Skip to main content
Respiratory Research logoLink to Respiratory Research
. 2024 Nov 27;25:417. doi: 10.1186/s12931-024-03044-1

Inhibition of IRE1α/XBP1 axis alleviates LPS-induced acute lung injury by suppressing TXNIP/NLRP3 inflammasome activation and ERK/p65 signaling pathway

Sijiao Wang 1,#, Lijuan Hu 1,#, Yipeng Fu 2,#, Fan Xu 3, Yue Shen 1, Hanhan Liu 4,, Lei Zhu 5,
PMCID: PMC11603636  PMID: 39604886

Abstract

Background

Acute lung injury or acute respiratory distress syndrome (ALI/ARDS) is a devastating clinical syndrome with high incidence and mortality rates. IRE1α-XBP1 pathway is one of the three major signaling axes of endoplasmic reticulum stress that is involved in inflammation, metabolism, and immunity. The role and potential mechanisms of IRE1α-XBP1 axis in ALI/ARDS has not well understood.

Methods

The ALI murine model was established by intratracheal administration of lipopolysaccharide (LPS). Hematoxylin and eosin (H&E) staining and analysis of bronchoalveolar lavage fluid (BALF) were used to evaluate degree of lung injury. Inflammatory responses were assessed by ELISA and RT-PCR. Apoptosis was evaluated using TUNEL staining and western blot. Moreover, western blot, immunohistochemistry, and immunofluorescence were applied to test expression of IRE1α, XBP1, NLRP3, TXNIP, IL-1β, ERK1/2 and NF-κB p65.

Results

The expression of IRE1α significantly increased after 24 h of LPS treatment. Inhibition of the IRE1α-XBP1 axis with 4µ8C notably improved LPS-induced lung injury and inflammatory infiltration, reduced the levels of IL-6, IL-1β, and TNF-α, and decreased cell apoptosis as well as the activation of the NLRP3 inflammasome. Besides, in LPS-stimulated Beas-2B cells, both 4µ8C and knockdown of XBP1 diminished the mRNA levels of IL-6 and IL-1B, inhibited cell apoptosis and reduced the protein levels of TXNIP, NLRP3 and secreted IL-1β. Mechanically, the phosphorylation and nuclear translocation of ERK1/2 and p65 were significantly suppressed by 4µ8C and XBP1 knockdown.

Conclusions

In summary, our findings suggest that IRE1α-XBP1 axis is crucial in the pathogenesis of ALI/ARDS, whose suppression could mitigate the pulmonary inflammatory response and cell apoptosis in ALI through the TXNIP/NLRP3 inflammasome and ERK/p65 signaling pathway. Our study may provide new evidence that IRE1α-XBP1 may be a promising therapeutic target for ALI/ARDS.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12931-024-03044-1.

Keywords: Acute lung injury, IRE1α-XBP1 axis, Inflammation, NRLP3, ERK/p65

Background

Acute lung injury or acute respiratory distress syndrome (ALI/ARDS) is a devastating common complication with high morbidity and mortality [1, 2]. It is characterized by increased permeability of endothelium lining the lung’s capillaries, disruption of the alveolar epithelial tight junctions and inflammatory injury [3, 4]. Despite decades of research, there is no effective therapeutic strategy for ALI/ARDS [1, 5]. Therefore, it is urgently necessary to explore novel therapeutic targets for ARDS.

Endoplasmic reticulum (ER) is a dynamic organelle orchestrating the folding and post-translational maturation of most proteins [6]. When ER homeostasis is perturbed, the unfolded protein response (UPR) is activated to alleviate ER stress (ERS). There are three UPR sensors including IRE1α, PERK, and ATF6α, determining cell adaptation or inadaptation [7, 8]. During UPR, IRE1α excises an intron from the un-spliced XBP1 mRNA through its endoribonuclease (RNase) domain, causes translational frame shift and generates spliced XBP1 protein (XBP1s), an active transcription factor responsible for regulating the transcription of diverse genes related to metabolism and immune responses [9, 10].

As the most conserved branch of UPR, IRE1α-XBP1 axis can modulate inflammation, apoptosis and oxidative stress. For example, XBP1s regulated the gene expressions of the IL-6 and TNF in LPS-treated macrophages [11], and activated the phosphorylation and nuclear translocation of NF-κB p65 in LPS-exposed cardiomyocyte [12]. 4µ8C, one inhibitor of IRE1α, attenuated acute lung injury through activating β-catenin signaling in airway epithelial cells [13]. Mechanically, inhibiting IRE1α can reverse the reprogrammed cell state of alveolar type II epithelial cells (AEC2) undergoing ER stress and mitigate the alveolitis [14]. Hypercapnia, one characteristics of ARDS, could activate IRE1α to degrade β-subunit Na, K-ATPase, contributing to impaired alveolar epithelial integrity [15].

Emerging evidence have shown that ERS closely intersects with Nod-like receptor protein 3 (NLRP3) inflammasome via oxidative stress, calcium homeostasis, and NF-κB activation [1618]. Thioredoxin-interacting protein (TXNIP) was identified as a NLRP3 binding protein that could mediate subsequent inflammasome formation and activation [19, 20]. Selective activation of the IRE1α-XBP1 axis can activate NLRP3 inflammasome and promote pro-IL-1β cleavage in LPS-stimulated THP-1 cells, human peripheral blood mono-nuclear cells (PBMCs) [21] or Raw264.7 cells [22]. And IRE1a activation can also enhance TXNIP expression to promote NLRP3 inflammasome formation in brain damage [23]. While inhibiting IRE1-XBP1 axis attenuated sepsis-associated microglial pyroptosis and inflammation [24]. Besides, silencing IRE1α alleviated NLRP3 activation via the cAMP/PKA pathway in cardiac fibroblast [25]. In addition, different with classical pyroptosis, LPS mainly activated caspase-11 to trigger NLRP3 inflammasome activation and maturation of pro-IL-1β [26]. At present, the effects and underlying mechanisms of IRE1α-XBP1 axis on TXNIP/NLRP3 inflammasome activation in the lung epithelia cells is unclear. Besides, maladaptive UPR could trigger ERS-induced apoptosis [8, 27], one form of multiple forms of cell death that participate in the development of ALI/ARDS [28, 29]. Although the ERS classical inhibitor 4-PBA attenuated lung epithelia cell apoptosis in ALI induced by LPS or hyperoxia [30, 31], the impact of IRE1α-XBP1 axis on the apoptosis of epithelial cells in ALI has not been fully elucidated.

In this study, we aim to investigate the effects of IRE1α-XBP1 axis on lung injury, inflammatory response, apoptosis as well as NLRP3 inflammasome activation in LPS-induced ALI murine model and lung epithelia cells and further explore the underlying mechanisms.

