Abstract
Toxin-antitoxin (TA) systems are ubiquitous in bacteria and archaea. Most are composed of two neighboring genetic elements, a stable toxin capable of inhibiting crucial cellular processes, including replication, transcription, translation, cell division and membrane integrity, and an unstable antitoxin to counteract the toxicity of the toxin. Many new discoveries regarding the biochemical properties of the toxin and antitoxin components have been made since the first TA system was reported nearly four decades ago. The physiological functions of TA systems have been hotly debated in recent decades, and it is now increasingly clear that TA systems are important immune systems in prokaryotes. In addition to being involved in biofilm formation and persister cell formation, these modules are antiphage defense systems and provide host defenses against various phage infections via abortive infection. In this review, we explore the potential applications of TA systems based on the recent progress made in elucidating TA functions. We first describe the most recent classification of TA systems and then introduce the biochemical functions of toxins and antitoxins, respectively. Finally, we primarily focus on and devote considerable space to the application of TA complexes in synthetic biology.
Keywords: Toxin, Antitoxin, Toxin-antitoxin system, Classification, Application
Graphical abstract
1. Introduction
TA systems are broadly distributed in bacterial and archaeal chromosomes and mobile genetic elements and usually consist of two genetic components, including typically stable toxins that function as bactericidal or bacteriostatic agents, while the adjacent labile antitoxins act as antagonists to mask their toxicity [1]. In model strains, such as Escherichia coli K12 and Mycobacterium tuberculosis, dozens or even hundreds of TA systems have been identified [2], [3], [4].
TA systems were originally discovered in conjugative plasmids in the 1980s, and the first three TA systems described were CcdB/CcdA of the F plasmid [5,6], and Hok/Sok and ParD (kis/kid) of the conjugative plasmid R1 [7,8]. The function of plasmid-encoded TA systems in maintaining the vertical inheritance of plasmids is well documented by strong evidence obtained in different labs, but the exact mechanisms remain debatable. TA systems in plasmids have generally recognized “plasmid addition modules” which control the stability of plasmids in bacterial populations by a mechanism known as postsegregational killing (PSK) [5,9,10]. Other mechanisms have been found to explain the advantages of harboring TA systems in plasmids, including increased fitness during plasmid-plasmid competition [11] and the direct control of plasmid replication by the antitoxins [12]. In the past decade, the rapid expansion in the number of sequenced plasmids has revealed that many plasmids harbor multiple TA pairs, including many conjugative plasmids carrying multiple antibiotic resistance genes [13,14].
TA systems have also been discovered in some other mobile elements in chromosomes, such as integrative and conjugative elements, transposons and prophages [15], [16], [17], [18]. In most cases, toxin- and antitoxin-encoding genes are located on the same operon, and antitoxin genes are located upstream of toxin genes [19]. Type II TA systems are negatively autoregulated either by antitoxin alone or by toxin-antitoxin complexes [1]. Currently, the mechanisms by which toxin proteins exert toxicity include binding to DNA helicases or ribosomes and RNA degradation, leading to disruption of DNA replication or mRNA translation [20], [21], [22]. Structural studies also help to uncover the molecular basis of enzymatic toxins and how antitoxins counteract toxins by direct interactions in type II and type III TA systems or by posttranslational modifications in type VII TA systems [23], [24], [25]. The physiological roles of TA systems are also diverse. Studies to date have shown that TA systems are crucial in plasmid stability maintenance [12], phage inhibition [26], biofilm formation and stress response [27] and programmed cell death (PCD) [28].
In this review, we summarize the most recent classification of TA systems, including the discovery of two new types of TA systems since 2016. We then explore the biochemical functions of toxins and antitoxins, and the application of TA systems in synthetic biology, including those in mobile genetic element stabilization and DNA cloning, as potential phage defense elements and as new drugs.
2. Classification of TA systems
It is noteworthy that the vast majority of toxins are proteins (except for the newly discovered type VIII systems in which the toxins are RNA molecules), and antitoxins can be either proteins or RNAs. Currently, TA systems are grouped into eight main types based on the nature of the antitoxins as well as the way in which the antitoxins interact with toxins to block toxicity (Fig. 1) [29,30]. Notably, the antitoxins of type I, type III and type VIII TA systems consist of RNA. For the remaining systems, the antitoxins consist of proteins. In type I TA systems (the first described is Hok/Sok [31]), the noncoding small RNA antitoxin acts as an antisense RNA that binds to toxin-encoding mRNA and inhibits its translation. Type II TA systems are the most extensively studied among the various types of TA systems. In type II TA systems (the first described is CcdB/CcdA [6]), the antitoxin neutralizes the cognate toxin toxicity via a direct protein-protein interaction, resulting in TA complex formation. In type III TA systems (the first described is ToxN/ToxI [32]), the RNA antitoxins directly bind and counteract toxin proteins to inhibit their toxicity. In type IV TA systems (the first described is CbtA/CbeA [33]), the antitoxin and the toxin do not have a direct interaction. Instead, the antitoxin can neutralize the toxin's activity by interacting with the toxin's target. In the type V TA system, GhoT/GhoS [34], the antitoxin GhoS acts as an RNase that specifically degrades toxin mRNA. In the type VI TA system, the SocB/SocA TA system [35], the antitoxin protein functions as a proteolytic adapter and stimulates degradation of the toxin SocA. Recently, we described a new type of TA system, HepT/MntA, in which the antitoxin functions as an adenylyltransferase enzyme to antagonize the toxin by polyadenylylating the toxin [25]. Then, we proposed and categorized it with Hha/TomB and TglT/TakA as type VII TA systems, all of which have the same neutralization mechanism in which the antitoxin neutralizes toxin proteins by chemical modification [29]. Intriguingly, in the most recently discovered type VIII TA system, both the toxin and antitoxin consist of RNA. The small RNA toxin CreT sequesters tRNAUCU, and antitoxin CreA that resembles crRNA guides the Cas (CRISPR-associated) proteins to transcriptionally inhibit the toxin CreT [36].
Fig. 1.
Current classification of TA systems. The eight major types of TA systems are classified based on the nature of antitoxins (protein or RNA) as well as the way that the antitoxins neutralize the toxicity of the cognate toxins.
3. Biochemical functions of toxins and antitoxins
Toxins in TA systems target numerous cellular processes, including replication, translation and others, ultimately leading to cell death or inhibiting cell proliferation. A wide variety of the molecular activities of toxins and their bacterial hosts are listed in Table 1. Toxins targeting DNA replication function by changing the topological structures of DNA by cleaving DNA or modifying DNA. We have shown that the RalR toxin in the type I TA system, RalRA, is a nonspecific endonuclease and cleaves DNA substrates but not RNA substrates [37]. Many type II toxins are endoribonucleases. Some of them (e.g., RelE and HigB) nonspecifically cleave mRNA in ribosomes in a translation-dependent manner. Remarkably, some toxins, such as MazF and MqsR in E. coli, cleave RNA independently of ribosomes with sequence specificity with preferences at ACA and GCN in vitro, respectively [38], [39], [40]. Additionally, diverse specific recognition and cleavage motifs are reported for MazF homologues in different strains. For example, MazF toxin from Nitrospira strain ND1 specifically cleaves the AACU, AACG, and AAUU motifs [41], and MazF toxin from Clostridium difficile cleaves mRNA at the consensus UACAU sequences [42] as well as MazF from Deinococcus radiodurans strictly recognizes and cleaves the UACA sequences [43].
Table 1.
