A3(-) + LOS group. (C) Statistical analysis of the expression of aging-related proteins. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(-)-NC group; #P < 0.05, ##P < 0.01 vs. EIF4A3(-) group; &P < 0.05, &&P < 0.01 vs. EIF4A3(-) + EPO group; ▲P < 0.05, ▲▲P < 0.01 vs. EIF4A3(-) + LOS group. (D) SA-β-gal staining images showing senescent cells. (E) Statistical analysis of the percentages of senescent cells. Data are presented as mean ± SD (n = 3, each group). *P < 0.05 vs. EIF4A3(-)-NC group; #P < 0.05, ##P < 0.01 vs. EIF4A3(-) group; &P < 0.05 vs. EIF4A3(-) + EPO group; ▲P < 0.05 vs. EIF4A3(-) + LOS group.
SA-β-Gal staining showed that the positive rate of SA-β-Gal staining and the degree of aging decreased following EIF4A3 silencing. After EPO increased the activity of JAK2/STAT5 signaling pathway, the positive rate of SA-β-Gal staining increased, and the degree of cell senescence was obvious.Following LOS treatment, the positive rate of SA-β-Gal staining decreased, and the degree of senescence was reduced. These results indicated that the activity of JAK2/STAT5 signaling pathway is decreased after EIF4A3 silencing, which can delay the aging process. Upon EPO treatment, activation of the JAK2/STAT5 signaling pathway after EIF4A3 silencing led to increased HGMC senescence. LOS therapy could reduce the pathway activity and delay the senescence of HGMCs. These results suggested that EIF4A3 regulated renal aging process through JAK2/STAT5 pathway.
The regulatory effect of overexpression of EIF4A3 on senescence of HGMCs
In this study, we detected changes in the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins following EIF4A3 overexpression (Fig. 6A-C). Compared with the EIF4A3(+)-NC group, the expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins in the EIF4A3(+) group were upregulated, which confirmed that after overexpression of EIF4A3, the activity of JAK2/STAT5 signaling pathway was upregulated, promoting the aging process. These findings indicate that EIF4A3 overexpression activates the JAK2/STAT5 signaling pathway, thereby promoting cellular aging. Compared with EIF4A3(+) + AG490 group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in EIF4A3(+) + AG490 group, which slowed down the aging process. These findings suggest that inhibiting JAK2/STAT5 signaling pathway activity can mitigate cell senescence in the context of EIF4A3 overexpression. Compared with EIF4A3(+) + LOS group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in EIF4A3(+) + LOS group, which slowed down the aging process. These results demonstrate that in the context of EIF4A3 overexpression, LOS treatment reduces JAK2/STAT5 pathway activity and significantly slows cellular aging. Compared with EIF4A3(+) + AG490 group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were decreased in EIF4A3(+) + AG490 + LOS group, which slowed down the aging process. These findings suggest that LOS treatment reduces JAK2/STAT5 pathway activity and slows cell aging in the context of EIF4A3 and JAK2/STAT5 inhibition. Compared with EIF4A3(+) + LOS group, the expressions of JAK2/STAT5 signaling pathway proteins and aging-related proteins were upregulated in EIF4A3(+) + AG490 + LOS group, which promoted the aging process. These results indicate that JAK2/STAT5 signaling pathway inhibition can enhance cellular aging under EIF4A3 overexpression and LOS treatment.
Fig. 6.

Overexpression of EIF4A3 promoted senescence of HGMCs. (A) The expression of JAK2/STAT5 signaling pathway proteins and aging-related proteins. (B) Statistical analysis of the expression of JAK2/STAT5 signaling pathway proteins. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(+)-NC group; #P < 0.05, ##P < 0.01 vs. EIF4A3(+) group; &P < 0.05, &&P < 0.01 vs. EIF4A3(+) + AG490 group; ▲P < 0.05, ▲▲P < 0.01 vs. EIF4A3(+) + LOS group. (C) Statistical analysis of the expression of aging-related proteins. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(+)-NC group; #P < 0.05, ##P < 0.01 vs. EIF4A3(+) group; &P < 0.05, &&P < 0.01 vs. EIF4A3(+) + AG490 group; ▲P < 0.05, ▲▲P < 0.01 vs. EIF4A3(+) + LOS group. (D) SA-β-gal staining images showing senescent cells. (E) Statistical analysis of the percentages of senescent cells. Data are presented as mean ± SD (n = 3, each group). **P < 0.01 vs. EIF4A3(+)-NC group; ##P < 0.01 vs. EIF4A3(+) group; &P < 0.05 vs. EIF4A3(+) + AG490 group; ▲P < 0.05 vs. EIF4A3(+) + LOS group.
