KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-TCRβ (H57-597), Brilliant Violet 711 | Biolegend | Cat# 109243; RRID:AB_2629564 |
| anti-CD8α (53-6.7), PerCP-Cyanine5.5 | Cytek/Tonbo | Cat# 65-0081-U100; RRID:AB_2621882 |
| anti-CD8α (53-6.7), Biotin | Thermo Fisher Scientific | Cat# 13-0081-82; RRID: AB_466346 |
| anti-CD103 (2E7), APC | Thermo Fisher Scientific | Cat# 17-1031-82; RRID: AB_1106992 |
| anti-CD103 (2E7), Brilliant Violet 711 | Thermo Fisher Scientific | Cat# 407-1031-82; RRID: AB_2942156 |
| anti-CD69 (H1.2F3), PE/Cyanine 7 | Biolegend | Cat# 104512; RRID: AB_493564 |
| anti-CCR9 (CW-1.2), Brilliant Violet 421 | BD Bioscience | Cat# 565412; RRID: AB_2739223 |
| anti-CD45.1 (A20), Brilliant Violet 711 | Biolegend | Cat# 110739; RRID: AB_2562605 |
| anti-CD45.2 (104), PE/Cyanine 7 | Biolegend | Cat# 109830; RRID: AB_1186098 |
| anti-Thy1.1 (OX-7), PE | Biolegend | Cat# 202524; RRID: AB_1595524 |
| anti-Thy1.2 (53-2.1), Brilliant Violet 421 | Biolegend | Cat# 140327; RRID: AB_2686992 |
| anti-CD62L (MEL-14), Brilliant Violet 711 | Biolegend | Cat# 104445; RRID: AB_2564215 |
| anti-α4β7 (DATK32), PE | Thermo Fisher Scientific | Cat# 12-5887-82; RRID: AB_657803 |
| anti-KLRG1 (2F1), Brilliant Violet 605 | Biolegend | Cat# 138419; RRID: AB_2563357 |
| anti-LAMP-1 (1D4B), PE | Thermo Fisher Scientific | Cat# 12-1071-82; RRID: AB_657554 |
| anti-Ki67 (SolA15), APC | Thermo Fisher Scientific | Cat# 17-5698-82; RRID: AB_2688057 |
| anti-IFN-γ (XMG1.2), PE/Cyanine 7 | Biolegend | Cat# 505826; RRID: AB_2295770 |
| anti-TNF-α (MP6-XT22), APC | Biolegend | Cat# 506308; RRID: AB_315429 |
| anti-phosphorylated-S6 (Ser235–Ser236) (D57.2.2E), Pacific Blue | Cell Signaling Technology | Cat# 8520; RRID: AB_2797646 |
| anti-phosphorylated-4EBP1 (Thr37–Thr46) (236B4), Alexa Fluor 647 | Cell Signaling Technology | Cat# 5123; RRID: AB_2097838 |
| anti-phosphorylated-Smad2-Smad3 (072-670), PE | BD Biosciences | Cat# 562586; RRID: AB_11151915 |
| anti-active caspase-3 (C92-605), PE | BD Biosciences | Cat# 561011; RRID: AB_2033931 |
| anti-BrdU (Bu20a), APC | Biolegend | Cat# 339808; RRID: AB_10895898 |
| anti-Epcam (G8.8), biotin | Biolegend | Cat# 118203; RRID: AB_1134174 |
| anti-Goat IgG (H+L) secondary antibody, Alexa Fluor Plus 555 | Thermo Fisher Scientific | Cat# A32816; RRID: AB_2762839 |
| Streptavidin, PE | Thermo Fisher Scientific | Cat# SA10041 |
| Streptavidin, APC-eFluor 780 | Thermo Fisher Scientific | Cat# 47-4317-82; RRID: AB_10366688 |
| Phalloidin, Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A12380 |
| anti-Tfeb | ProteinTech | Cat# 13372-1-AP; RRID: AB_2199611 |
| anti-rabbit IgG (H+L), Alexa Fluor Plus 647 | Thermo Fisher Scientific | Cat# A32795; RRID: AB_2762835 |
| anti-mCherry | Biorbyt | Cat# orb11618; RRID: AB_2687829 |
| Purified anti-mouse CD3 | Bio-X-Cell | Cat# BE0001-1; RRID: AB_1107634 |
| Purified anti-mouse CD28 | Bio-X-Cell | Cat # BE0015-1; RRID: AB_1107624 |
| Bacterial and virus strains | ||
| Listeria monocytogenes expressing ovalbumin (LM-OVA) | In house | N/A |
| Yersinia pseudotuberculosis mutant (Yptb ΔyopM) | Laboratory of Dr. Yasmine Belkaid | N/A |
| Yersinia pseudotuberculosis (WT Yptb) (32777 strain) | Laboratory of Dr. Yasmine Belkaid | N/A |
| LCMV-Armstrong | In house | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| OVA peptide (257–264) | Macromolecular Synthesis Core Facility, St. Jude Children’s Research Hospital | N/A |
| Collagenase, type IV | Worthington Biochemicals | Cat# LS004188 |