Targeted cellular processes and mechanisms of toxins in different types of TA systems.
| TA pair | TA type | Toxin | Mechanism/Targeted cellular process | Organism | Source |
|---|---|---|---|---|---|
| DNA replication | |||||
| RalRA | I | RalR | DNase | E. coli | [37] |
| FicTA | II | FicT | Adenylylation of DNA gyrase and topoisomerase IV | Bartonella schoenbuchensis | [44] |
| ParDE | II | ParE | Inhibition of DNA gyrase | E. coli, Vibrio cholerae | [45,46] |
| CcdBA | II | CcdB | DNA topoisomerase II poison | E. coli | [47] |
| DarTG | IV | DarT | ADP-ribosylation | Thermus aquaticus | [48] |
| SocAB | VI | SocB | Direct interaction with DnaN | Caulobacter crescentus | [35] |
| Translation | |||||
| SymE/SymR | I | SymE | mRNA cleavage | E. coli | [49] |
| MazEF | II | MazF | Ribonuclease independent of ribosomes | E. coli | [38] |
| HicAB | II | HicA | mRNA cleavage | E. coli | [20] |
| HipBA | II | HipA | Phosphorylation of the glutamyl-tRNA-synthetase | E. coli | [50] |
| VapBC | II | VapC | Cleavage of initiator tRNA | Shigella flexneri, Salmonella enterica, Mycobacterium tuberculosis | [51], [52], [53] |
| TacAT | II | TacT | Acetylation of tRNA | Salmonella enterica | [54] |
| AtaRT | II | AtaT | N-acetylation of the initiator tRNAfMet | E. coli | [55] |
| RatA/RatB | II | RatA | Inhibition of the formation of 70S ribosomes | E. coli | [56] |
| RelBE | II | RelE | Cleavage of ribosome-independent mRNA and tmRNA | E. coli | [22,57] |
| ToxIN | III | ToxN | Cleavage of mRNA | Erwinia carotovora | [32] |
| HepT/MntA | VII | HepT | Cleavage of mRNA | Shewanella oneidensis | [25] |
| HEPN/MNT | VII | HEPN | Cleaving 4 nt from the 3′ end of tRNA | Aphanizomenon flos-aquae | [58] |
| CreTA | VIII | CreT | Sequestering tRNAUCU | Haloarcula hispanica | [36] |
| Others | |||||
| HoK/Sok | I | HoK | Depolarizing the bacterial membrane | E. coli | [31,59] |
| Doc/Phd | II | Doc | Phosphorylation of EF-Tu | E. coli | [60] |
| GhoT/GhoS | V | GhoT | Disrupting the cell membrane | E. coli, Shigella | [34] |
| Retron | / | RcaT | Hydrolyze nucleosides/nucleotides | Salmonella enterica | [61] |
Accumulating evidence has shown that antitoxins can function as global regulators. We summarized the antitoxins that regulate host metabolic pathways by binding to DNA or RNA sequences similar to those of TA operons or by directly binding to host proteins (Table 2). Among the eight different types of TA systems, type II antitoxins have DNA-binding abilities, and many of them are produced in greater amounts than toxins. The ability of these antitoxins to regulate other host genes that have similar binding motifs is expected and has now been demonstrated in various E. coli and Pseudomonas strains. Importantly, the cellular targets of type II antitoxins are often the master regulators of the bacterial stress response. In E. coli, the stationary phase sigma factor RpoS controls up to 500 genes. We found that the antitoxin MqsA of type II TA MqsRA directly regulates RpoS by binding to an MqsA-specific palindrome [62]. Evidence has demonstrated that the type II antitoxin HigA in the HigBA TA system in Pseudomonas aeruginosa binds to the promoter of the virulence-related sigma factor MvfR to regulate virulence [63,64]. Moreover, our recent study found that the antitoxin PrpA in the PrpTA system directly binds to iterons in the plasmid origin, which could hinder binding of the Rep protein to the iterons, leading to a reduction in the plasmid copy number [12]. Furthermore, we have recently proven that antitoxin CrlA by itself can inhibit phage infection, and potential binding sites were observed in phage genomes [65]. Collectively, antitoxins can serve as flexible regulators in regulating gene expression by recognizing specific sequences in their promoter regions.
Table 2.
Antitoxins regulate host genes by binding to DNA or RNA sequences similar to those of TA pairs or by directly binding to host proteins.
| TA pair | TA type | Antitoxins | Regulated genes and sequences | Organisms | Source |
|---|---|---|---|---|---|
| MqsRA | II | MqsA | mqsRA, TAACCTTTTAGGTTA and ACCTTTTAGGT | E. coli | [66,67] |
| rpoS, AACCTTGCAGGTT | [62] | ||||
| csgD, AACCTTAAGGTT | [68] | ||||
| binds to cspD, bssR, spy, mcbR promoter regions | [69] | ||||
| MqsRA | II | MqsA | mqsRA, TTAACCTGGATCACAGC | Pseudomonas putida | [70] |
| algU(rpoE), ACCTGCCAGGT | [70] | ||||
| PP_3288, ACCTCAGAGGT | [70] | ||||
| nadB, ACCTGGCAGGT | [70] | ||||
| HigBA | II | HigA | higBA, TTAACGTTAA | Pseudomonas aeruginosa | [63, [71], [72], [73]] |
| mvfR, TTAACGTTAA | [63] | ||||
| pelA, TTGACGTTAA | [63,72] | ||||
| clpP2, TTAACTGTTAA | [63] | ||||
| cysC, GTTAACTTAAC | [63] | ||||
| chtA, TAACGTTA | [72] | ||||
| nadA, TTAACGTTAA | [72] | ||||
| fpvG, TACCGTTA | [72] | ||||
| hexR, TGACGTTA | [72] | ||||
| dctA, TAACGCTA | [72] | ||||
| pslO, TACCGTTA | [72] | ||||
| cntO, TAGCGTTA | [72] | ||||
| pa2440, TAGCGTTA | [72] | ||||
| YafQ/DinJ | II | DinJ | dinJ-yafQ, CTGAATAAATATACAG | [74] | |
| cspE, TACTG(TA)5CAGTA | [75] | ||||
| PrpTA | II | PrpA | prpAT, GTCATGGTAGTTTGTAATGATATGTCTTAT | Pseudoalteromonas rubra | [12] |
| ori, TGTAAGTATTTGAAATATATAGAand CGTGTAGGTTTGTAATACGCTAT | |||||
| ParEso/CopAso | II | CopAso | parEso-copAso, GTATTACCTAGTAGTAC | [15] | |
| pemKso-pemIso GTATTACAATGTAATAC | [15] | ||||
| RalRA | I | RalA | ralR, AAGUGAAAAAGAAGCA | E. coli | [37] |
| rnb, CACAGUGAAAAAGAACGUGAAUCand AAUCUGGAAAAAGAAGCACCAGA | [37] | ||||
| rnE, ACCGAAUUAAAAGAAGCACUGGC | [37] | ||||
| recE, GCGUCCGUAAAAGAAGCACCAAU | [37] | ||||
| ygcH, CCGUUAAUAAAAGAAGCAGAACA | [37] | ||||
| SprG1/ SprF1 | I | SprF1 | binds ribosomes to attenuate translation and promotes persister cell formation | Staphylococcus aureus | [76] |
| CbtA(YeeV)/CbeA(YeeU) | IV | CbeA | enhances the bundling of cytoskeletal polymers of MreB and FtsZ via direct protein-protein interaction | E. coli | [33] |
| CptA (YgfX)/CptB(YgfY) | IV | CptB | enhances the bundling of cytoskeletal polymers of MreB and FtsZ via direct protein-protein interaction | E. coli | [77] |
| YkfI/YafW | IV | YafW | YkfI binds to FtsZ | E. coli | [78] |
| YpjF/YfjZ | IV | YfjZ | YpjF binds to FtsZ | [78] | |
| ToxSAS/antiToxSAS | IV | antiToxSAS | degrades the molecular product ppGpp and ppApp of ToxSAS toxin | Cellulomonas marina | [79] |
4. Applications of TA systems
4.1. TA systems in mobile genetic element stabilization
TA systems have been shown to be involved in stabilizing different mobile genetic elements. TA systems were originally discovered as plasmid addiction systems, and their function is to prevent the formation of plasmid-free progeny, as plasmids exhibit a metabolic burden and are easily lost [6,8,80]. A plethora of findings have demonstrated that TA systems contribute to the stability of plasmids. For instance, the PrcA/PrcT system in the pCAR1 plasmid, a typical member of the RES-Xre family, which was cloned into the unstable plasmid pSEVA644 has been demonstrated to enhance pSEVA644 plasmid stability in P. resinovorans and E. coli strains [81]. The ParDEI TA system in Enterobacteriaceae, a member of the ParDE superfamily, has been found to function in plasmid maintenance with additional functions in promoting persister cell formation and providing antibiotic tolerance [82]. Additionally, the type II TA system, PumAB, which is encoded by the IncP-1 plasmid pUM505 in P. aeruginosa, was reported to maintain the stability of the pJET plasmid under nonselective conditions in E. coli [83]. We recently also described three TA systems, including the VapC/VapB, YoeB/YefM and Orf2769/Orf2770 TA systems in deep-sea Streptomyces sp. SCSIO 02,999 significantly increased pCA24N plasmid maintenance in E. coli [84,85].