SA-β-Gal staining showed that overexpression of EIF4A3 increased the positive rate of SA-β-Gal staining, and the degree of aging increased. With JAK2/STAT5 pathway inhibition, the positive rate of SA-β-Gal staining increased, showing obvious cell senescence. After LOS treatment, the positive rate of SA-β-Gal staining decreased and the degree of senescence decreased. These results suggest that EIF4A3 overexpression increases JAK2/STAT5 signaling activity, promoting aging. On the basis of overexpression of EIF4A3, AG490 was used to inhibit the activity of signal pathway and the process of cell aging decline. LOS therapy can reduce the activity of pathway and delay the process of cell aging.
Discussion
Aging is a natural, progressive biological process marked by a gradual decline in cellular function and structural changes across multiple organ systems37. Aging is an inevitable process of renal tissue degradation in elderly patients, and renal function declines with age38. Progressive deterioration of renal structure is part of normal aging process39.As we age, kidney cells gradually accumulate damage, leading to a decline in cell function(PMID: 32835891,PMID: 38527400)40,41. Increasing evidence from past studies has shown that circRNAs possess unique molecular structures, with cell- and tissue-specific expression, making them valuable therapeutic targets and biomarkers for early diagnosis of malignant tumors. In this study, we explored the regulatory role of circRNAs in renal aging.
Protein misfolding and aggregation increase in the aged kidney, affecting the cell’s clearance mechanisms(PMID:34246657)42.Increased senescence-associated β-galactosidase (SA-β-Gal) activity is often used to recognize senescent cells43. SA-β-Gal is a widely utilized biomarker for aging, providing a valuable tool for assessing “healthy aging” in cells and potentially predicting individual longevity. With the increase of age, the content of SA-β-gal in mice gradually increases, and among the major organs of naturally aging mice, the accumulation of SA-β-gal in the kidney is the most significant, indicating that the kidney is the most severely aged organ in the process of natural aging44. P53 and P21 proteins regulate the cell cycle and are key markers of cellular aging45. Studies have confirmed that STAT1 can directly interact with P53 as a co-activator to regulate the functional activity of P53 response genes. Activated STAT1 also binds to STAT1-responsive elements in the P21 promoter region, positively regulating P21 expression, leading to cell cycle arrest or apoptosis. Therefore, the STAT1-P53-P21 signaling axis can regulate the aging of HGMCs under stress conditions46. P16 is another critical biomarker of aging.P21 is activated during early aging, while P16 is activated at a later stage47. Renal senescence stems from cellular senescence, an irreversible state of cell cycle arrest, marked by morphological and epigenetic changes due to various forms of stress. In this study, P53, P21 and P16 were selected as key marker proteins of cell senescence, and SA-β-gal staining was used to further characterize the degree of cell senescence.
CircRNAs are single-stranded, closed-loop RNA molecules that have been shown to play crucial roles in various biological and pathological processes. It has been reported that CircHIPK3 is one of the most abundant circRNAs in the heart, and its expression is sharply decreased during cardiomyocyte (CMs) aging. Loss of CircHIPK3 can lead to decreased cardiac function and increased CMs senescence48. Smoking plays a key role in the pathogenesis of chronic obstructive pulmonary disease (COPD), which is characterized by inflammation of alveolar epithelial cells and cellular senescence. CircXPO1 was overexpressed in the lungs of mice exposed to cigarette smoke (CS) and in the alveolar epithelial cell line MLE12 treated with CS extract (CSE). Inhibiting circXPO1 reduced CSE-induced inflammatory cytokine production and cell senescence49. CircRNF169 accelerates the aging of mouse embryonic fibroblast (mef) cells and is a therapeutic target for anti-aging intervention50. However, the roles and mechanisms of circRNAs in aging and age-related diseases remain unclear. In this study, we focused on the regulatory functions and molecular mechanisms of a newly discovered circRNAs hsa_circ_0127071 in renal aging. Hsa_circ_0127071 was found to be highly expressed in aged kidneys. Sanger sequencing assay, RNase R enzyme tolerance assay and half-life assay confirmed that hsa_circ_0127071 had the typical properties of circRNAs.To further investigate the regulatory role of hsa_circ_0127071 in renal aging, transfection experiments were conducted in HGMCs. The results showed that silencing hsa_circ_0127071 delayed the aging process of HGMCs by reducing the activity of JAK2/STAT5 pathway.