Materials and methods

Animals and models

C57BL/6 male mice (6 ~ 8 weeks) were purchased from Shanghai JSJ Laboratory. All mice were.

kept in the SPF-grade standard environment in the Animal Faculties of Zhongshan Hospital.

As was previously described [30, 32, 33], mice were anesthetized by intraperitoneal injection of 3% 2,2,2-Tri-bromoethanol (Sigma-Aldrich), and the mice were fixed to 45-degree inclined board after deep anesthesia, followed by the insertion of an endotracheal tube through the glottis under searchlight. Pull out the needle core of the endotracheal tube, and connect the endotracheal tube immediately with a 1 ml syringe with a 1 cm liquid column. If the liquid column jumps with the breathing of mice, it means that the tube has been successfully inserted into the trachea. Then LPS (5 mg/kg, Escherichia coli O111:B4) (Sigma-Aldrich, Saint Louis, USA) dissolved in sterile phosphate buffer solution (PBS) was intratracheally instilled into mice to induce ALI. To ensure that LPS was distributed evenly throughout the mouse lungs, the mice were placed in a prone position after 30 s of vertical rotation. Mice in the control group received the same volume of PBS and manipulations.

Mice were randomly divided into five groups: PBS, LPS for 6 h,12 h, 24 h, and 48 h. Each group has six mice and: mice were sacrificed at the end of the timepoint. Additionally, mice were intraperitoneally injected with either 4µ8C (10 mg/kg) or vehicle. After 1 h, mice were intratracheally instilled with LPS or equal volume of PBS. Thus, the mice were divided into four groups: the Control group, the 4µ8C group, the LPS group, and the LPS + 4µ8C group. Each group has six mice. Mice were sacrificed 24 h after the LPS treatment. All animal studies were performed with protocols approved by the Animal Care and Use Committee of Zhongshan Hospital, Fudan university.

Cells and reagents

Beas-2B cells were purchased from American Type Culture Collection (ATCC) and cultured in DMEM/high glucose medium containing 10% FBS in cell culture incubator with 5% CO2 and humidity of 37℃. When cell confluency reached over 80%, BEAS-2B cells were trypsinized, resuspended, and seeded in 6-well plates or 12-well plates. 24 h later, the cells were pretreated with 4µ8C (Selleck, Shanghai, China) for 1 h prior to LPS (Sigma, 5 µg/ml) exposure for 24 h.

Antibodies

The following antibodies were used: IRE1α (CST; #3294), XBP1(Santa Cruz; sc-8015).

COX-2 (CST; #73315), ERK1/2 (CST; # 4695), phospho-ERK1/2 (Thr202/Tyr204) (CST; # 4370), NF-κB p65 (CST; #8242), phospho-NF-κB p65 (Thr202/Tyr204) (CST; #3033), NLRP3 (abcam; #283819), NLRP3 (abcam; #283819), IL-1β (abcam; #283818), TXNIP (abcam; #ab188865), β-tubulin (ABclonal; #AC008), Laminin B1 (Beyotime; #AG2478) and GAPDH (Beyotime; #AF1186), caspase-3 (CST; #14220), caspase-7 (CST; #12827), Bax (CST; #411162), cleaved caspase-3 (CST; #9664), cleaved caspase-7 (CST; #8438), Bcl-2 (CST; #4223). HRP-conjugated Goat anti-Mouse IgG (H + L) (SA00001-1) and HRP-conjugated Goat Anti-Rabbit IgG(H + L) (SA00001-2) were purchased from Beyotime.

RT-qPCR

The total RNA of cells or tissues were extracted by Trizol reagents (Thermo Fisher Scientific, USA). According to the manufacturer’s protocol, the reverse transcript RNA kit (Yeasen, Shanghai, China) was used to reversely transcribe to complementary DNA (cDNA). After that, a RT-PCR kit (Yeasen, Shanghai, China) was employed to quantify the mRNA levels using SYBR Green Master Mix in Quantitative RT-PCR system ABI 7500 (USA). The primer sequences were listed in Table 1.

Table 1.

Primers used in the study

Gene name Strand direction Primer sequences
Mouse-Actb Forward Sequence GTGACGTTGACATCCGTAAAGA
Reverse Sequence GTAACAGTCCGCCTAGAAGCAC
Mouse-Il-1b Forward Sequence AGGCTCCGAGATGAACAACAAA
Reverse Sequence GTGCCGTCTTTCATTACACAGGA
Mouse-Il-6 Forward Sequence CCCCAATTTCCAATGCTCTCC
Reverse Sequence CGCACTAGGTTTGCCGAGTA
Mouse-Tnfa Forward Sequence CAGGCGGTGCCTATGTCTC
Reverse Sequence CGATCACCCCGAAGTTCAGTAG
Human-ACTB Forward Sequence CACCCAGCACAATGAAGATCAAGAT
Reverse Sequence CCAGTTTTTAAATCCTGAGTCAAGC
Human-IL1B Forward Sequence CGATCACTGAACTGCACGCTC
Reverse Sequence ACAAAGGACATGGAGAACACCACTT
Human-IL-6 Forward Sequence GTAGTGAGGAACAAGCCAGAGC
Reverse Sequence TACATTTGCCGAAGAGCCCT
Human-XBP1 Forward Sequence CCAAGGGGAATGAAGTGAGGC
Reverse Sequence AGAGTTCATTAATGGCTTCCAG

Bronchoalveolar Lavage Fluid (BALF) analysis

After anesthetized and exposed tracheas, the mice were lavaged twice with 1 ml of precooled PBS to collect BALF with recovery rate of 80%, then BALF was centrifuged at 300 g for 5 min. The supernatant was transferred and stored at − 80 °C for further assays. The cell sediments were resuspended to count the cell number using NanoDrop (Thermo Scientific, USA). In addition, the protein concentration of the supernatant was detected by using bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China).

Enzyme-linked immunosorbent assay (ELISA)

According to the manufacturers’ protocols, IL-1β, IL-6, and TNF-α in BALF were detected by ELISA kit Duoset (R&D system).

Hematoxylin and eosin (H&E) staining

Isolated the left upper lobe of lungs were fixed with 4% paraformaldehyde, paraffin embedded, sectioned into 5 μm thick slices, dewaxed, and rehydrated. After that, the H&E staining kit (Servicebio, Wuhan, China) was used to stain the lung tissue slices in accordance with the manufacturer’s instructions. The stained slices were observed by a light microscope (Olympus IX73, Tokyo, Japan). As previously reported [33], the severity of lung injury was evaluated in a double-blind manner based on the scoring system as following: 1 representing no area of injury, 2 representing 25% area of injury, 3 representing 25 to 50% area of injury, 4 representing 50 to 75% area of injury, and 5 representing widespread lung tissue injury.