Plasmid instability is a major problem for the large-scale industrial production of proteins in bacterial hosts. Applications of TA systems in large-scale industrial fermentation consist of maintaining the existence and replication of plasmids in enzyme production. The hok/sok TA system has been well demonstrated to stabilize the highly unstable pUC derivative pMJR1750 in large-scale industrial fermentation [86]. The most obvious advantage indicated by this research is that there is no need to sustainably add antibiotics to maintain the existence of plasmids in bacterial culture processes, which reduces pollution from antibiotics to the environment and saves production costs.
TA systems also stabilize other mobile genetic elements. ParESO/CopASO, a type II TA system, is critically important in stabilizing circular CP4So prophages after their excision in Shewanella onidensis [15]. Likewise, we also found that the PfiT toxin in the type II PfiT/PfiA system contributes to phage stabilization [87]. Deletion of the PfiT toxin activated the expression of the replication initiation factor gene PA0727 and greatly increased Pf4 phage production. Additionally, a widely distributed TA system, the SgiAT system, is encoded by an integrative mobilizable element called Salmonella Genomic Island 1 (GI1) and plays a vital role in stabilizing the GI [17]. Similarly, the HipAB TA system encoded by GI21 can stabilize the composite GI48 in Shewanella putrefaciens CN-32 [88]. In addition, an integrative and conjugative element (ICE), SXT, has been found that was maintained by a newly identified TA pair MosAT, conferring maintenance of antibiotic resistance [16]. Overall, TA systems are potential tools especially for stabilizing plasmids and other mobile genetic elements in synthetic biology.
4.2. TA systems in DNA cloning
Currently, plasmid-encoded TA systems have been shown to be crucial and promising tools for positive selection in bacterial DNA cloning and protein expression in synthetic biology and clinical trials. The CcdB toxin of CcdB/CcdA from the F-plasmid was inserted into vectors for positive selection (Fig. 2A) [89,90]. Clones with inserted foreign DNA that lead to toxin inactivation have been proven to be a successful strategy in DNA cloning.
Fig. 2.
Bioengineering applications of TA systems in DNA cloning. (A)Toxin disruption-based strategy for positive selection. Type II toxin is inserted into cloning vectors, using for positive selection. (B) Toxin replacement-based strategy for positive selection. Type II toxin is used in vitro recombination cloning such as Gateway™ system, using for positive selection. (C) Toxin neutralization-based strategy for positive selection. Toxin is inserted in host chromosome and antitoxin is inserted in the cloning vector, using for positive selection.
The second DNA cloning technology, the Gateway™ system, based on the phage λ recombinant system and TA system, was also proposed for use in the positive selection of plasmids (Fig. 2B) [90]. Basically, the constructed plasmid contains the ccdB toxin gene between the attP1 and attP2 sites. The target gene flanked by attB1 and attB2 was then introduced into the constructed plasmid through in vitro recombination, and this reaction contains integration host factor and λ integrase from E. coli. Cells harboring the plasmid in which the ccdB gene was successfully replaced by inserted foreign DNA formed colonies.
In addition, the CcdA/CcdB module was applied to the StabyCloning™ system introduced by Delphi Genetics (Fig. 2C) [90,91]. In this technology, host cells contain the ccdB toxin gene in their genomes, and a truncated inactive CcdA antitoxin is contained in the linearized vector. When a 14 bp sequence that is attached to the 5′-end of the DNA fragment is correctly inserted into the vector, the truncated antitoxin restores an active CcdA antitoxin to neutralize the toxin. Consequently, this system will positively select recombinant plasmids that are free of antibiotic resistance genes, and only clones containing a vector with the target gene in the correct orientation can survive. Notably, this technology also significantly enhances the stability of the plasmid. Therefore, due to the particularly efficient stabilization and avoidance of using antibiotics, this technology has a promising future in DNA cloning. Recently, this method has been successfully utilized in clinical trials to produce safe and efficacious DNA vaccines without antibiotic resistance genes against pseudorabies [92]. Taken together, the above three techniques can be utilized in DNA cloning and have wide prospects in the gene therapy field.
4.3. TA systems as phage defense elements in the fermentation industry
Phage contamination is a frequent and persistent threat in industrial fermentation processes and leads to low-quality products and even causes failure of the entire fermentation process [93]. Several studies have reported that phage infections are prevalent in industrial fermentations, which include the production of cheese [94], milk [95], cucumber by lactic acid bacteria (LAB) [96], and acetone-butanol-ethanol by Clostridium saccharoperbutylacetonicum [97]. Currently, the commonly used methods to eliminate phage contamination in the fermentation industry consist of rotating bacterial strains and adding phage inhibitors.
Engineering bacterial strains with antiphage elements can provide a different line of defense against phage infection. The primary role of TA systems is to provide antiphage defenses [26,98]. The mechanism of most TA system defenses against phage infection is known as abortive infection (Abi) [99]. When phages infect bacteria, the toxins of TA systems are triggered and then induce cell death after infection but before the phage replication cycle is complete, which thereby prevents phages from spreading to nearby cells and protects uninfected bacteria. Several TA systems have been found to protect cells by preventing phage infection, including Hok/Sok [100], MazEF [101], RnlAB [102], ToxIN [103], DarTG [104], retron-based TA systems [105], CapRelSJ46 fused TA systems [106] and kinase-kinase-phosphatase (KKP)-based TA systems [107], and most of them have been shown to provide phage defense via Abi.
A recent study engineered E. coli K-12 strains in which the SspBCDE phage defense system was integrated into the genome, which can confer high levels of phage resistance during industrial fermentation processes [108]. Based on above evidences, it is an effective way to integrate and design high-efficiency TA antiphage elements into bacterial chromosomes by using synthetic biology to construct phage-resistant industrial engineering bacteria (Fig. 3). However, evolution of escaper phage mutants that overcome individual phage defense systems is common, and the antiphage efficiencies of the engineered strains will decrease during the fermentation process. A feasible way to solve this problem is to combine TA systems with other phage defense systems that prevent different types of phages, such as CRISPR‒Cas [109], restriction-modification (R-M) systems [110] and a series of recently identified antiphage elements into the genomes of industrial bacteria [111], [112], [113], which can theoretically exert broad-spectrum antiphage effects to resist phages that are ubiquitous in production environments.
Fig. 3.
Integration of TA systems into industrial engineering bacterial chromosomes to construct phage-resistant cells. Host cells without TA system are quickly lysed upon phage infection (Upper panel). Individual cells with TA system integrated can activate toxin production when sensing phage attack to inhibit phage propagation, providing anti-phage protection at the population level (Lower panel).
4.4. TA systems as new drugs
Since TA systems can lead to cell death when the toxin is activated, they can be utilized in the development of new antimicrobial agents [90,114,115]. The strategy of using TA systems as novel antimicrobial agents relies on tunable toxin activation, involving TA complex disruption, activation of cellular proteases that degrade antitoxins, or translation inhibition of antitoxin expressions [116]. Previous studies have shown that designed peptides that mimic binding of the TA complex are designed to disrupt the TA complex and thus release toxins [117], [118], [119], [120]. Another alternative strategy is to induce the expressions of proteases that can degrade antitoxins, e.g., overproducing Lon protease can cause cell death by degrading YefM and releasing YoeB toxin to degrade mRNAs for the YoeB/YefM TA pair [121]. Another different strategy is to design antisense RNA that can bind to antitoxin mRNA to hinder antitoxin translation [122].
Although TA systems are mostly found in prokaryotes, considering the biochemical function of toxins such as RNA cleavages, toxins may also be used to selectively eliminate target cells in eukaryotes. Encouragingly, some type II TA systems have been shown to trigger apoptosis in human cells and are being considered for applications in molecular biology and medicine [123,124]. For instance, bacterial TA systems MazF/MazE TA can be designed to eliminate cells that are infected by human immunodeficiency virus (HIV-1) and hepatitis C virus (HCV) based on the endoribonuclease activity of MazF in sequence-specific manners. The main strategy of MazF/MazE system as an antiviral tool is based on the principle that MazF fused with a C-terminal unstructured peptide from MazE by using a viral protease-specific cleavage site as a linker. The linker would be effectively cleaved when HIV-1 and HCV infected cells, resulting in release of the MazF toxin to kill HIV-1- and HCV-infected cells [125,126]. Another alternative strategy is to construct MazF under the control of the HIV-1 LTR (long terminal repeat) promoter and transduce it by self-inactivating retroviral vectors in the genome of CD4+ T lymphocytes. Upon HIV-1 infection, MazF was induced to degrade the infecting HIV-1 mRNA and ultimately completely suppressed HIV-1 proliferation but did not inhibit cell growth [127]. Studies also indicated that the MazF ribonuclease in the MazF/MazE TA system was specific and effective in inhibiting tumor growth in vivo and induced selective cell death of lung, colorectal and pancreatic cancer cells based on the adenovirus delivery system [128].