Overexpression of hsa_circ_0127071 promotes aging process by promoting JAK2/STAT5 signaling pathway activity. On the basis of overexpression of hsa_circ_0127071, JAK2/STAT5 signaling pathway activity was inhibited by AG490 treatment, and cell senescence decreased. Angiotensin II (AngII), the central effector molecule of the renin-angiotensin system (RAS), plays a critical role in promoting both systemic and cellular aging. By accelerating age-related processes, AngII contributes to the pathogenesis of various age-associated diseases. Losartan (LOS), an AngII receptor antagonist, has been shown to counteract these aging-related effects by inhibiting AngII signaling, thereby mitigating features of cellular senescence and delaying the progression of age-related dysfunctions51.The activity of JAK2/STAT5 pathway was decreased by LOS treatment, which delayed cell senescence.
miR-665 is highly expressed in various cancers and plays a key role in promoting tumor progression. In hepatocellular carcinoma (HCC), it facilitates proliferation and metastasis by downregulating tumor suppressor genes such as PTPRB and HOXA152.Circular RNAs (circRNAs) act as miRNA sponges, binding to miRNAs like miR-665 and modulating their activity. For instance, in lung adenocarcinoma, Circ_0129047 inhibited LUAD progression by sponging miR-665 and upregulating PTPRB expression, indicating its potential in preventing LUAD53. Based on this mechanism, it is speculated that hsa_circ_0127071 might similarly regulate miR-665, influencing tumor growth by modulating miR-665’s interaction with its targets.In summary, the interaction between miR-665 and circRNAs plays a crucial role in cancer progression. Further investigation into circRNAs like hsa_circ_0127071 could provide insights into novel therapeutic strategies aimed at targeting miR-665’s oncogenic activity.
EIF4A3 plays a key regulatory role in multiple signaling pathways, impacting essential cellular processes such as post-transcriptional regulation, mRNA splicing, and degradation. In embryonic stem cells, it helps maintain pluripotency by regulating specific mRNAs, while in the Wnt/β-catenin pathway, it influences cell proliferation and differentiation, both critical in development and cancer progression54.EIF4A3 also regulates mRNA splicing as part of the exon junction complex (EJC), ensuring proper mRNA quality control. Furthermore, through interactions with lncRNAs and miRNAs, it indirectly modulates the JAK2/STAT5 pathway and autophagy, contributing to cellular stress responses55.Additionally, EIF4A3 interacts with METTL3, affecting circRNA generation via m6A modification, which plays a role in alternative splicing and tumor progression. These mechanisms highlight EIF4A3’s involvement in crucial biological processes and its potential as a therapeutic target, particularly in cancer56.
The RNA-binding protein EIF4A3 is part of the translation initiation factor EIF4A DEAD-box helicase family. Currently, multiple RNA binding proteins have been reported to have a regulatory effect on circRNAs biogenesis13. EIF4A3 has been shown to activate circMMP9 transcription in glioblastoma57. EIF4A3-induced circWAC promotes proliferation, migration, invasion and glycolysis of breast cancer cells, and inhibits apoptosis of breast cancer cells58.In this study, the binding of EIF4A3 to hsa_circ_0127071 was confirmed via RIP and RNA pull-down experiments. In this study, we verified the expression changes of hsa_circ_0127071 after transfection with EIF4A3. The results showed a decrease in hsa_circ_0127071 expression following EIF4A3 silencing, while overexpression of EIF4A3 led to increased hsa_circ_0127071 expression. In summary, EIF4A3 promoted the expression of hsa_circ_0127071 by binding with hsa_circ_0127071.
This study explored EIF4A3’s regulatory effect on cellular senescence. The results confirmed that after silencing EIF4A3, the activity of JAK2/STAT5 signaling pathway was decreased, which could delay the aging process. Upon EIF4A3 silencing, EPO activation of the JAK2/STAT5 signaling pathway increased HGMC senescence. After treatment with LOS, the activity of JAK2/STAT5 pathway was decreased and the aging process of HGMCs was delayed. Overexpression of EIF4A3 increased JAK2/STAT5 pathway activity, promoting the aging process. On the basis of overexpression of EIF4A3, AG490 treatment inhibited the activity of signal pathway, and the cell senescence decreased. LOS therapy decreased pathway activity and delayed cell senescence.