TdT‑mediated dUTP nick end labeling (TUNEL) staining

Briefly, lung tissues were fixed with 4% paraformaldehyde, cut into paraffin slices, deparaffinized, and digested with proteinase K for 30 min. As per the manufacturer’s instructions. the TUNEL test solution (Servicebio, China) was added to the tissue slices, and incubated at 37 °C for 2 h using a thermo-stat in a humid box. Then the slices were washed with PBS for three times with 5 min each, stained with 4’,6-diamidino-2-phenylindole (DAPI) solution for 10 min at room temperature. After thorough clean, the slices were dried and mounted with anti-fluorescence quenching agent. Apoptosis was observed and captured using the Olympus digital camera and software (Olympus, Tokyo, Japan).

Immunohistochemistry

After undergoing dewaxing and hydration, the lungs slices were placed in the citric acid antigen repair buffer and microwaved for antigen repair. After cooling to RT, the slices were washed three times for 5 min each with PBS, and then were submerged in 3% hydrogen peroxide at room temperature (RT) for 25 min. Next, block the slices at 37 °C for 1 h using the goat serum and incubated with NLRP3 antibody (1:200, Servicebio, China) at 4 °C overnight. After thorough wash, add HRP-conjugated rabbit secondary antibody to the slices for 1 h at RT. Then remove the secondary antibody, and add diaminobenzidine to develop the color and hematoxylin to counterstain the nuclei. Dehydrated and mounted, and NLRP3 level were observed using a light microscope (Olympus IX73).

Immunofluorescence, confocal microscopy

Beas-2B cells were fixed with 4% paraformaldehyde at RT for 15 min and then blocked for 30 min with 3% BSA. The cells were first treated with primary antibodies against ERK1/2, p65, and NLRP3 overnight at 4 °C, followed by incubation with secondary antibody conjugated with fluorescein. Cell slides were captured using a confocal microscope (Olympus, Japan).

Western blot

Cell and lung tissues were lysed in lysis buffer containing protease inhibitor and phosphatase inhibitor cocktail. Protein samples were separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, USA). After blocking with 5% BSA for 1 h at RT, the membranes were incubated with primary antibodies overnight at 4 °C and then incubated with the secondary antibodies for 1 h at RT. Enhanced chemiluminescent reagent (YEASEN, China) was used to observe the gray intensity of bands and Image J was applied for assessment.

Cell transfection

XBP1 siRNA and negative control (si-NC) were designed and synthesized by GenePharma (Shanghai, China). When the cell density reached 30–40%, siRNA was transfected into the cells according to the manufacturer’ protocol of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The sequences of si- RNA1 of XBP1 were: -5’- GCCUUGUAGUUGAGAACCATT-3’(sense) and 5’- UGGUUCUCAACUACAAGGCTT-3’(antisense), si-RNA2 for XBP1 were: 5’- GCCUUGUAGUUGAGAACCATT-3’(sense) and 5’-UGGUUCUCAACUACAAGGCTT-3’(antisense), and si-RNA3 for XBP1 were: 5’- GCUGGAAGCCAUUAAUGAATT-3’(sense) and 5’- UUCAUUAAUGGCUUCCAGCTT-3’(antisense).

Isolation of cytoplasmic and nuclear protein

According to the manufacturer’ protocol, nuclear proteins were extracted using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, Shanghai, China). Briefly, cells were washed with precooled PBS, collected and centrifugation at 300 g for 5 min. Then add the cytoplasmic protein extraction reagent A containing PMSF to the cell sediments and vortex vigorously at high speed for 5 s, followed by an ice bath for 15 min. Then add cytoplasmic protein extraction reagent B, vortex again, followed by an ice bath for 1 min. Vortex for 5 s and centrifuge at 14,000 g for 5 min at 4 °C to obtain the cytoplasmic proteins and precipitation. Then PMSF-containing nuclear protein extraction reagent was add to the precipitation, vortex at high speed for 15 ~ 30 s with intermittent ice bathing 1 min. Half an hour later, the tube was centrifuged to obtain the supernatant that is nuclear protein.

Statistical analysis

GraphPad Prism8.0 software (GraphPad Software Inc, USA) was used for statistical analysis. The results of the experiments were shown as mean ± SEM. Student’ s t-test was used to compare the statistical significance of two independent groups. One-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was used to compare multiple groups. All experiments were performed three or more times. P value < 0.05 was considered statistically significant.

Results

4µ8C attenuated lung injury and IRE1α-XBP1 axis in LPS-induced ALI

First, hematoxylin and eosin (H&E) staining of the lungs showed that tissue damage gradually worsen as the duration of LPS stimulation increased (Fig. 1A), and the protein level of IRE1α was significantly increased after 24 h of LPS stimulation (Fig. 1B). Next, to inhibit the IRE1α-XBP1 axis in ALI, mice were intraperitoneally injected with 4µ8C 1 h before 24 h of LPS exposure (Fig. 1C). Western blot confirmed that the expressions of IRE1α and XBP1s in the lungs was considerably inhibited in the LPS + 4µ8C group in comparison with LPS group (Fig. 1D). H&E of lung tissues showed that the LPS-induced larger alveolar septa, collapsed alveoli and inflammatory cell infiltration were evidently alleviated by 4µ8C (Fig. 1E), and the lung injury score was decreased by 4µ8C as well (Fig. 1F). Moreover, the cell number of total cell and neutrophil. cells as well as protein concentration in BALF were reduced in LPS + 4µ8C group in contrast to the LPS group (Fig. 1G-I). Above, it demonstrated that IRE1α/XBP1 was significantly activated in the LPS-induced ALI, whose inhibition could ameliorate the pulmonary injury,.

Fig. 1.

Fig. 1

4µ8C attenuated lung injury and IRE1α-XBP1 axis in LPS-induced ALI. (A) Representative H&E staining images of mouse lung tissue exposed to LPS for different timepoint. Magnification 100×, scale bar = 100 μm. (B) Representative western blot of IRE1α, XBP1s and XBP1u, and densitometric analysis normalized to β-tubulin. (C) Experimental design. (D) Representative western blot of IRE1α, XBP1s and XBP1u, and densitometric analyses. (E) Representative H&E staining images of mice lung tissues. Magnification 100×, scale bar = 50 μm. (F) Lung injury scores according to the H&E staining images. (G-I) The total cell counts (G) and neutrophil cell number (H), and protein concentration (I) in BALF. Data are mean ± SEM, n = 4–6 for each group. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

4µ8C inhibited inflammation and apoptosis in LPS-induced ALI

Next, we found protein levels of inflammatory cytokines IL-1β, IL-6, and TNF-α in BALF as well as their mRNA levels of lung tissue were all elevated in LPS group (Fig. 2A-F), which were significantly downregulated by 4µ8C (Fig. 2A-F). In addition, apoptosis markers including cleaved caspase-7, cleaved caspase-3 and Bax/Bcl-2 were increased in the LPS group, latter two of which were significantly inhibited by the 4µ8C (Fig. 2G–J). TUNEL staining further demonstrated that 4µ8C reduced the LPS-induced apoptotic cells in lungs (Fig. 2K). These results suggested that 4µ8C could effectively suppress lung inflammation and apoptosis in ALI.