Future uses of TA systems to treat pathogens are promising; however, challenges remain due to the strong interactions of toxins and antitoxins and the possible attenuation of toxin activity after interference. In recent years, the role of TA system in phage defense has been elucidated, and several groups found that phage protein can trigger the toxicity of the TA systems. For instance, the newly synthesized phage major capsid protein directly binds to the antitoxin of the fused TA system CapRelSJ46 which liberates toxin component [106], and the phage protein YopM binds to the antitoxin of the MazF/MazE TA system which can also activate toxin activity [129]. Although many studies have shown that TA systems play a vital role in eukaryotic disease-related therapy, one limitation is the failure of the adenovirus delivery system in the above strategies since a majority of people have antibodies against adenoviruses. Therefore, developing novel delivery methods for TA systems in disease-related therapy is needed. These new findings provide feasible strategies to activate the toxin of the TA systems in a controllable manner, leading to cell death in prokaryotic and eukaryotic cells.
5. Future perspective
In this review, we summarized that different TA systems present diverse biological functions and applications in mobile genetic element maintenance, DNA cloning, phage resistance, and as new drugs. However, most TA system applications in synthetic biology are immature and are still under development.
Extensive sequencing and comparative analysis comparisons reveal a very broad presence of TA systems in both bacteria and archaea. TA functions in archaea are mostly uncharted. Recent studies have shown that TA systems in prokaryotes act as ancient antiviral immunity elements, and several toxins, such as HepT toxins, harbor active domains that are also conserved in eukaryotic cells. These findings are not only expected to stimulate research in archaea that could shed light on diverse cellular processes regulated by TA systems across different life domains but could also provide important insights into TA applications in various fields.
Declaration of Competing Interest
The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Given her role as Editorial Board Member, Dr. Xiaoxue Wang, had no involvement in the peer-review of this article and has no access to information regarding its peer-review. Full responsibility for the editorial process for this article was delegated to Dr. Qunxin She.
Acknowledgments
This work was supported by the National Science Foundation of China (31970037, 42188102, 91951203, 31625001, 32100030), Science & Technology Fundamental Resources Investigation Program (2022FY100600), Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (2019BT02Y262), Guangdong Major Project of Basic and Applied Basic Research (2019B030302004), Guangdong Basic and Applied Basic Research Foundation (2022A1515010702) and the Key Special Project for Introduced Talents Team of Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou) (GML2019ZD0407).
References
- 1.Gerdes K., Christensen S.K., Lobner-Olesen A. Prokaryotic toxin-antitoxin stress response loci. Nat. Rev. Microbiol. 2005;3:371–382. doi: 10.1038/nrmicro1147. [DOI] [PubMed] [Google Scholar]
- 2.Harms A., Brodersen D.E., Mitarai N., Gerdes K. Toxins, targets, and triggers: an overview of toxin-antitoxin biology. Mol. Cell. 2018;70:768–784. doi: 10.1016/j.molcel.2018.01.003. [DOI] [PubMed] [Google Scholar]
- 3.Ramage H.R., Connolly L.E., Cox J.S. Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009;5 doi: 10.1371/journal.pgen.1000767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sala A., Bordes P., Genevaux P. Multiple toxin-antitoxin systems in Mycobacterium tuberculosis. Toxins (Basel) 2014;6:1002–1020. doi: 10.3390/toxins6031002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jaffe A., Ogura T., Hiraga S. Effects of the ccd function of the F plasmid on bacterial growth. J. Bacteriol. 1985;163:841–849. doi: 10.1128/jb.163.3.841-849.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ogura T., Hiraga S. Mini-F plasmid genes that couple host cell division to plasmid proliferation. Proc. Natl. Acad. Sci. U. S. A. 1983;80:4784–4788. doi: 10.1073/pnas.80.15.4784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gerdes K., Poulsen L.K., Thisted T., Nielsen A.K., Martinussen J., Andreasen P.H. The hok killer gene family in gram-negative bacteria. New. Biol. 1990;2:946–956. [PubMed] [Google Scholar]
- 8.Bravo A., de Torrontegui G., Diaz R. Identification of components of a new stability system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol. Gen. Genet. 1987;210:101–110. doi: 10.1007/BF00337764. [DOI] [PubMed] [Google Scholar]
- 9.Hayes F. Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. Science. 2003;301:1496–1499. doi: 10.1126/science.1088157. [DOI] [PubMed] [Google Scholar]
- 10.Nordstrom K., Austin S.J. Mechanisms that contribute to the stable segregation of plasmids. Annu. Rev. Genet. 1989;23:37–69. doi: 10.1146/annurev.ge.23.120189.000345. [DOI] [PubMed] [Google Scholar]
- 11.Cooper T.F., Paixao T., Heinemann J.A. Within-host competition selects for plasmid-encoded toxin-antitoxin systems. Proc. Biol. Sci. 2010;277:3149–3155. doi: 10.1098/rspb.2010.0831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ni S., Li B., Tang K., Yao J., Wood T.K., Wang P., Wang X. Conjugative plasmid-encoded toxin-antitoxin system PrpT/PrpA directly controls plasmid copy number. Proc. Natl. Acad. Sci. U. S. A. 2021;118 doi: 10.1073/pnas.2011577118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Meinersmann R.J. The biology of IncI2 plasmids shown by whole-plasmid multi-locus sequence typing. Plasmid. 2019;106 doi: 10.1016/j.plasmid.2019.102444. [DOI] [PubMed] [Google Scholar]
- 14.Carattoli A. Plasmids and the spread of resistance. Int. J. Med. Microbiol. 2013;303:298–304. doi: 10.1016/j.ijmm.2013.02.001. [DOI] [PubMed] [Google Scholar]
- 15.Yao J., Guo Y., Wang P., Zeng Z., Li B., Tang K., Liu X., Wang X. Type II toxin/antitoxin system ParESO /CopASO stabilizes prophage CP4So in Shewanella oneidensis. Environ. Microbiol. 2018;20:1224–1239. doi: 10.1111/1462-2920.14068. [DOI] [PubMed] [Google Scholar]
- 16.Wozniak R.A., Waldor M.K. A toxin-antitoxin system promotes the maintenance of an integrative conjugative element. PLoS Genet. 2009;5 doi: 10.1371/journal.pgen.1000439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Huguet K.T., Gonnet M., Doublet B., Cloeckaert A. A toxin antitoxin system promotes the maintenance of the IncA/C-mobilizable Salmonella Genomic Island 1. Sci. Rep. 2016;6:32285. doi: 10.1038/srep32285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Szekeres S., Dauti M., Wilde C., Mazel D., Rowe-Magnus D.A. Chromosomal toxin-antitoxin loci can diminish large-scale genome reductions in the absence of selection. Mol. Microbiol. 2007;63:1588–1605. doi: 10.1111/j.1365-2958.2007.05613.x. [DOI] [PubMed] [Google Scholar]
- 19.Yamaguchi Y., Inouye M. Regulation of growth and death in Escherichia coli by toxin-antitoxin systems. Nat. Rev. Microbiol. 2011;9:779–790. doi: 10.1038/nrmicro2651. [DOI] [PubMed] [Google Scholar]
- 20.Jørgensen M.G., Pandey D.P., Jaskolska M., Gerdes K. HicA of Escherichia coli defines a novel family of translation-independent mRNA interferases in bacteria and archaea. J. Bacteriol. 2009;191:1191–1199. doi: 10.1128/jb.01013-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dao-Thi M.H., Van Melderen L., De Genst E., Afif H., Buts L., Wyns L., Loris R. Molecular basis of gyrase poisoning by the addiction toxin CcdB. J. Mol. Biol. 2005;348:1091–1102. doi: 10.1016/j.jmb.2005.03.049. [DOI] [PubMed] [Google Scholar]