In summary, our results suggested that hsa_circ_0127071 promoted the aging process of HGMCs and played a key role in regulating renal aging. Mechanistically, EIF4A3 increased hsa_circ_0127071 expression by binding to it. The increased expression of hsa_circ_0127071 further activated the JAK2/STAT5 signaling pathway, caused changes in the expression of aging-related proteins P53/P21/P16, and promoted the aging process of kidney cells. The study confirms the significant role of the EIF4A3/hsa_circ_0127071/JAK2/STAT5 axis in regulating renal aging.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Author contributions
Y conceived the study; Y, S, and L designed experiments. Y, S, X, D, L performed experiments and data collection. Y analyzed all data and prepared the figures. Y and L wrote the manuscript.
Funding
This study was funded by National Natural Science Foundation of China 81370870.
Data availability
The datasets generated during the current study are available in the GEO database, https://www.ncbi.nlm.nih.gov/geo/ and accession number: GSE245017.
Declarations
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Shuang Yang, Email: yrch128@163.com.
Lining Wang, Email: lnwang56@163.com.
References
- 1.Fang, Y. et al. AGE-related GSK3β overexpression drives podocyte senescence and glomerular aging. J. Clin. Invest.10.1172/JCI141848 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Van der Wolde, J. et al. The ability of remaining glomerular podocytes to adapt to the loss of their neighbours decreases with AGEs. Cell Tissue Res.10.1007/s00441-022-03611-2 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hommos, M. S., Glassock, R. J. & Rule, A. D. Structural and functional changes in human kidneys with healthy aging. J. Am. Soc. Nephrol.10.1681/ASN.2017040421 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Xiao, Q. Cinnamaldehyde attenuates kidney senescence and injury through PI3K/Akt pathway-mediated autophagy via downregulating miR-155. Ren. Fail.10.1080/0886022X.2022.2056485 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zhao, F. et al. Deregulated expression of circular RNAs is associated with immune evasion and leukemia relapse after allogeneic hematopoietic stem cell transplantation. Genes (Basel)10.3390/genes13111986 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yepmo, M. et al. Discussing the role of circular RNA in the pathogenesis of non-alcoholic fatty liver disease and its complications. Front. Endocrinol. (Lausanne).10.3389/fendo.2022.1035159 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Xu, S. L. et al. Circular RNAs regulate vascular remodelling in pulmonary hypertension. Dis. Markers.10.1155/2022/4433627 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wong, R. et al. Circular RNAs in organ injury: Recent development. J. Transl. Med.10.1186/s12967-022-03725-9 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gao, F. et al. Emerging roles of circRNAs in mice kidney with aging. Microsc. Res. Tech.10.1002/jemt.24147 (2022). [DOI] [PubMed] [Google Scholar]
- 10.Gao, Q. et al. eIF4A3 promotes RNA viruses’ replication by inhibiting innate immune responses. J. Virol.10.1128/jvi.01513-22 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zhang, M. et al. circ_0086296 induced atherosclerotic lesions via the IFIT1/STAT1 feedback loop by sponging miR-576-3p. Cell Mol. Biol. Lett.10.1186/s11658-022-00372-2 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhou, X. et al. EIF4A3-induced circFIP1L1 represses miR-1253 and promotes radiosensitivity of nasopharyngeal carcinoma. Cell Mol. Life Sci.10.1007/s00018-022-04350-x (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Liu, Y. et al. EIF4A3-induced circTOLLIP promotes the progression of hepatocellular carcinoma via the miR-516a-5p/PBX3/EMT pathway. J. Exp. Clin. Cancer Res.10.1186/s13046-022-02378-2 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wang, F. et al. CircNOL10 suppresses breast cancer progression by sponging miR-767-5p to regulate SOCS2/JAK/STAT signaling. J. Biomed. Sci.10.1186/s12929-020-00697-0 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wang, M. et al. Intracellular matrix Gla protein promotes tumor progression by activating JAK2/STAT5 signaling in gastric cancer. Mol. Oncol.10.1002/1878-0261.12652 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ma, R. et al. JAK2/STAT5/Bcl-xL signalling is essential for erythropoietin-mediated protection against apoptosis induced in PC12 cells by the amyloid β-peptide