Fig. 2.

Fig. 2

4µ8C inhibited inflammation and apoptosis in LPS-induced ALI. (A-C) The levels of IL-1β, IL-6, and TNFα in BALF were measured by ELISA. (D-F) The mRNA expressions of IL-1β, IL-6, and TNFαin lung tissues quantified by RT-PCR. (G) Representative western blots of Bax, Bcl-2, cleaved caspase-7, and cleaved caspase-3. (H-J) Densitometric analyses normalized to β-tubulin. (K) Representative lung images of TUNEL assay (magnification: 200×). The white arrow indicates apoptotic cell that was positive green cells. scale bar = 50 μm. Data are mean ± SEM, n = 4–6 for each group. ns, none of statistical significance, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

4µ8C inhibited the activation of NLRP3 inflammasome in LPS-induced ALI

Next, we investigated the effects that 4µ8C on the activation of NLRP3 inflammasome in ALI. IHC analysis showed that LPS significantly upregulated the levels of NLRP3 in the lungs, which was remarkably reduced by 4µ8C pretreatment (Fig. 3A). Meanwhile, western blots showed that protein expressions of NLRP3, caspase-11, Pro-IL-1β and cleaved-IL-1β were significantly inhibited by the 4µ8C in contrast to LPS group (Fig. 3B–E). These results indicated that 4µ8C could inhibit NLRP3-mediated pyroptosis in LPS-induced ALI.

Fig. 3.

Fig. 3

4µ8C suppressed the activation of NLRP3 inflammasome in lungs of LPS-induced ALI murine model. (A) Representative immunohistochemical images of NLRP3 in lungs (magnification: 200×), scale bar = 50 μm. (B) Representative western blots of NLRP3, caspase-11, Pro-IL-1β and cleaved-IL-1β. (C-E) Densitometric analyses normalized to β-tubulin. Data are mean ± SEM, n = 4–6 for each group. *P < 0.05, **P < 0.01, ***P < 0.001

Inhibiting IRE1α-XBP1axis suppressed apoptosis and inflammatory response in LPS-exposed Beas-2B cells

To investigate the effects of IRE1α-XBP1axis on ALI in vitro, LPS-stimulated lung epithelia cells were used as the cell models. Protein level of IRE1α significantly increased in a concentration- and time- dependent manner in Beas-2B cells treated with LPS (Fig. 4A and B). Western blot results demonstrated that the expressions of IRE1α and XBP1s were effectively suppressed by pretreatment of 4µ8C (5µM) for 1 h before LPS stimulation (5 µg/ml, 24 h) (Fig. 4C-E). Besides. 4µ8C inhibited the mRNA levels of IL-1B and IL-6 in LPS-exposed Beas-2B cells (Fig. 4H-I), as well the levels of Bax/Bcl-2 and cleaved caspase-3 (Fig. 4J). In addition, siRNA was used to silence the expression of XBP1 and western blots confirmed that the transfection efficacy of three siRNAs for XBP1 (Fig. 4F). In addition to XBP1 (Fig. 4G), the mRNA levels of IL-1B and IL-6 in LPS-stimulated Beas-2B cells were decreased significantly (Fig. 4K-L), and also the levels of Bax/Bcl-2 and cleaved caspase-3 were suppressed by siRNA3 of XBP1 (Fig. 4M). Collectively, these results suggested that inhibiting IRE1α-XBP1 axis alleviated apoptosis and inflammatory response in LPS-exposed Beas-2B cells.

Fig. 4.

Fig. 4

Inhibiting IRE1α-XBP1axis inhibited apoptosis and inflammatory response in LPS-exposed Beas-2B cells. (A-B) Western blots and quantitative analysis of IRE1α protein in Beas-2B cells treated with different doses of LPS or LPS (5 µg/mL) for different time. (C-E) Western blots and quantitative analysis of IRE1α, p-IRE1α, XBP1s, and XBP1u in different cell groups. (F-G) The transfection efficiency of XBP1 siRNA was assessed by western blot and qRT-PCR, respectively. (H-I) The mRNA levels of XBP1, IL-1B and IL-6 were tested by qRT-PCR. (L-N) The mRNA levels of IL-1B and IL-6 tested by qRT-PCR in LPS-induced Beas-2B cells with 4µ8C treatment. (J) Western blots of Bax/Bcl-2, and cleaved caspase-3 in different cell groups and corresponding quantitative analysis. (K-L) The mRNA levels of IL-1B and IL-6 tested by qRT-PCR in LPS-induced Beas-2B cells with XBP1 knockdown. (M) Western blots of Bax/Bcl-2, and cleaved caspase-3 in different cell groups and quantitative analysis. Data are mean ± SEM, n = 3–5 for each group. *P < 0.05, **P < 0.01, ***P < 0.001

Blocking IRE1α-XBP1 axis mitigated TXNIP/NLRP3 inflammasome activation in LPS-exposed Beas-2B cells

We further investigated the whether IRE1α-XBP1 axis could affect the NLRP3 inflammasome activation within lung epithelia cells. Western blot showed that NLRP3, TXNIP, and IL-1β were increased in Beas-2B cell treated with LPS, which were significantly suppressed by 4µ8C (Fig. 5A-D). Besides, protein levels of NLRP3, TXNIP and cleaved IL-1β were decreased in LPS-exposed Beas-2B cell with XBP1 knockdown (Fig. 5E-H). In addition, immunofluorescence showed that the activated NLRP3 in the LPS group was significantly reduced by 4µ8C pretreatment (Fig. 5I). Taken together, consistent with findings in vivo, these results indicated that 4µ8C inhibited TXNIP/NLRP3 inflammasome activation in LPS-exposed Beas-2B cells.

Fig. 5.