- 22.Christensen S.K., Gerdes K. RelE toxins from bacteria and archaea cleave mRNAs on translating ribosomes, which are rescued by tmRNA. Mol. Microbiol. 2003;48:1389–1400. doi: 10.1046/j.1365-2958.2003.03512.x. [DOI] [PubMed] [Google Scholar]
- 23.Hadzi S., Garcia-Pino A., Haesaerts S., Jurenas D., Gerdes K., Lah J., Loris R. Ribosome-dependent Vibrio cholerae mRNAse HigB2 is regulated by a beta-strand sliding mechanism. Nucleic Acids Res. 2017;45:4972–4983. doi: 10.1093/nar/gkx138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Manikandan P., Sandhya S., Nadig K., Paul S., Srinivasan N., Rothweiler U., Singh M. Identification, functional characterization, assembly and structure of ToxIN type III toxin-antitoxin complex from E. coli. Nucleic Acids Res. 2022 doi: 10.1093/nar/gkab1264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yao J., Zhen X., Tang K., Liu T., Xu X., Chen Z., Guo Y., Liu X., Wood T.K., Ouyang S., Wang X. Novel polyadenylylation-dependent neutralization mechanism of the HEPN/MNT toxin/antitoxin system. Nucleic Acids Res. 2020;48:11054–11067. doi: 10.1093/nar/gkaa855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Song S., Wood T.K. A primary physiological role of toxin/antitoxin systems is phage inhibition. Front. Microbiol. 2020;11:1895. doi: 10.3389/fmicb.2020.01895. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wang X., Wood T.K. Toxin-antitoxin systems influence biofilm and persister cell formation and the general stress response. Appl. Environ. Microbiol. 2011;77:5577–5583. doi: 10.1128/AEM.05068-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Aizenman E., Engelberg-Kulka H., Glaser G. An Escherichia coli chromosomal "addiction module" regulated by guanosine [corrected] 3′,5′-bispyrophosphate: a model for programmed bacterial cell death. Proc. Natl. Acad. Sci. U. S. A. 1996;93:6059–6063. doi: 10.1073/pnas.93.12.6059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Wang X., Yao J., Sun Y.C., Wood T.K. Type VII toxin/antitoxin classification system for antitoxins that enzymatically neutralize toxins. Trends. Microbiol. 2020 doi: 10.1016/j.tim.2020.12.001. [DOI] [PubMed] [Google Scholar]
- 30.Jurenas D., Fraikin N., Goormaghtigh F., Van Melderen L. Biology and evolution of bacterial toxin-antitoxin systems. Nat. Rev. Microbiol. 2022 doi: 10.1038/s41579-021-00661-1. [DOI] [PubMed] [Google Scholar]
- 31.Gerdes K., Bech F.W., Jorgensen S.T., Lobner-Olesen A., Rasmussen P.B., Atlung T., Boe L., Karlstrom O., Molin S., von Meyenburg K. Mechanism of postsegregational killing by the hok gene product of the parB system of plasmid R1 and its homology with the relF gene product of the E. coli relB operon. EMBO J. 1986;5:2023–2029. doi: 10.1002/j.1460-2075.1986.tb04459.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Fineran P.C., Blower T.R., Foulds I.J., Humphreys D.P., Lilley K.S., Salmond G.P. The phage abortive infection system, ToxIN, functions as a protein-RNA toxin-antitoxin pair. Proc. Natl. Acad. Sci. U. S. A. 2009;106:894–899. doi: 10.1073/pnas.0808832106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Masuda H., Tan Q., Awano N., Wu K.P., Inouye M. YeeU enhances the bundling of cytoskeletal polymers of MreB and FtsZ, antagonizing the CbtA (YeeV) toxicity in Escherichia coli. Mol. Microbiol. 2012;84:979–989. doi: 10.1111/j.1365-2958.2012.08068.x. [DOI] [PubMed] [Google Scholar]
- 34.Wang X., Lord D.M., Cheng H.Y., Osbourne D.O., Hong S.H., Sanchez-Torres V., Quiroga C., Zheng K., Herrmann T., Peti W., Benedik M.J., Page R., Wood T.K. A new type V toxin-antitoxin system where mRNA for toxin GhoT is cleaved by antitoxin GhoS. Nat. Chem. Biol. 2012;8:855–861. doi: 10.1038/nchembio.1062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Aakre C.D., Phung T.N., Huang D., Laub M.T. A bacterial toxin inhibits DNA replication elongation through a direct interaction with the β sliding clamp. Mol. Cell. 2013;52:617–628. doi: 10.1016/j.molcel.2013.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Li M., Gong L., Cheng F., Yu H., Zhao D., Wang R., Wang T., Zhang S., Zhou J., Shmakov S.A., Koonin E.V., Xiang H. Toxin-antitoxin RNA pairs safeguard CRISPR-Cas systems. Science. 2021;372 doi: 10.1126/science.abe5601. [DOI] [PubMed] [Google Scholar]
- 37.Guo Y., Quiroga C., Chen Q., McAnulty M.J., Benedik M.J., Wood T.K., Wang X. RalR (a DNase) and RalA (a small RNA) form a type I toxin-antitoxin system in Escherichia coli. Nucleic Acids Res. 2014;42:6448–6462. doi: 10.1093/nar/gku279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhang Y., Zhang J., Hoeflich K.P., Ikura M., Qing G., Inouye M. MazF cleaves cellular mRNAs specifically at ACA to block protein synthesis in Escherichia coli. Mol. Cell. 2003;12:913–923. doi: 10.1016/s1097-2765(03)00402-7. [DOI] [PubMed] [Google Scholar]
- 39.Chowdhury N., Kwan B.W., McGibbon L.C., Babitzke P., Wood T.K. Toxin MqsR cleaves single-stranded mRNA with various 5′ ends. Microbiologyopen. 2016;5:370–377. doi: 10.1002/mbo3.335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Mets T., Lippus M., Schryer D., Liiv A., Kasari V., Paier A., Maivali U., Remme J., Tenson T., Kaldalu N. Toxins MazF and MqsR cleave Escherichia coli rRNA precursors at multiple sites. RNA Biol. 2017;14:124–135. doi: 10.1080/15476286.2016.1259784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Aoi R., Miyamoto T., Yokota A., Ota Y., Fujitani H., Tsuneda S., Noda N. MazF endoribonucleolytic Toxin conserved in Nitrospira Specifically cleaves the AACU, AACG, and AAUU motifs. Toxins (Basel) 2020;12 doi: 10.3390/toxins12050287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Rothenbacher F.P., Suzuki M., Hurley J.M., Montville T.J., Kirn T.J., Ouyang M., Woychik N.A. Clostridium difficile MazF toxin exhibits selective, not global, mRNA cleavage. J. Bacteriol. 2012;194:3464–3474. doi: 10.1128/JB.00217-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Miyamoto T., Ota Y., Yokota A., Suyama T., Tsuneda S., Noda N. Characterization of a Deinococcus radiodurans MazF: a UACA-specific RNA endoribonuclease. Microbiologyopen. 2017;6 doi: 10.1002/mbo3.501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Harms A., Stanger F.V., Scheu P.D., de Jong I.G., Goepfert A., Glatter T., Gerdes K., Schirmer T., Dehio C. Adenylylation of gyrase and topo IV by FicT toxins disrupts bacterial DNA topology. Cell. Rep. 2015;12:1497–1507. doi: 10.1016/j.celrep.2015.07.056. [DOI] [PubMed] [Google Scholar]
- 45.Jiang Y., Pogliano J., Helinski D.R., Konieczny I. ParE toxin encoded by the broad-host-range plasmid RK2 is an inhibitor of Escherichia coli gyrase. Mol. Microbiol. 2002;44:971–979. doi: 10.1046/j.1365-2958.2002.02921.x. [DOI] [PubMed] [Google Scholar]
- 46.Yuan J., Sterckx Y., Mitchenall L.A., Maxwell A., Loris R., Waldor M.K. Vibrio cholerae ParE2 poisons DNA gyrase via a mechanism distinct from other gyrase inhibitors. J. Biol. Chem. 2010;285:40397–40408. doi: 10.1074/jbc.M110.138776. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Bernard P., Couturier M. Cell killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes. J. Mol. Biol. 1992;226:735–745. doi: 10.1016/0022-2836(92)90629-x. [DOI] [PubMed] [Google Scholar]