| Collagenase, type I | Worthington Biochemicals | Cat# LS004194 |
| Bovine pancreatic deoxyribonuclease I (DNase I) | Sigma-Aldrich | Cat# DN25-1G |
| Percoll | GE Healthcare | Cat#1 7089101 |
| MgCl2 | Ambion | Cat# AM9530G |
| CaCl2 | Thermo Fisher Scientific | Cat# J63122 |
| ACK buffer | Thermo Fisher Scientific | Cat# A1049201 |
| HEPES | Gibco | Cat# 15630-080 |
| β-mercaptoethanol | Sigma-Aldrich | Cat# M6250 |
| EDTA | Thermo Fisher Scientific | Cat# 15575020 |
| Dithiothreitol | Sigma-Aldrich | Cat# D9779 |
| DMEM | Thermo Fisher Scientific | Cat# 11965118 |
| RPMI 1640 | Thermo Fisher Scientific | Cat# 11875085 |
| Click’s medium | FujiFilm Irvine Scientific | Cat# 9195 |
| Penicillin–streptomycin–L-glutamine | Thermo Fisher Scientific | Cat# 15140122 |
| rmIL-7 | PeproTech | Cat# 217-17 |
| rmIL-15 | PeproTech | Cat# 210-15 |
| rhIL-2 | Sigma-Aldrich | Cat# 23-6019 |
| rhTGF-β | R&D | Cat# 240-B |
| Retinoic acid | Sigma-Aldrich | Cat# R2625 |
| Dialyzed FBS | Thermo Fisher Scientific | Cat# A3382001 |
| RPMI 1640 medium without amino acids | US Biological | Cat# R8999-04A |
| MEM amino acids solution | Thermo Fisher Scientific | Cat# 11130051 |
| MEM non-essential amino acids solution | Thermo Fisher Scientific | Cat# 11140050 |
| L-Alanine | Sigma-Aldrich | Cat# A7469 |
| Glycine | Sigma-Aldrich | Cat# 50046 |
| L-Asparagine | Sigma-Aldrich | Cat# A4159 |
| L-Aspartic acid | Sigma-Aldrich | Cat# A8949 |
| L-Glutamic acid | Sigma-Aldrich | Cat# 49449 |
| L-Glutamine | Thermo Fisher Scientific | Cat# A2916801 |
| L-Proline | Sigma-Aldrich | Cat# 81709 |
| L-Serine | Sigma-Aldrich | Cat# 84959 |
| L-Arginine | Sigma-Aldrich | Cat# A8094 |
| L-Cystine dihydrochloride | Sigma-Aldrich | Cat# C2526 |
| L-Histidine | Sigma-Aldrich | Cat# 53319 |
| L-Isoleucine | Sigma-Aldrich | Cat# 58879 |
| L-Leucine | Sigma-Aldrich | Cat# L8912 |
| L-Lysine monohydrochloride | Sigma-Aldrich | Cat# 62929 |
| L-Methionine | Sigma-Aldrich | Cat# 64319 |
| L-Phenylalanine | Sigma-Aldrich | Cat# P5482 |
| L-Threonine | Sigma-Aldrich | Cat# T8441 |
| L-Tryptophan | Sigma-Aldrich | Cat# 93659 |
| L-Tyrosine | Sigma-Aldrich | Cat# 93829 |
| L-Valine | Sigma-Aldrich | Cat# V0513 |
| Triton X-100 | Sigma-Aldrich | Cat# 93443 |
| Tween-20 | Fisher Scientific | Cat# BP337-500 |
| Formaldehyde | Polysciences | Cat# 18814-20 |
| Paraformaldehyde | Thermo Fisher Scientific | Cat# J19943-K2 |
| Normal donkey serum | Jackson ImmunoResearch | Cat# 017-000-121 |
| Poly-D-lysine coated coverslips | Electron Microscopy Sciences | Cat# 72294-04 |
| GolgiStop | BD Biosciences | Cat# 554724 |
| GolgiPlug | BD Biosciences | Cat# 555029 |
| Fixable Viability Dye eFluor 780 | Thermo Fisher Scientific | Cat# 65-0865-14 |
| Polybrene | Sigma-Aldrich | Cat# TR-1003 |
| KOD Hot Start DNA Polymerase | Sigma-Aldrich | Cat# 71086 |
| AMPure XP beads | Beckman Coulter | Cat# A63881 |
| Baker amino acid with 16% total protein (control diet) | TestDiet | Cat# 5CC7 |
| Modified TestDiet 5CC7 with 2% total protein | TestDiet | Cat# 5BT9 |
| Critical commercial assays | ||
| APC BrdU flow kit | BD Biosciences | Cat# 552598 |
| CytoFix/CytoPerm fixation/permeabilization kit | BD Biosciences | Cat# 554714 |
| Phosflow lyse/fix buffer | BD Biosciences | Cat# 558049 |
| Phosflow perm buffer III | BD Biosciences | Cat# 558050 |
| GFP booster | Chromotek/ProteinTech | Cat# gba488 |
| Vectashield Vibrance mounting media with DAPI | Vector Laboratories | Cat# H-1800 |
