REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Monoclonal Anti-β-Actin mouse antibody (1:4000) | Sigma-Aldrich | Cat# A2228; RRID: AB_476697 |
Anti-H7 v2 Rabbit (1:1000) polyclonal antibody for HYlight detection | Generated by Genscript | RRID: SCR_002891 |
Anti-histidine tag Mouse monoclonal antibody (1:1000) | Bio-rad | Cat# MCA1396G; RRID: AB_322084 |
Anti-Mouse IgG (Fc specific)–Peroxidase antibody produced in goat (1:10000) | Sigma-Aldrich | Cat# A0168; RRID: AB_257867 |
Goat Anti-Rabbit IgG Antibody, HRP-conjugate (1:5000) | Sigma-Aldrich | Cat# 12–348; RRID: AB_390191 |
Donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (1:500) | Thermofisher Scientific | Cat# A-21206; RRID:AB_2535792 |
Bacterial and virus strains | ||
XL1-Blue E. coli strain | Messens lab repository, originally Agilent | – |
Chemicals, peptides, and recombinant proteins | ||
William’s E Medium, GlutaMAX™ Supplement | Thermofisher Scientific | Cat# 32551087 |
Fetal Bovine Serum, qualified, USDA-approved regions | Thermofisher Scientific | Cat# 10437028 |
Penicillin-Streptomycin (10,000 U/mL) | Thermofisher Scientific | Cat# 15140122 |
Gibco™ HEPES (1M) | Fisher Scientific | Cat# 15-630-080 |
Hoechst 33342 | Thermofisher Scientific | Cat# 62249 |
Propidium iodide, ≥94.0% (HPLC) | Merck | Cat# P4170-100MG |
DMEM, low glucose, GlutaMAX™ Supplement, pyruvate | Thermofisher Scientific | Cat# 21885108 |
Seahorse XF DMEM Medium pH 7.4 | Agilent Technologies | Cat# 103575-100 |
Seahorse XF 200 mM glutamine solution | Agilent Technologies | Cat# 103579-100 |
Seahorse XF 1.0 M glucose solution | Agilent Technologies | Cat# 103577-100 |
Oligomycin A | MedChem Express | Cat# HY-16589 |
2-deoxy-D-glucose | Sigma-Aldrich | Cat# D6134 |
Dexamethasone | Sigma-Aldrich | Cat# D4902 |
Glucagon | Sigma-Aldrich | Cat# G2044 |
5-chloro-2-(N-(2,5-dichlorobenzenesulfonamide))-benzoxazole (FBPase-1 Inhibitor) | Santa Cruz Biotechnology | Cat# sc-221608 |
Seahorse XFp Cell Culture Miniplate | Agilent Technologies | Cat# 103025-100 |
Sodium L-lactate,∼98% | Sigma-Aldrich | Cat# L7022-5G |
Sodium pyruvate, ReagentPlus®, ≥99% | Sigma-Aldrich | Cat# P2256-100G |
Cell Lysis Buffer (10×) | Cell Signaling Technology | Cat# 9803S |
Halt™ Protease and Phosphatase Inhibitor Cocktails, Thermo Scientific, Halt Protease and Phosphatase Inhibitor Cocktail | Life Technologies | Cat# 78442 |
Trizma (Base) | Sigma-Aldrich | Cat# T6066 |
tris(2-carboxyethyl)phosphine (TCEP) | Carl Roth | Cat# HN95.2 |
Ampicillin Sodium | Duchefa | Cat# A0104 |
LB Broth High salt | Duchefa | Cat# L1704 |
Isopropyl-β-D-Thiogalactopyranoside, Dioxane free | Inalco | Cat# 1758-1400 |
Trizma® hydrochloride | Sigma-Aldrich | Cat# T5941 |
PMSF Protease Inhibitor | Thermofisher Scientific | Cat# 36978 |