- 48.Jankevicius G., Ariza A., Ahel M., Ahel I. The toxin-antitoxin system DarTG catalyzes reversible ADP-ribosylation of DNA. Mol. Cell. 2016;64:1109–1116. doi: 10.1016/j.molcel.2016.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Kawano M., Aravind L., Storz G. An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin. Mol. Microbiol. 2007;64:738–754. doi: 10.1111/j.1365-2958.2007.05688.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Kaspy I., Rotem E., Weiss N., Ronin I., Balaban N.Q., Glaser G. HipA-mediated antibiotic persistence via phosphorylation of the glutamyl-tRNA-synthetase. Nat. Commun. 2013;4:3001. doi: 10.1038/ncomms4001. [DOI] [PubMed] [Google Scholar]
- 51.Winther K.S., Gerdes K. Enteric virulence associated protein VapC inhibits translation by cleavage of initiator tRNA. Proc. Natl. Acad. Sci. U. S. A. 2011;108:7403–7407. doi: 10.1073/pnas.1019587108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Cruz J.W., Sharp J.D., Hoffer E.D., Maehigashi T., Vvedenskaya I.O., Konkimalla A., Husson R.N., Nickels B.E., Dunham C.M., Woychik N.A. Growth-regulating Mycobacterium tuberculosis VapC-mt4 toxin is an isoacceptor-specific tRNase. Nat. Commun. 2015;6:7480. doi: 10.1038/ncomms8480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Winther K., Tree J.J., Tollervey D., Gerdes K. VapCs of Mycobacterium tuberculosis cleave RNAs essential for translation. Nucleic Acids Res. 2016;44:9860–9871. doi: 10.1093/nar/gkw781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Cheverton A.M., Gollan B., Przydacz M., Wong C.T., Mylona A., Hare S.A., Helaine S. A Salmonella toxin promotes persister formation through acetylation of tRNA. Mol. Cell. 2016;63:86–96. doi: 10.1016/j.molcel.2016.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Jurenas D., Chatterjee S., Konijnenberg A., Sobott F., Droogmans L., Garcia-Pino A., Van Melderen L. AtaT blocks translation initiation by N-acetylation of the initiator tRNA(fMet) Nat. Chem. Biol. 2017;13:640–646. doi: 10.1038/nchembio.2346. [DOI] [PubMed] [Google Scholar]
- 56.Zhang Y., Inouye M. RatA (YfjG), an Escherichia coli toxin, inhibits 70S ribosome association to block translation initiation. Mol. Microbiol. 2011;79:1418–1429. doi: 10.1111/j.1365-2958.2010.07506.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Pedersen K., Zavialov A.V., Pavlov M.Y., Elf J., Gerdes K., Ehrenberg M. The bacterial toxin RelE displays codon-specific cleavage of mRNAs in the ribosomal A site. Cell. 2003;112:131–140. doi: 10.1016/s0092-8674(02)01248-5. [DOI] [PubMed] [Google Scholar]
- 58.Songailiene I., Juozapaitis J., Tamulaitiene G., Ruksenaite A., Sulcius S., Sasnauskas G., Venclovas C., Siksnys V., toxin-antitoxin system HEPN-MNT. The HEPN ribonuclease is neutralized by oligoAMPylation. Mol. Cell. 2020;80:955–970. doi: 10.1016/j.molcel.2020.11.034. e957. [DOI] [PubMed] [Google Scholar]
- 59.Verstraeten N., Knapen W.J., Kint C.I., Liebens V., Van den Bergh B., Dewachter L., Michiels J.E., Fu Q., David C.C., Fierro A.C., Marchal K., Beirlant J., Versees W., Hofkens J., Jansen M., Fauvart M., Michiels J. Obg and membrane depolarization are part of a microbial bet-hedging strategy that leads to antibiotic tolerance. Mol. Cell. 2015;59:9–21. doi: 10.1016/j.molcel.2015.05.011. [DOI] [PubMed] [Google Scholar]
- 60.Castro-Roa D., Garcia-Pino A., De Gieter S., van Nuland N.A.J., Loris R., Zenkin N. The Fic protein Doc uses an inverted substrate to phosphorylate and inactivate EF-Tu. Nat. Chem. Biol. 2013;9:811–817. doi: 10.1038/nchembio.1364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Bobonis J., Mitosch K., Mateus A., Karcher N., Kritikos G., Selkrig J., Zietek M., Monzon V., Pfalz B., Garcia-Santamarina S., Galardini M., Sueki A., Kobayashi C., Stein F., Bateman A., Zeller G., Savitski M.M., Elfenbein J.R., Andrews-Polymenis H.L., Typas A. Bacterial retrons encode phage-defending tripartite toxin-antitoxin systems. Nature. 2022;609:144–150. doi: 10.1038/s41586-022-05091-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Wang X., Kim Y., Hong S.H., Ma Q., Brown B.L., Pu M., Tarone A.M., Benedik M.J., Peti W., Page R., Wood T.K. Antitoxin MqsA helps mediate the bacterial general stress response. Nat. Chem. Biol. 2011;7:359–366. doi: 10.1038/nchembio.560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Guo Y., Sun C., Li Y., Tang K., Ni S., Wang X. Antitoxin HigA inhibits virulence gene mvfR expression in Pseudomonas aeruginosa. Environ. Microbiol. 2019;21:2707–2723. doi: 10.1111/1462-2920.14595. [DOI] [PubMed] [Google Scholar]
- 64.Song Y., Zhang S., Luo G., Shen Y., Li C., Zhu Y., Huang Q., Mou X., Tang X., Liu T., Wu S., Tong A., He Y., Bao R. Type II antitoxin HigA is a key virulence regulator in Pseudomonas aeruginosa. ACS Infect. Dis. 2021;7:2930–2940. doi: 10.1021/acsinfecdis.1c00401. [DOI] [PubMed] [Google Scholar]
- 65.Ni M., Lin J., Gu J., Lin S., He M., Guo Y. Antitoxin CrlA of CrlTA toxin-antitoxin system in a clinical isolate Pseudomonas aeruginosa inhibits lytic phage infection. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.892021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Yamaguchi Y., Park J.H., Inouye M. MqsR, a crucial regulator for quorum sensing and biofilm formation, is a GCU-specific mRNA interferase in Escherichia coli. J. Biol. Chem. 2009;284:28746–28753. doi: 10.1074/jbc.M109.032904. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Brown B.L., Wood T.K., Peti W., Page R. Structure of the Escherichia coli antitoxin MqsA (YgiT/b3021) bound to its gene promoter reveals extensive domain rearrangements and the specificity of transcriptional regulation. J. Biol. Chem. 2011;286:2285–2296. doi: 10.1074/jbc.M110.172643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Soo V.W., Wood T.K. Antitoxin MqsA represses curli formation through the master biofilm regulator CsgD. Sci. Rep. 2013;3:3186. doi: 10.1038/srep03186. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Kim Y., Wang X., Zhang X.S., Grigoriu S., Page R., Peti W., Wood T.K. Escherichia coli toxin/antitoxin pair MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 2010;12:1105–1121. doi: 10.1111/j.1462-2920.2009.02147.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Sun C., Guo Y., Tang K., Wen Z., Li B., Zeng Z., Wang X. MqsR/MqsA toxin/antitoxin system regulates persistence and biofilm formation in Pseudomonas putida KT2440. Front. Microbiol. 2017;8:840. doi: 10.3389/fmicb.2017.00840. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Liu Y., Gao Z., Liu G., Geng Z., Dong Y., Zhang H. Structural insights into the transcriptional regulation of HigBA toxin-antitoxin system by antitoxin HigA in Pseudomonas aeruginosa. Front. Microbiol. 2019;10:3158. doi: 10.3389/fmicb.2019.03158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Song Y., Luo G., Zhu Y., Li T., Li C., He L., Zhao N., Zhao C., Yang J., Huang Q., Mu X., Tang X., Kang M., Wu S., He Y., Bao R. Pseudomonas aeruginosa antitoxin HigA functions as a diverse regulatory factor by recognizing specific pseudopalindromic DNA motifs. Environ. Microbiol. 2021;23:1541–1558. doi: 10.1111/1462-2920.15365. [DOI] [PubMed] [Google Scholar]
- 73.Li M., Long Y., Liu Y., Liu Y., Chen R., Shi J., Zhang L., Jin Y., Yang L., Bai F., Jin S., Cheng Z., Wu W. HigB of Pseudomonas aeruginosa enhances killing of phagocytes by up-regulating the Type III secretion system in ciprofloxacin induced persister cells. Front. Cell. Infect. Microbiol. 2016;6:125. doi: 10.3389/fcimb.2016.00125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Prysak M.H., Mozdzierz C.J., Cook A.M., Zhu L., Zhang Y., Inouye M., Woychik N.A. Bacterial toxin YafQ is an endoribonuclease that associates with the ribosome and blocks translation elongation through sequence-specific and frame-dependent mRNA cleavage. Mol. Microbiol. 2009;71:1071–1087. doi: 10.1111/j.1365-2958.2008.06572.x. [DOI] [PubMed] [Google Scholar]