| Naïve CD8+ T cell isolation kit | Miltenyi Biotec | Cat# 130-096-543 |
| RNeasy Micro Kit | QIAGEN | Cat# 74004 |
| DNeasy Blood & Tissue Kits | QIAGEN | Cat# 69504 |
| Transfection reagent | Mirus | Cat# MIR2706 |
| Clariom S mouse array | Thermo Fisher Scientific | Cat# 902930 |
| Nextera DNA sample preparation kit | Illumina | Cat# FC-121-1031 |
| NEBNext HiFi 2 × PCR master mix | NEB | Cat# M0541S |
| MinElute kit | Qiagen | Cat# 28004 |
| High Sensitivity D5000 ScreenTape | Agilent | Cat# 5067-5592 |
| High Sensitivity D5000 Reagents | Agilent | Cat# 5067-5593 |
| Chromium Next GEM Single Cell 3' GEM, Library & Gel Bead Kit v3.1 | 10X Genomics | Cat# PN-1000128 |
| Chromium Next GEM Chip G Single Cell Kit | 10X Genomics | Cat# PN-1000127 |
| Chromium i7 Sample Index Plate | 10X Genomics | Cat# PN-220103 |
| High-Capacity cDNA Reverse Transcription kit | Thermo Fisher Scientific | Cat# 4374966 |
| Power SYBR Green PCR Master Mix | Thermo Fisher Scientific | Cat# 4309155 |
| Deposited data | ||
| Data files for microarray | This paper | GEO: GSE231502 |
| Processed single-cell RNA sequencing data | This paper | GEO: GSE231502 |
| Data files for ATAC-seq | This paper | GEO: GSE231502 |
| Publicly available microarray and RNA sequencing data | Nath et al.53; Milner et al.7; Milner et al.46; Mackay et al.8 | GEO: GSE125471, GSE107278, GSE157072, GSE47045 |
| Publicly available single-cell RNA sequencing data | Kurd et al.42; Crowl et al.27; Boland et al.28 | GEO: GSE131847, GSE182276, GSE125527 |
| Publicly available putative Tfeb target genes | Palmieri et al.39 | N/A |
| Experimental models: Cell lines | ||
| Plat-E | Laboratory of Dr. Yun-Cai Liu, La Jolla Institute of Immunology | N/A |
| HEK293T | ATCC | Cat# CRL-3216 |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6J | The Jackson Laboratory | Cat# JAX: 000664; RRID: IMSR_JAX:000664 |
| Mouse: OT-I | The Jackson Laboratory | Cat# JAX: 003831; RRID: IMSR_JAX:003831 |
| Mouse: P14 | Laboratory of Dr. Benjamin A. Youngblood, St. Jude Children’s Research Hospital | N/A |
| Mouse: YopE-I | Laboratory of Dr. Yasmine Belkaid | N/A |
| Mouse: Cd4Cre: Tg(Cd4-cre)1Cwi/BfluJ | The Jackson Laboratory | Cat# JAX: 017336; RRID: IMSR_JAX:017336 |
| Mouse: Flcnfl/fl | Laboratory of Dr. Laura S. Schmidt, National Cancer Institute-Frederick | N/A |
| Mouse: Tfebfl/fl | Laboratory of Dr. Andrea Ballabio, Telethon Institute of Genetics and Medicine | N/A |
| Mouse: Tfe3−/− | The Jackson Laboratory | Cat# JAX: 042292; RRID: MMRRC_042292-JAX |
| Mouse: Tcra−/− | The Jackson Laboratory | Cat# JAX: 002116; RRID: IMSR_JAX:002116 |
| Mouse: Rosa26-Cas9 knock-in mice | The Jackson Laboratory | Cat# JAX: 026179; RRID: IMSR_JAX:026179 |
| Oligonucleotides | ||
| Nextera NGS-F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTTGTGGAAAGGACGAAACACCG | This paper | N/A |
| Nextera NGS-R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCACTTTTTCAAGTTGATAACGG | This paper | N/A |
| Tgfbr1-F: TCTGCATTGCACTTATGCTGA | This paper | N/A |
| Tgfbr1-R: AAAGGGCGATCTAGTGATGGA | This paper | N/A |
| Tgfbr2-F: GACTGTCCACTTGCGACAAC | This paper | N/A |
| Tgfbr2-R: GGCAAACCGTCTCCAGAGTAA | This paper | N/A |
| Actb-F: GGCTGTATTCCCCTCCATCG | This paper | N/A |
| Actb-R: CCAGTTGGTAACAATGCCATGT | This paper | N/A |
| sgRNA targeting sequences | This paper | N/A |
| Recombinant DNA | ||
| psPAX2 | N/A | Addgene plasmid # 12260 |
| pCAG4-Eco | N/A | Addgene plasmid # 35617 |