Fig. 5

Inhibiting IRE1α-XBP1axis mitigated TXNIP/NLRP3 inflammasome activation in LPS-exposed Beas-2B cells. (A-D) Western blots of NLRP3, TXNIP, and cleaved IL-1β/pro-IL-1β in different group cells, and their densitometric analyses normalized to GAPDH. (E-H) Western blots of NLRP3, TXNIP, and cleaved IL-1β/pro-IL-1β in different group cells, and corresponding densitometric analyses. (I) Representative immunofluorescence staining of NLRP3 proteins in Beas-2B cells.Scale bar = 20μm. Data are mean ± SEM, n = 3–5 for each group. *P < 0.05, **P < 0.01, ****P < 0.0001

IRE1α-XBP1 axis regulated inflammation and apoptosis through ERK/p65 signaling pathway in LPS-induced ALI.

We further explored the downstream molecular mechanism by inhibiting IRE1α-XBP1 axis in ALI in vivo and in vitro. Western blot showed that LPS activated the phosphorylation of ERK and p65 in Beas-2B cells, both of which were significantly inhibited by 4µ8C (Fig. 6A). Moreover, immunofluorescence demonstrated that LPS promoted the nuclear translocation of p65 and ERK, which were partially reversed by 4µ8C (Fig. 6B-C). Similarly, levels of p-ERK/ERK and p-p65/p65 were reduced in LPS-exposed Beas-2B cells with XBP1 knockdown (Fig. 6D), and the nuclear expression of the p65 and ERK were inhibited as well (Fig. 6E). Also, the levels of p-p65/p65 and p-ERK/ERK were largely increased in the lungs of LPS group in contrast to the control group, which were decreased remarkably by 4µ8C (Fig. 6F). These results indicated blocking IRE1α-XBP1 axis might regulate inflammation and apoptosis through ERK/p65 signaling pathway in LPS-induced ALI.

Fig. 6.

Fig. 6

Inhibiting IRE1α-XBP1 axis downregulated the phosphorylation and/or nuclear translocation of ERK/p65 in LPS-induced ALI in vitro and in vivo. (A) Western blots and quantitative analysis of p65, p-p65, ERK, and p-ERK in Beas-2B cells. (B-C) Representative immunofluorescence staining of p65 and ERK proteins in Beas-2B cells. Scale bar = 20μm. (D-E) Western blots and quantitative analysis of p65, p-p65, ERK, and p-ERK in (D) total protein and (E) nuclear protein of Beas-2B cells with XBP1 knockdown. n = 3–5 for each group. (F) Representative western blots images and quantitative analysis of p65, p-p65, ERK, and p-ERK in lung tissue. Data are mean ± SEM, n = 4–6 for each group. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Discussion

In this present study, we found that IRE1α-XBP1 axis was activated in LPS-induced mice and Beas-2B cells, and suppressing IRE1α-XBP1 axis can attenuate the acute lung damage, inflammation and cell apoptosis through downregulating TXNIP3/NLRP3 inflammasome activation and ERK/p65 signaling pathway (Fig. 7). These findings uncovered the role and molecular mechanisms of IRE1α-XBP1 axis underlying LPS-induced ALI providing a theoretical basis for the development of targeted therapy for ALI/ARDS.

Fig. 7.

Fig. 7

Schematic mechanisms concerning the IRE1α-XBP1 axis in LPS-induced acute lung injury. Inhibiting IRE1α-XBP1 axis by 4µ8C and siRNA inhibits TXNIP/NLRP3 inflammasome activation and ERK/p65 signaling pathway

Several studies have shown that the ER stress-associated IRE1α-XBP1 axis is involved in the pathogenesis of ALI. For example, activation of triggering receptor expressed on myeloid cells 1 (TREM-1) contributed the proinflammatory microenvironment through inducing IRE1α-XBP1 pathway in macrophages, while the proinflammatory microenvironment was significantly diminished by XBP1 silencing in LPS-induced ALI [34]. Another study demonstrated that inhibition of IRE1α-XBP1 axis suppressed M1 polarization in macrophages in LPS-induced ALI [35]. Dexmedetomidine markedly attenuated the increases in IRE1α to play protective effects on LPS-induced ALI [36]. Similarly, we found that inhibition of IRE1α-XBP-1 axis protects against ALI by suppressing pulmonary inflammation and apoptosis in mice with ALI or Beas-2B cells exposed to LPS. However, unlike studies above, we focused on airway epithelial cells but not macrophages. It has been reported that inhibiting IRE1α can mitigate alveolitis in airway epithelial cells [13, 14], and aqueous extract of Descuraniae Semen decreases inflammation and apoptosis in LPS-stimulated A549 cells by downregulating IRE1α-dependent UPR [37]. Here we also found that both 4µ8C and silencing XBP1 could alleviate inflammatory responses and apoptosis in LPS-treated Beas-2B cells, suggesting that IRE1α-XBP1 axis may be a promising therapeutic target for ALI/ ARDS.

Uncontrolled inflammatory response is one of the most prominent characteristics of ALI, leading to poor and serious consequences [1, 2, 38]. Numerous studies have confirmed the regulatory role of IRE1α-XBP1 axis in production of inflammatory mediators. Research has proved that XBP1 activation acted in synergy with TLR2/4 signaling to transcriptionally regulates the expressions of IL-6 and TNF-α in macrophages by enhancing the activity of their respective promoters [11]. Furthermore, in the context of pulmonary cystic fibrosis, activated XBP1 could upregulate the expression of TNF-α and IL-6 in alveolar macrophages [39]. Besides, IRE1α-XBP1 axis regulate melanoma cell proliferation or carcinogenesis of hepatocellular carcinoma by activating IL-6/JAK/STAT3 pathway [40, 41]. Moreover, IRE1α-XBP1 axis is closely related to ERK/p65 signaling pathway among three sensors of UPR with strong ability to induce NF-κB p65 activation [42, 43], blocking IRE1α/XBP1 significantly reduced NF-κB p65 phosphorylation, indicating it may be the main UPR pathway to activate NF-κB [12, 44]. In addition, IRE1α activates ERK1/2 by interacting with the adaptor protein Nck [45], and the protein-protein interaction relationship between IRE1α and ERK has been identified in tumor cells [46]. These findings were consistent with our results that 4µ8C and silencing XBP1 could significantly inhibit phosphorylation and nuclear translocation of NF-κB p65 and ERK1/2, both of which has been previously confirmed that could regulate the inflammation and apoptosis in LPS-exposed airway epithelia cells [47, 48].