- 75.Hu Y., Benedik M.J., Wood T.K. Antitoxin DinJ influences the general stress response through transcript stabilizer CspE. Environ. Microbiol. 2012;14:669–679. doi: 10.1111/j.1462-2920.2011.02618.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Pinel-Marie M.L., Brielle R., Riffaud C., Germain-Amiot N., Polacek N., Felden B. RNA antitoxin SprF1 binds ribosomes to attenuate translation and promote persister cell formation in Staphylococcus aureus. Nat. Microbiol. 2021;6:209–220. doi: 10.1038/s41564-020-00819-2. [DOI] [PubMed] [Google Scholar]
- 77.Masuda H., Tan Q., Awano N., Yamaguchi Y., Inouye M. A novel membrane-bound toxin for cell division, CptA (YgfX), inhibits polymerization of cytoskeleton proteins, FtsZ and MreB, in Escherichia coli. FEMS Microbiol. Lett. 2012;328:174–181. doi: 10.1111/j.1574-6968.2012.02496.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Wen Z., Wang P., Sun C., Guo Y., Wang X. Interaction of type IV toxin/antitoxin systems in cryptic prophages of Escherichia coli K-12. Toxins (Basel) 2017;9 doi: 10.3390/toxins9030077. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Jimmy S., Saha C.K., Kurata T., Stavropoulos C., Oliveira S.R.A., Koh A., Cepauskas A., Takada H., Rejman D., Tenson T., Strahl H., Garcia-Pino A., Hauryliuk V., Atkinson G.C. A widespread toxin-antitoxin system exploiting growth control via alarmone signaling. Proc. Natl. Acad. Sci. U. S. A. 2020;117:10500–10510. doi: 10.1073/pnas.1916617117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Jensen R.B., Gerdes K. Programmed cell death in bacteria: proteic plasmid stabilization systems. Mol. Microbiol. 1995;17:205–210. doi: 10.1111/j.1365-2958.1995.mmi_17020205.x. [DOI] [PubMed] [Google Scholar]
- 81.Takashima A., Kawano H., Ueda T., Suzuki-Minakuchi C., Okada K., Nojiri H. A toxin-antitoxin system confers stability to the IncP-7 plasmid pCAR1. Gene. 2022;812 doi: 10.1016/j.gene.2021.146068. [DOI] [PubMed] [Google Scholar]
- 82.Kamruzzaman M., Iredell J. A ParDE-family toxin antitoxin system in major resistance plasmids of Enterobacteriaceae confers antibiotic and heat tolerance. Sci. Rep. 2019;9:9872. doi: 10.1038/s41598-019-46318-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Hernández-Ramírez K.C., Chávez-Jacobo V.M., Valle-Maldonado M.I., Patiño-Medina J.A., Díaz-Pérez S.P., Jácome-Galarza I.E., Ortiz-Alvarado R., Meza-Carmen V., Ramírez-Díaz M.I. Plasmid pUM505 encodes a Toxin-Antitoxin system conferring plasmid stability and increased Pseudomonas aeruginosa virulence. Microb. Pathog. 2017;112:259–268. doi: 10.1016/j.micpath.2017.09.060. [DOI] [PubMed] [Google Scholar]
- 84.Guo Y., Yao J., Sun C., Wen Z., Wang X. Characterization of the deep-sea Streptomyces sp. SCSIO 02999 derived VapC/VapB toxin-antitoxin system in Escherichia coli. Toxins (Basel) 2016;8 doi: 10.3390/toxins8070195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Zhan W., Yao J., Tang K., Li Y., Guo Y., Wang X. Characterization of two toxin-antitoxin systems in deep-sea Streptomyces sp. SCSIO 02999. Mar. Drugs. 2019;17 doi: 10.3390/md17040211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Wu K., Jahng D., Wood T.K. Temperature and growth rate effects on the hok/sok killer locus for enhanced plasmid stability. Biotechnol. Prog. 1994;10:621–629. doi: 10.1021/bp00030a600. [DOI] [PubMed] [Google Scholar]
- 87.Li Y., Liu X., Tang K., Wang W., Guo Y., Wang X. Prophage encoding toxin/antitoxin system PfiT/PfiA inhibits Pf4 production in Pseudomonas aeruginosa. Microb. Biotechnol. 2020;13:1132–1144. doi: 10.1111/1751-7915.13570. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Zhao Y., Wang W., Yao J., Wang X., Liu D., Wang P. The HipAB toxin-antitoxin system stabilizes a composite genomic island in Shewanella putrefaciens CN-32. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.858857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Bernard P., Gabant P., Bahassi E.M., Couturier M. Positive-selection vectors using the F plasmid ccdB killer gene. Gene. 1994;148:71–74. doi: 10.1016/0378-1119(94)90235-6. [DOI] [PubMed] [Google Scholar]
- 90.Unterholzner S.J., Poppenberger B., Rozhon W. Toxin-antitoxin systems: biology, identification, and application. Mob. Genet. Elements. 2013;3:e26219. doi: 10.4161/mge.26219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Stieber D., Gabant P., Szpirer C. The art of selective killing: plasmid toxin/antitoxin systems and their technological applications. BioTechniques. 2008;45:344–346. doi: 10.2144/000112955. [DOI] [PubMed] [Google Scholar]
- 92.Reschner A., Scohy S., Vandermeulen G., Daukandt M., Jacques C., Michel B., Nauwynck H., Xhonneux F., Préat V., Vanderplasschen A., Szpirer C. Use of Staby(®) technology for development and production of DNA vaccines free of antibiotic resistance gene. Hum. Vaccin. Immunother. 2013;9:2203–2210. doi: 10.4161/hv.25086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Los M. Minimization and prevention of phage infections in bioprocesses. Methods Mol. Biol. 2012;834:305–315. doi: 10.1007/978-1-61779-483-4_19. [DOI] [PubMed] [Google Scholar]
- 94.Murphy J., Royer B., Mahony J., Hoyles L., Heller K., Neve H., Bonestroo M., Nauta A., van Sinderen D. Biodiversity of lactococcal bacteriophages isolated from 3 Gouda-type cheese-producing plants. J. Dairy. Sci. 2013;96:4945–4957. doi: 10.3168/jds.2013-6748. [DOI] [PubMed] [Google Scholar]
- 95.Garneau J.E., Moineau S. Bacteriophages of lactic acid bacteria and their impact on milk fermentations. Microb. Cell. Fact. 2011;10(Suppl 1):S20. doi: 10.1186/1475-2859-10-S1-S20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Lu Z., Perez-Diaz I.M., Hayes J.S., Breidt F. Bacteriophage ecology in a commercial cucumber fermentation. Appl. Environ. Microbiol. 2012;78:8571–8578. doi: 10.1128/AEM.01914-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Schuler M.A., Stegmann B.A., Poehlein A., Daniel R., Durre P. Genome sequence analysis of the temperate bacteriophage TBP2 of the solvent producer Clostridium saccharoperbutylacetonicum N1-4 (HMT, ATCC 27021) FEMS. Microbiol. Lett. 2020;367 doi: 10.1093/femsle/fnaa103. [DOI] [PubMed] [Google Scholar]
- 98.LeRoux M., Laub M.T. Toxin-antitoxin systems as phage defense elements. Annu. Rev. Microbiol. 2022;76:21–43. doi: 10.1146/annurev-micro-020722-013730. [DOI] [PubMed] [Google Scholar]
- 99.Lopatina A., Tal N., Sorek R. Abortive infection: bacterial suicide as an antiviral immune strategy. Annu. Rev. Virol. 2020;7:371–384. doi: 10.1146/annurev-virology-011620-040628. [DOI] [PubMed] [Google Scholar]
- 100.Pecota D.C., Wood T.K. Exclusion of T4 phage by the hok/sok killer locus from plasmid R1. J. Bacteriol. 1996;178:2044–2050. doi: 10.1128/jb.178.7.2044-2050.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Hazan R., Engelberg-Kulka H. Escherichia coli mazEF-mediated cell death as a defense mechanism that inhibits the spread of phage P1. Mol. Genet. Genomics. 2004;272:227–234. doi: 10.1007/s00438-004-1048-y. [DOI] [PubMed] [Google Scholar]