| pMIG-II-retroviral vector | N/A | Addgene #52107 |
| pCL-Eco | N/A | Addgene #12371 |
| Constitutively active Tfeb sequence | N/A | Addgene #79014 |
| Lentiviral mitochondria–lysosome library | This paper | N/A |
| Software and algorithms | ||
| FACSDiva software (version 8) | BD Biosciences | https://www.bdbiosciences.com/en-us/products/software/instrument-software/bd-facsdiva-software |
| FlowJo (version 10.10.0) | BD Biosciences | https://www.flowjo.com/ |
| Prism (version 10.2.2) | GraphPad | https://www.graphpad.com/features |
| NIS Elements software (version 5.30.05) | Nikon Instruments | https://www.microscope.healthcare.nikon.com/products/software/nis-elements |
| HiSeq analysis software | Illumina | https://support.illumina.com/sequencing/sequencing_software/hiseq-analysis-software-v2-1.html |
| MAGeCK software (version 0.5.9.4) | Li et al.79 | https://www.encodeproject.org/software/mageck/ |
| DrugZ software | Colic et al.80 | https://github.com/hart-lab/drugz |
| NetBID2 R package (version 2.0.2) | Dong et al.81 | https://github.com/jyyulab/NetBID |
| JUMPn software (version 0.19.006) | Vanderwall et al..82 | N/A |
| Cytoscape (version 3.7.256) | Shannon et al.83 | https://cytoscape.org/index.html |
| MCODE algorithm | Bader and Hogue84 | N/A |
| CRIS.py | Connelly and Pruett-Miller85 | https://github.com/patrickc01/CRIS.py |
| Limma R package (version 3.46.0) | Ritchie et al.86 | https://bioconductor.org/packages/release/bioc/html/limma.html |
| Gene set enrichment analysis (GSEA) | Subramanian et al.87 | https://www.gsea-msigdb.org/gsea/msigdb/ |
| Seurat R package (version 4.0) | Butler et al.88 | https://satijalab.org/seurat/ |
| Slingshot R package (version 2.12.0) | Street et al.52 | https://www.bioconductor.org/packages/release/bioc/html/slingshot.html |
| gplots R package (version 3.1.1) | N/A | https://cran.r-project.org/web/packages/gplots/index.html |
| Harmony R package (version 1.0) | N/A | https://portals.broadinstitute.org/harmony/ |
| DESeq2 R package (version1.43.5) | N/A | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| limma R package (version 3.46.0) | N/A | https://bioconductor.org/packages/release/bioc/html/limma.html |
| WGCNA R package (version 1.66) | Langfelder and Horvath89 | https://cran.r-project.org/web/packages/WGCNA/index.html |
| FIMO from MEME suite (version 4.11.3) | Bailey et al.90 | https://meme-suite.org/meme/ |
| RGT HINT software | Li et al.38 | https://reg-gen.readthedocs.io/en/latest/hint/introduction.html |
| Picard (version 2.9.4) | N/A | https://broadinstitute.github.io/picard/ |
| Samtools (version 1.9) | N/A | https://www.htslib.org/ |
| IGV (version 2.4.13) | N/A | https://igv.org/ |
| MACS2 | N/A | https://github.com/macs3-project/MACS |
| bedtools (version 2.25.0) | N/A | https://bedtools.readthedocs.io/en/latest/ |
| HOMER software | N/A | http://homer.ucsd.edu/homer/ |
| Other | ||
| LSR Fortessa flow cytometer | BD Biosciences | N/A |
| LSRII flow cytometer | BD Biosciences | N/A |
| Symphony A3 flow cytometer | BD Biosciences | N/A |
| Reflection cell sorter | iCyt | N/A |
| MoFlo cell sorter | BD Biosciences | N/A |
| BigFoot cell sorter | Thermo Fisher Scientific | N/A |
| Miseq and NovaSeq | Illumina | N/A |
| Inverted Ti2 eclipse microscope | Nikon Instruments | N/A |
| Applied Biosystems QuantStudio 7 Flex quantitative PCR machine | Thermo Fisher Scientific | N/A |
| CRISPick | Broad Institute | https://portals.broadinstitute.org/gppx/crispick/public |