As a programmed cell death, NLRP3 inflammasome mediated pyroptosis is an important mechanism for the uncontrolled inflammatory response in ALI/ARDS, and is extensively studied and commonly associated within alveolar macrophages and pulmonary vascular endothelial cells that could trigger inflammatory cascades and the microvascular barrier disruption [4951]. Currently, NLRP3 inflammasome within the airway epithelium of ALI has aroused the interests of investigators. USP9X promotes LPS-stimulated ALI by deubiquitinating NLRP3 inflammasome of alveolar epithelial cells Zinc oxide nanoparticle could induce the activation of NLRP3 inflammasome in A549 cells to aggravate ALI [52, 53]. Meanwhile, LPS could also induce NLRP3 inflammasome activation within Beas-2B cells [32]. Consistently, in our study, we found that LPS exposure increased the protein levels of NLRP3, IL-1β, and TXNIP in the BEAS-2B cells, indicating that NLRP3 inflammasome within airway epithelia cells may play a pivotal role in the pathogenesis of ALI/ARDS.

NLRP3 inflammasome is one of important inflammatory pathways that IRE1α-XBP1 axis intersects with. Previous study has reported that the PERK and IRE1α-XBP1 pathways could induce TXNIP/NLRP3 inflammasome and mediate ER stress-mediated pancreatic βcell death [54]. And IRE1α enhanced the saturated fatty-acid-induced activation of the NLRP3 inflammasome in macrophages [55]. While IRE1α inhibition decreased TXNIP/NLRP3 inflammasome activation in hypoxic-ischemic brain injury [23] and in Ang II-treated rat myocardium [25]. Silencing of XBP1 was also capable of suppressing the NLRP3 inflammatory pathway in hepatic IR injury [56]. One study showed that Chrysin inhibited IRE1α-mediated TXNIP/NLRP3 pathway to protect against LPS-induced ALI [57]. Consistently, we found that LPS triggered activation of the TXNIP/NLRP3 mediated inflammasome in Beas-2B cells, which can be mitigated by inhibiting IRE1α-XBP1 axis. However, the regulatory molecular mechanisms of IRE1α-XBP1 axis on TXNIP/NLRP3 in ALI is unclear and requires further exploration in the future.

Conclusions

In conclusion, this study demonstrates that IRE1α-XBP1 axis is elevated significantly in LPS-induced ALI, whose inhibition plays a beneficial role in regulation of inflammation, apoptosis by suppressing TXNIP/NLRP3 inflammasome and ERK/p65 signaling pathway. These findings suggesting that IRE1α-XBP1 axis may be a potential promising target for ALI/ARDS treatment.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (47.9MB, rar)

Abbreviations

ALI

Acute lung injury

ARDS

Acute respiratory distress syndrome

ERS

Endoplasmic reticulum stress

NLRP3

Nod-like receptor protein 3

TXNIP

Thioredoxin-interacting protein

UPR

Unfolded protein response

Author contributions

SJW: Conceptualization; Investigation; Methodology; Data curation; Formal analysis; Writing - original draft; Writing - review & editing. LJH: Investigation; Methodology; Data curation; Writing - original draft. YPF: Funding acquisition; Investigation; Methodology; Data curation; Writing - review & editing. FX: Methodology; Validation; Writing - review & editing. YS: Methodology; Validation; Writing - review & editing. HHL: Conceptualization; Methodology; Validation; Writing - review & editing. LZ: Conceptualization; Funding acquisition; Writing - review & editing.

Funding

This work was supported by grants from the National Natural Science Foundation of China (82070075), and funded by Outstanding Resident Clinical Postdoctoral Program of Zhongshan Hospital Affiliated to Fudan University (2024) and Science and Shanghai Municipal Health Commission, China (20214Y0389).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study followed the national guidelines and protocols of the National Institutes of Health and was approved by the Animal Care Committee of Fudan University Zhongshan Hospital (ID:2022-09).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Sijiao Wang, Lijuan Hu and Yipeng Fu contributed equally to this work.

Contributor Information

Hanhan Liu, Email: lhhssym@163.com.

Lei Zhu, Email: tfzhu@126.com.