- 102.Koga M., Otsuka Y., Lemire S., Yonesaki T. Escherichia coli rnlA and rnlB compose a novel toxin-antitoxin system. Genetics. 2011;187:123–130. doi: 10.1534/genetics.110.121798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103.Guegler C.K., Laub M.T. Shutoff of host transcription triggers a toxin-antitoxin system to cleave phage RNA and abort infection. Mol. Cell. 2021;81:2361–2373. doi: 10.1016/j.molcel.2021.03.027. e2369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.LeRoux M., Srikant S., Teodoro G.I.C., Zhang T., Littlehale M.L., Doron S., Badiee M., Leung A.K.L., Sorek R., Laub M.T. The DarTG toxin-antitoxin system provides phage defence by ADP-ribosylating viral DNA. Nat. Microbiol. 2022 doi: 10.1038/s41564-022-01153-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Millman A., Bernheim A., Stokar-Avihail A., Fedorenko T., Voichek M., Leavitt A., Oppenheimer-Shaanan Y., Sorek R. Bacterial retrons function in anti-phage defense. Cell. 2020;183:1551–1561. doi: 10.1016/j.cell.2020.09.065. e1512. [DOI] [PubMed] [Google Scholar]
- 106.Zhang T., Tamman H., Coppieters ’t Wallant K., Kurata T., LeRoux M., Srikant S., Brodiazhenko T., Cepauskas A., Talavera A., Martens C., Atkinson G.C., Hauryliuk V., Garcia-Pino A., Laub M.T. Direct activation of a bacterial innate immune system by a viral capsid protein. Nature. 2022;612:132–140. doi: 10.1038/s41586-022-05444-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Guo Y., Tang K., Sit B., Gu J., Chen R., Lin J., Lin S., Liu X., Wang W., Gao X., Nie Z., Liu T., Waldor M.K., Wang X. Dual control of lysogeny and phage defense by a phosphorylation-based toxin/antitoxin system. bioRxiv. 2022 doi: 10.1101/2022.09.05.506569. 2022.2009.2005.506569. [DOI] [Google Scholar]
- 108.Zou X., Xiao X., Mo Z., Ge Y., Jiang X., Huang R., Li M., Deng Z., Chen S., Wang L., Lee S.Y. Systematic strategies for developing phage resistant Escherichia coli strains. Nat. Commun. 2022;13:4491. doi: 10.1038/s41467-022-31934-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109.Sorek R., Kunin V., Hugenholtz P. CRISPR–a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat. Rev. Microbiol. 2008;6:181–186. doi: 10.1038/nrmicro1793. [DOI] [PubMed] [Google Scholar]
- 110.Tock M.R., Dryden D.T. The biology of restriction and anti-restriction. Curr. Opin. Microbiol. 2005;8:466–472. doi: 10.1016/j.mib.2005.06.003. [DOI] [PubMed] [Google Scholar]
- 111.Cohen D., Melamed S., Millman A., Shulman G., Oppenheimer-Shaanan Y., Kacen A., Doron S., Amitai G., Sorek R. Cyclic GMP-AMP signalling protects bacteria against viral infection. Nature. 2019;574:691–695. doi: 10.1038/s41586-019-1605-5. [DOI] [PubMed] [Google Scholar]
- 112.Doron S., Melamed S., Ofir G., Leavitt A., Lopatina A., Keren M., Amitai G., Sorek R. Systematic discovery of antiphage defense systems in the microbial pangenome. Science. 2018:359. doi: 10.1126/science.aar4120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 113.Bernheim A., Sorek R. The pan-immune system of bacteria: antiviral defence as a community resource. Nat. Rev. Microbiol. 2020;18:113–119. doi: 10.1038/s41579-019-0278-2. [DOI] [PubMed] [Google Scholar]
- 114.Williams J.J., Hergenrother P.J. Artificial activation of toxin-antitoxin systems as an antibacterial strategy. Trends Microbiol. 2012;20:291–298. doi: 10.1016/j.tim.2012.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Lopez-Igual R., Bernal-Bayard J., Rodriguez-Paton A., Ghigo J.M., Mazel D. Engineered toxin-intein antimicrobials can selectively target and kill antibiotic-resistant bacteria in mixed populations. Nat. Biotechnol. 2019;37:755–760. doi: 10.1038/s41587-019-0105-3. [DOI] [PubMed] [Google Scholar]
- 116.Lee K.Y., Lee B.J. Structure, biology, and therapeutic application of toxin-antitoxin systems in pathogenic bacteria. Toxins (Basel) 2016;8 doi: 10.3390/toxins8100305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 117.Kang S.M., Jin C., Kim D.H., Park S.J., Han S.W., Lee B.J. Structure-based design of peptides that trigger Streptococcus pneumoniae cell death. FEBS J. 2021;288:1546–1564. doi: 10.1111/febs.15514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Kang S.M., Moon H., Han S.W., Kim D.H., Kim B.M., Lee B.J. Structure-based de novo design of Mycobacterium tuberculosis VapC-activating stapled peptides. ACS Chem. Biol. 2020;15:2493–2498. doi: 10.1021/acschembio.0c00492. [DOI] [PubMed] [Google Scholar]
- 119.Kang S.M., Kim D.H., Lee K.Y., Park S.J., Yoon H.J., Lee S.J., Im H., Lee B.J. Functional details of the Mycobacterium tuberculosis VapBC26 toxin-antitoxin system based on a structural study: insights into unique binding and antibiotic peptides. Nucleic Acids Res. 2017;45:8564–8580. doi: 10.1093/nar/gkx489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 120.Kim D.H., Kang S.M., Park S.J., Jin C., Yoon H.J., Lee B.J. Functional insights into the Streptococcus pneumoniae HicBA toxin-antitoxin system based on a structural study. Nucleic Acids Res. 2018;46:6371–6386. doi: 10.1093/nar/gky469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Christensen S.K., Maenhaut-Michel G., Mine N., Gottesman S., Gerdes K., Van Melderen L. Overproduction of the Lon protease triggers inhibition of translation in Escherichia coli: involvement of the yefM-yoeB toxin-antitoxin system. Mol. Microbiol. 2004;51:1705–1717. doi: 10.1046/j.1365-2958.2003.03941.x. [DOI] [PubMed] [Google Scholar]
- 122.Mruk I., Kobayashi I. To be or not to be: regulation of restriction-modification systems and other toxin-antitoxin systems. Nucleic Acids Res. 2014;42:70–86. doi: 10.1093/nar/gkt711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 123.Yamamoto T.A., Gerdes K., Tunnacliffe A. Bacterial toxin RelE induces apoptosis in human cells. FEBS Lett. 2002;519:191–194. doi: 10.1016/s0014-5793(02)02764-3. [DOI] [PubMed] [Google Scholar]
- 124.de la Cueva-Mendez G., Mills A.D., Clay-Farrace L., Diaz-Orejas R., Laskey R.A. Regulatable killing of eukaryotic cells by the prokaryotic proteins Kid and Kis. EMBO J. 2003;22:246–251. doi: 10.1093/emboj/cdg026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 125.Park J.H., Yamaguchi Y., Inouye M. Intramolecular regulation of the sequence-specific mRNA interferase activity of MazF fused to a MazE fragment with a linker cleavable by specific proteases. Appl. Environ. Microbiol. 2012;78:3794–3799. doi: 10.1128/AEM.00364-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 126.Shapira A., Shapira S., Gal-Tanamy M., Zemel R., Tur-Kaspa R., Benhar I. Removal of hepatitis C virus-infected cells by a zymogenized bacterial toxin. PLoS One. 2012;7:e32320. doi: 10.1371/journal.pone.0032320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 127.Chono H., Matsumoto K., Tsuda H., Saito N., Lee K., Kim S., Shibata H., Ageyama N., Terao K., Yasutomi Y., Mineno J., Kim S., Inouye M., Kato I. Acquisition of HIV-1 resistance in T lymphocytes using an ACA-specific E. coli mRNA interferase. Hum. Gene. Ther. 2011;22:35–43. doi: 10.1089/hum.2010.001. [DOI] [PubMed] [Google Scholar]
- 128.Shapira S., Boustanai I., Kazanov D., Ben Shimon M., Fokra A., Arber N. Innovative dual system approach for selective eradication of cancer cells using viral-based delivery of natural bacterial toxin-antitoxin system. Oncogene. 2021;40:4967–4979. doi: 10.1038/s41388-021-01792-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 129.Cui Y., Su X., Wang C., Xu H., Hu D., Wang J., Pei K., Sun M., Zou T. Bacterial MazF/MazE toxin-antitoxin suppresses lytic propagation of arbitrium-containing phages. Cell. Rep. 2022;41 doi: 10.1016/j.celrep.2022.111752. [DOI] [PubMed] [Google Scholar]