Aβ25-35. Br. J. Pharmacol.10.1111/bph.12672 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liu, F. et al. Electroacupuncture Improves cerebral ischemic injury by enhancing the EPO-JAK2-STAT5 pathway in rats. Neuropsychiatr. Dis Treat.10.2147/NDT.S316136 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Keller, A. et al. The JAK2/STAT5 signaling pathway as a potential therapeutic target in canine mastocytoma. Vet. Comp. Oncol.10.1111/vco.12311 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Korça, E. et al. Circulating antibodies against AGEs-modified proteins in patients with coronary atherosclerosis. Sci. Rep.10.1038/s41598-020-73877-5 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Brinkley, T. E., Semba, R. D., Kritchevsky, S. B. & Houston, D. K. Dietary protein intake and circulating advanced glycation end product/receptor for advanced glycation end product concentrations in the Health, Aging, and Body Composition Study. Am. J. Clin. Nutr.10.1093/ajcn/nqaa241 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dozio, E. et al. Sarcopenia in chronic kidney disease: focus on advanced glycation end products as mediators and markers of oxidative stress. Biomedicines10.3390/biomedicines9040405 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Prieur, A. & Peeper, D. S. Cellular senescence in vivo: A barrier to tumorigenesis. Curr. Opin. Cell Biol.10.1016/j.ceb.2008.01.007 (2008). [DOI] [PubMed] [Google Scholar]
- 23.Shi, M. et al. The RAGEs/STAT5/autophagy axis regulates senescence in mesangial cells. Cell Signal.10.1016/j.cellsig.2019.05.019 (2019). [DOI] [PubMed] [Google Scholar]
- 24.Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet. J.10.1089/cmb.2017.0096 (2011). [Google Scholar]
- 25.Dobin, A. et al. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics10.1093/bioinformatics/bts635 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Metge, F., Dieterich, C. & Cheng, J. Specific identification and quantification of circular RNAs from sequencing data. Bioinformatics10.1093/bioinformatics/btv656 (2016). [DOI] [PubMed] [Google Scholar]
- 27.Rajewsky, N., Glažar, P. & Papavasileiou, P. CircBase: A database for circular RNAs. RNA10.1261/rna.043687.113 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ghosal, S., Das, S., Sen, R., Basak, P. & Chakrabarti, J. Circ2Traits: A comprehensive database for circular RNA potentially associated with disease and traits. Front. Genet.10.3389/fgene.2013.00283 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Smyth, G. K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics10.1093/bioinformatics/btp616 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ma, B. X. et al. Recombinant human erythropoietin protects myocardial cells from apoptosis via the janus-activated kinase 2/signal transducer and activator of transcription 5 pathway in rats with epilepsy. Curr. Ther. Res. Clin. Exp.10.1016/j.curtheres.2015.07.001 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Tóthová, Z. et al. The role of PI3K/AKT and MAPK signaling pathways in erythropoietin signalization. Int. J. Mol. Sci.10.3390/ijms22147682 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Iwatsuki, K. et al. STAT5 activation correlates with erythropoietin receptor-mediated erythroid differentiation of an erythroleukemia cell line. J. Biol. Chem.10.1074/jbc.272.13.8149 (1997). [DOI] [PubMed] [Google Scholar]
- 33.Fan, L. & Zhou, L. AG490 protects cerebral ischemia/reperfusion injury via inhibiting the JAK2/3 signaling pathway. Brain Behav.10.1002/brb3.1911 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Jia, L. et al. Electroacupuncture pretreatment attenuates intestinal injury after autogenous orthotopic liver transplantation in rats via the JAK/STAT pathway. Oxid. Med. Cell Longev.10.1155/2020/9187406 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Choi, J. K. et al. Signal transduction pathways of GM-CSF in neural cell lines. Neurosci. Lett.10.1016/j.neulet.2007.03.065 (2007). [DOI] [PubMed] [Google Scholar]
- 36.Zhang, F. et al. CircRNA_0017076 acts as a sponge for miR-185-5p in the control of epithelial-to-mesenchymal transition of tubular epithelial cells during renal interstitial fibrosis. Hum. Cell.10.1007/s13577-023-00877-8 (2023). [DOI] [PubMed] [Google Scholar]