References

  • 1.Bellani G, Laffey JG, Pham T, Fan E, Brochard L, Esteban A, Gattinoni L, van Haren F, Larsson A, McAuley DF, et al. Epidemiology, patterns of Care, and mortality for patients with Acute Respiratory Distress Syndrome in Intensive Care Units in 50 countries. JAMA. 2016;315:788–800. [DOI] [PubMed] [Google Scholar]
  • 2.Parhar KKS, Zjadewicz K, Soo A, Sutton A, Zjadewicz M, Doig L, Lam C, Ferland A, Niven DJ, Fiest KM, et al. Epidemiology, Mechanical Power, and 3-Year outcomes in Acute Respiratory Distress Syndrome patients using standardized screening. An Observational Cohort Study. Annals Am Thorac Soc. 2019;16:1263–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Acute respiratory distress syndrome. Nat Reviews Disease Primers. 2019;5:19. [DOI] [PubMed] [Google Scholar]
  • 4.Thompson BT, Chambers RC, Liu KD. Acute respiratory distress syndrome. N Engl J Med. 2017;377:562–72. [DOI] [PubMed] [Google Scholar]
  • 5.Battaglini D, Iavarone IG, Li A-H, Ball L, Robba C, Silva PL, Cruz FF, Rocco PR. Anti-inflammatory therapies for acute respiratory distress syndrome. Expert Opin Investig Drugs 2023. [DOI] [PubMed]
  • 6.Zhang Z, Zhang L, Zhou L, Lei Y, Zhang Y, Huang C. Redox signaling and unfolded protein response coordinate cell fate decisions under ER stress. Redox Biol. 2019;25:101047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chen X, Shi C, He M, Xiong S, Xia X. Endoplasmic reticulum stress: molecular mechanism and therapeutic targets. Signal Transduct Target Therapy. 2023;8:352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hetz C, Papa FR. The unfolded protein response and cell Fate Control. Mol Cell. 2018;69:169–81. [DOI] [PubMed] [Google Scholar]
  • 9.Jiang D, Niwa M, Koong AC. Targeting the IRE1α-XBP1 branch of the unfolded protein response in human diseases. Sem Cancer Biol. 2015;33:48–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Park S-M, Kang T-I, So J-S. Roles of XBP1s in Transcriptional Regulation of Target genes. Biomedicines 2021, 9. [DOI] [PMC free article] [PubMed]
  • 11.Martinon F, Chen X, Lee A-H, Glimcher LH. TLR activation of the transcription factor XBP1 regulates innate immune responses in macrophages. Nat Immunol. 2010;11:411–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Zhang C, Chen X, Wang C, Ran Y, Sheng K. Inhibition of XBP1 alleviates LPS-Induced cardiomyocytes Injury by Upregulating XIAP through suppressing the NF-κB signaling pathway. Inflammation. 2021;44:974–84. [DOI] [PubMed] [Google Scholar]
  • 13.Zhang H, Li J, Wang X, Wang K, Xie J, Chen G, Li Y, Zhong K, Li J, Chen X. IRE1α/XBP-1 promotes β-catenin signaling activation of airway epithelium in lipopolysaccharide-induced acute lung injury. Pulm Pharmacol Ther. 2023;83:102263. [DOI] [PubMed] [Google Scholar]
  • 14.Katzen J, Rodriguez L, Tomer Y, Babu A, Zhao M, Murthy A, Carson P, Barrett M, Basil MC, Carl J, et al. Disruption of proteostasis causes IRE1 mediated reprogramming of alveolar epithelial cells. Proc Natl Acad Sci USA. 2022;119:e2123187119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kryvenko V, Wessendorf M, Tello K, Herold S, Morty RE, Seeger W, Vadász I. Hypercapnia induces inositol-requiring enzyme 1α-Driven endoplasmic reticulum-associated degradation of the Na,K-ATPase β-Subunit. Am J Respir Cell Mol Biol. 2021;65:615–29. [DOI] [PubMed] [Google Scholar]
  • 16.Li W, Cao T, Luo C, Cai J, Zhou X, Xiao X, Liu S. Crosstalk between ER stress, NLRP3 inflammasome, and inflammation. Appl Microbiol Biotechnol. 2020;104:6129–40. [DOI] [PubMed] [Google Scholar]
  • 17.Ji T, Han Y, Yang W, Xu B, Sun M, Jiang S, Yu Y, Jin Z, Ma Z, Yang Y, Hu W. Endoplasmic reticulum stress and NLRP3 inflammasome: crosstalk in cardiovascular and metabolic disorders. J Cell Physiol. 2019;234:14773–82. [DOI] [PubMed] [Google Scholar]
  • 18.Lv S, Li X, Wang H. The role of the effects of endoplasmic reticulum stress on NLRP3 inflammasome in diabetes. Front Cell Dev Biology. 2021;9:663528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhou R, Tardivel A, Thorens B, Choi I, Tschopp J. Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat Immunol. 2010;11:136–40. [DOI] [PubMed] [Google Scholar]
  • 20.Xi X, Zhang R, Chi Y, Zhu Z, Sun R, Gong W. TXNIP regulates NLRP3 Inflammasome-Induced pyroptosis related to Aging via cAMP/PKA and PI3K/Akt signaling pathways. Molecular Neurobiology; 2024. [DOI] [PubMed]
  • 21.Talty A, Deegan S, Ljujic M, Mnich K, Naicker SD, Quandt D, Zeng Q, Patterson JB, Gorman AM, Griffin MD, et al. Inhibition of IRE1α RNase activity reduces NLRP3 inflammasome assembly and processing of pro-IL1β. Cell Death Dis. 2019;10:622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shao R, Lou X, Xue J, Yang Y, Ning D, Chen G, Jiang L. Thioredoxin-1 regulates IRE1α to ameliorate sepsis-induced NLRP3 inflammasome activation and oxidative stress in raw 264.7 cell. Immunopharmacol Immunotoxicol. 2023;45:277–86. [DOI] [PubMed] [Google Scholar]
  • 23.Chen D, Dixon BJ, Doycheva DM, Li B, Zhang Y, Hu Q, He Y, Guo Z, Nowrangi D, Flores J, et al. IRE1α inhibition decreased TXNIP/NLRP3 inflammasome activation through mir-17-5p after neonatal hypoxic-ischemic brain injury in rats. J Neuroinflammation. 2018;15:32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jing G, Zuo J, Fang Q, Yuan M, Xia Y, Jin Q, Liu Y, Wang Y, Zhang Z, Liu W, et al. Erbin protects against sepsis-associated encephalopathy by attenuating microglia pyroptosis via IRE1α/Xbp1s-Ca2 + axis. J Neuroinflamm. 2022;19:237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhang L-S, Zhang J-S, Hou Y-L, Lu W-W, Ni X-Q, Lin F, Liu X-Y, Wang X-J, Yu Y-R, Jia M-Z, et al. Intermedin1-53 inhibits NLRP3 inflammasome activation by targeting IRE1α in Cardiac Fibrosis. Inflammation. 2022;45:1568–84. [DOI] [PubMed] [Google Scholar]
  • 26.Hagar JA, Powell DA, Aachoui Y, Ernst RK, Miao EA. Cytoplasmic LPS activates caspase-11: implications in TLR4-independent endotoxic shock. Sci (New York NY). 2013;341:1250–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nguyen H, Uhal BD. The unfolded protein response controls ER stress-induced apoptosis of lung epithelial cells through angiotensin generation. Am J Physiol Lung Cell Mol Physiol. 2016;311:L846–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Huang E, Gao L, Yu R, Xu K, Wang L. A bibliometric analysis of programmed cell death in acute lung injury/acute respiratory distress syndrome from 2000 to 2022. Heliyon. 2023;9:e19759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li X, Zhang Z, Wang Z, Gutiérrez-Castrellón P, Shi H. Cell deaths: involvement in the pathogenesis and intervention therapy of COVID-19. Signal Transduct Target Therapy. 2022;7:186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zeng M, Sang W, Chen S, Chen R, Zhang H, Xue F, Li Z, Liu Y, Gong Y, Zhang H, Kong X. 4-PBA inhibits LPS-induced inflammation through regulating ER stress and autophagy in acute lung injury models. Toxicol Lett. 2017;271:26–37. [DOI] [PubMed] [Google Scholar]
  • 31.Bhardwaj R, Bhardwaj A, Dhawan DK, Tandon C, Kaur T. 4-PBA rescues hyperoxaluria induced nephrolithiasis by modulating urinary glycoproteins: Cross talk between endoplasmic reticulum, calcium homeostasis and mitochondria. Life Sci. 2022;305:120786. [DOI] [PubMed] [Google Scholar]
  • 32.Li J, Li Y, Chen G, Liang Y, Xie J, Zhang S, Zhong K, Jiang T, Yi H, Tang H, Chen X. GLUT1 promotes NLRP3 inflammasome activation of Airway Epithelium in Lipopolysaccharide-Induced Acute Lung Injury. Am J Pathol 2024. [DOI] [PubMed]
  • 33.Xu F, Wang S, Wang Y, Hu L, Zhu L. Inhibition of gp130 alleviates LPS-induced lung injury by attenuating apoptosis and inflammation through JAK1/STAT3 signaling pathway. Inflamm Res. 2023;72:493–507. [DOI] [PubMed] [Google Scholar]
  • 34.Dong L, Tan C-W, Feng P-J, Liu F-B, Liu D-X, Zhou J-J, Chen Y, Yang X-X, Zhu Y-H, Zhu Z-Q. Activation of TREM-1 induces endoplasmic reticulum stress through IRE-1α/XBP-1s pathway in murine macrophages. Mol Immunol. 2021;135:294–303. [DOI] [PubMed] [Google Scholar]
  • 35.Zhao Y, Jiang Y, Chen L, Zheng X, Zhu J, Song X, Shi J, Li Y, He W. Inhibition of the endoplasmic reticulum (ER) stress-associated IRE-1/XBP-1 pathway alleviates acute lung injury via modulation of macrophage activation. J Thorac Disease. 2020;12:284–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Cui H, Zhang Q. Dexmedetomidine ameliorates lipopolysaccharide-induced acute lung injury by inhibiting the PI3K/Akt/FoxO1 signaling pathway. J Anesth. 2021;35:394–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hsieh P-C, Peng C-K, Liu G-T, Kuo C-Y, Tzeng IS, Wang M-C, Lan C-C, Huang K-L. Aqueous extract of Descuraniae Semen attenuates Lipopolysaccharide-Induced inflammation and apoptosis by regulating the proteasomal degradation and IRE1α-Dependent unfolded protein response in A549 cells. Front Immunol. 2022;13:916102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yuan R, Li Y, Han S, Chen X, Chen J, He J, Gao H, Yang Y, Yang S, Yang Y. Fe-Curcumin nanozyme-mediated reactive oxygen species scavenging and anti-inflammation for Acute Lung Injury. ACS Cent Sci. 2022;8:10–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lubamba BA, Jones LC, O’Neal WK, Boucher RC, Ribeiro CMP. X-box-binding protein 1 and Innate Immune responses of human cystic fibrosis alveolar macrophages. Am J Respir Crit Care Med. 2015;192:1449–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Chen C, Zhang X. IRE1α-XBP1 pathway promotes melanoma progression by regulating IL-6/STAT3 signaling. J Translational Med. 2017;15:42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Fang P, Xiang L, Huang S, Jin L, Zhou G, Zhuge L, Li J, Fan H, Zhou L, Pan C, Zheng Y. IRE1α-XBP1 signaling pathway regulates IL-6 expression and promotes progression of hepatocellular carcinoma. Oncol Lett. 2018;16:4729–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP, Ron D. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Sci (New York NY). 2000;287:664–6. [DOI] [PubMed] [Google Scholar]
  • 43.Hotamisligil GS. Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell. 2010;140:900–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Chen L, Xie Z-Y, Liu L, Zhu L, Wang F, Fan P, Sinkemani A, Zhang C, Hong X, Wu X-T. Nuclear factor-kappa B-dependent X-box binding protein 1 signalling promotes the proliferation of nucleus pulposus cells under tumour necrosis factor alpha stimulation. Cell Prolif. 2019;52:e12542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Nguyên DT, Kebache S, Fazel A, Wong HN, Jenna S, Emadali A, Lee E-H, Bergeron JJM, Kaufman RJ, Larose L, Chevet E. Nck-dependent activation of extracellular signal-regulated kinase-1 and regulation of cell survival during endoplasmic reticulum stress. Mol Biol Cell. 2004;15:4248–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Huo M, Zhao Y, Liu X, Gao Y, Zhang D, Chang M, Liu M, Xu N, Zhu H. EGFR targeting enhances the efficiency of chemotherapy through inhibiting IRE1α-XBP1s pathway in colorectal cancer cells. J Cancer. 2020;11:4464–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zeng Z, Fu Y, Li M, Shi Y, Ding Q, Chen S. Guben Qingfei decoction attenuates LPS-induced acute lung injury by modulating the TLR4/NF-κB and Keap1/Nrf2 signaling pathways. J Ethnopharmacol. 2024;323:117674. [DOI] [PubMed] [Google Scholar]
  • 48.Liu H, Wang S, Gong L, Shen Y, Xu F, Wang Y, Hu L, Zhu L. SIRT6 ameliorates LPS-induced apoptosis and tight junction injury in ARDS through the ERK1/2 pathway and autophagy. Int J Med Sci. 2023;20:581–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Feng Y, Li M, Yangzhong X, Zhang X, Zu A, Hou Y, Li L, Sun S. Pyroptosis in inflammation-related respiratory disease. J Physiol Biochem. 2022;78:721–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Liu B, Li Y, Xiang J, Li Y, Zhou M, Ren Y, Fu Z, Ding F. Significance of Pyroptosis in Immunoregulation and prognosis of patients with Acute Respiratory Distress Syndrome: evidence from RNA-Seq of alveolar macrophages. J Inflamm Res. 2023;16:3547–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Sun J, Li Y. Pyroptosis and respiratory diseases: a review of current knowledge. Front Immunol. 2022;13:920464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Zhuo L-B, Liu Y-M, Jiang Y, Yan Z. Zinc oxide nanoparticles induce acute lung injury via oxidative stress-mediated mitochondrial damage and NLRP3 inflammasome activation: In vitro and in vivo studies. Environmental Pollution (Barking, Essex: 1987) 2024, 341:122950. [DOI] [PubMed]
  • 53.Xiang Y, Li X, Cai M, Cai D. USP9X promotes lipopolysaccharide-stimulated acute lung injury by deubiquitination of NLRP3. Cell Biol Int. 2023;47:394–405. [DOI] [PubMed] [Google Scholar]
  • 54.Oslowski CM, Hara T, O’Sullivan-Murphy B, Kanekura K, Lu S, Hara M, Ishigaki S, Zhu LJ, Hayashi E, Hui ST, et al. Thioredoxin-interacting protein mediates ER stress-induced β cell death through initiation of the inflammasome. Cell Metabol. 2012;16:265–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Robblee MM, Kim CC, Porter Abate J, Valdearcos M, Sandlund KLM, Shenoy MK, Volmer R, Iwawaki T, Koliwad SK. Saturated fatty acids engage an IRE1α-Dependent pathway to activate the NLRP3 inflammasome in myeloid cells. Cell Rep. 2016;14:2611–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Li F, Zhang L, Xue H, Xuan J, Rong S, Wang K. SIRT1 alleviates hepatic ischemia-reperfusion injury via the miR-182-mediated XBP1/NLRP3 pathway. Mol Therapy Nucleic Acids. 2021;23:1066–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Chen M, Li J, Liu X, Song Z, Han S, Shi R, Zhang X. Chrysin prevents lipopolysaccharide-induced acute lung injury in mice by suppressing the IRE1α/TXNIP/NLRP3 pathway. Pulm Pharmacol Ther. 2021;68:102018. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (47.9MB, rar)

Data Availability Statement

No datasets were generated or analysed during the current study.


Articles from Respiratory Research are provided here courtesy of BMC

RESOURCES