- 37.Denic, A., Glassock, R. J. & Rule, A. D. Structural and functional changes with the aging kidney. Adv. Chronic Kidney Dis.10.1053/j.ackd.2015.08.004 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Wiggins, J. E. Aging in the glomerulus. J. Gerontol. A Biol. Sci. Med. Sci.10.1093/gerona/gls157 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Van Thiel, B. S. et al. In vivo Renin activity imaging in the kidney of progeroid ercc1 mutant mice. Int. J. Mol. Sci.10.3390/ijms222212433 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Fang, Y. et al. The ageing kidney: Molecular mechanisms and clinical implications. Ageing Res. Rev.10.1016/j.arr.2020.101151 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Chen, M. et al. The redox-sensitive GSK3β is a key regulator of glomerular podocyte injury in type 2 diabetic kidney disease. Redox Biol.10.1016/j.redox.2024.103127 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Fang, Y. et al. The ketone body β-hydroxybutyrate mitigates the senescence response of glomerular podocytes to diabetic insults. Kidney Int.10.1016/j.kint.2021.06.031 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Gong, W. et al. Brahma-related gene-1 promotes tubular senescence and renal fibrosis through Wnt/β-catenin/autophagy axis. Clin. Sci. (Lond.)10.1042/CS20210447 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Li, X. et al. First-generation species-selective chemical probes for fluorescence imaging of human senescence-associated β-galactosidase. Chem. Sci.10.1039/D0SC01234C (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Wei, H., Wang, J. & Liang, Z. STAT1-p53-p21axis-dependent stress-induced progression of chronic nephrosis in adriamycin-induced mouse model. Ann. Transl. Med.10.21037/atm-20-5167 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Yang, L. et al. FFAR4 improves the senescence of tubular epithelial cells by AMPK/SirT3 signaling in acute kidney injury. Signal Transduct. Target Ther.10.1038/s41392-022-01254-x (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ding, F. et al. circHIPK3 prevents cardiac senescence by acting as a scaffold to recruit ubiquitin ligase to degrade HuR. Theranostics10.7150/thno.77630 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Du, Y. et al. Suppression of circXPO1 attenuates cigarette smoke-induced inflammation and cellular senescence of alveolar epithelial cells in chronic obstructive pulmonary disease. Int. Immunopharmacol.10.1016/j.intimp.2022.109086 (2022). [DOI] [PubMed] [Google Scholar]
- 49.Zhang, D. et al. Circular RNA circRNF169 functions as a miR-30c-5p sponge to promote cellular senescence. Biochem. Biophys. Res. Commun.10.1016/j.bbrc.2022.03.041 (2022). [DOI] [PubMed] [Google Scholar]
- 50.Zhou, H. et al. Role of the JAK2/STAT pathway and losartan in human glomerular mesangial cell senescence. Mol. Med. Rep.10.3892/mmr_00000270 (2010). [DOI] [PubMed] [Google Scholar]
- 51.Guan, X. et al. Hsa-miR-665 is a promising biomarker in cancer prognosis. Cancers10.3390/cancers15204915 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Xia, X., Fan, J. & Fan, Z. Hsa_circ_0129047 sponges miR-665 to attenuate lung adenocarcinoma progression by upregulating protein tyrosine phosphatase receptor type B. Korean J. Physiol. Pharmacol.10.4196/kjpp.2023.27.2.131 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Li, D. et al. An RNAi screen of RNA helicases identifies eIF4A3 as a regulator of embryonic stem cell identity. Nucleic Acids Res.10.1093/nar/gkac1084 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Wang, Bo. et al. Eukaryotic initiation factor 4A3 inhibits Wnt/β-catenin signaling and regulates axis formation in zebrafish embryos. Development10.1242/dev.198101 (2021). [DOI] [PubMed] [Google Scholar]
- 55.Niu, Z.-S. et al. Role of long noncoding RNA-mediated competing endogenous RNA regulatory network in hepatocellular carcinoma. World J. Gastroenterol.10.3748/wjg.v26.i29.4240 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Wang, S. et al. The combined effects of circular RNA methylation promote pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol.10.1165/rcmb.2021-0379OC (2022). [DOI] [PubMed] [Google Scholar]
- 57.Wang, R. et al. EIF4A3-induced circular RNA MMP9 (circMMP9) acts as a sponge of miR-124 and promotes glioblastoma multiforme cell tumorigenesis. Mol. Cancer10.1186/s12943-018-0911-0 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Huang, W. H., Yang, Q. & Zhang, C. eIF4A3-induced circWAC promotes breast cancer progression through mediating miR-599/E2F3 axis. Kaohsiung J. Med. Sci.10.1002/kjm2.12496 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated during the current study are available in the GEO database, https://www.ncbi.nlm.nih.gov/geo/ and accession number: GSE245017.