Leupeptin Protease Inhibitor | Thermofisher Scientific | Cat# 78435 |
DNase I, RNase-free (1 U/μL) | Thermofisher Scientific | Cat# EN0521 |
Dithiothreitol (DTT) | Duchefa | Cat# D1309 |
Imidazole | Millipore | Cat# 288-32-4 |
D-Fructose 1,6-bisphosphate trisodium salt hydrate | Sigma-Aldrich | Cat# F6803 |
Bio-Rad Protein Assay Dye Reagent Concentrate | Bio-rad | Cat# 5000006 |
Carbohydrates Kit | Sigma-Aldrich | Cat# CAR10 |
TCA Cycle Metabolite Library | Sigma-Aldrich | Cat# ML0010 |
Guanosine 5′-triphosphate sodium salt hydrate | Sigma-Aldrich | Cat# G8877 |
Guanosine 5′-diphosphate sodium salt | Sigma-Aldrich | Cat# G7127 |
α-D-Glucose 1-phosphate dipotassium salt hydrate | Sigma-Aldrich | Cat# G6750 |
6-Phosphogluconic acid trisodium salt | Sigma-Aldrich | Cat# P7877 |
D-(−)-3-Phosphoglyceric acid disodium salt | Sigma-Aldrich | Cat# P8877 |
2,3-Diphospho-D-glyceric acid pentasodium salt | Sigma-Aldrich | Cat# D5764 |
Sodium L-lactate | Sigma-Aldrich | Cat# L7022 |
Dihydroxyacetone phosphate lithium salt | Sigma-Aldrich | Cat# 37442 |
Phospho(enol)pyruvic acid monopotassium salt | Sigma-Aldrich | Cat# P7127 |
D-Fructose 6-phosphate dipotassium salt | Sigma-Aldrich | Cat# F1502 |
DL-Glyceraldehyde 3-phosphate | Sigma-Aldrich | Cat# 39705 |
Adenosine 5′-triphosphate disodium salt solution | Sigma-Aldrich | Cat# A6559 |
β-Nicotinamide adenine dinucleotide 2′-phosphate reduced tetrasodium salt hydrate | Sigma-Aldrich | Cat# N1630 |
β-Nicotinamide adenine dinucleotide, reduced disodium salt hydrate | Sigma-Aldrich | Cat# N8129 |
β-Nicotinamide adenine dinucleotide hydrate | Sigma-Aldrich | Cat# N7004 |
Glucose 6-phosphate | Roche | Cat# 10127647001 |
Saponin | Sigma-Aldrich | Cat# 47036 |
Fructose 1,6-bisphosphate (U-1 ³C₆) | Buchem | Cat# CLM-8962 |
(2E)-3-(3-Pyridinyl)-1-(4-pyridinyl)-2-propen-1-one, 3PO (inhibitor of glucose metabolism) | Sigma-Aldrich | Cat# SML1343 |
Dmog,≥98% (hplc) (Dimethyloxalylglycine) | Sigma-Aldrich | Cat# D3695 |
William's Medium E w/o L-Glutamine, w/o Glucose, w/o Phenol red | Genaxxon Bioscience | Cat# C4318.0500TK |
Critical commercial assays | ||
Pierce™ BCA Protein Assay Kits | Thermofisher Scientific | Cat# 23225 |
PureYield™ Plasmid Miniprep System | Promega | Cat# A1222 |
Wizard® SV Gel and PCR Clean-Up System | Promega | Cat# A9282 |
Deposited data | ||
Fructose 1,6-bisphosphate quantification | Metabolomics Workbench (NMDR) | NMDR: https://doi.org/10.21228/M8WB25 |
HYlight Mass Spectrometry | ProteomeXchange | PRIDE: PXD051879 |
Experimental models: Cell lines | ||
HepG2 hepatoma cell line (Male) | ATCC | Cat# HB-8065; RRID: CVCL_0027 |
Huh6 hepatoma cell line (Male) | – | RRID: CVCL_4381 |
HLE hepatoma cell line (Male) | – | RRID: CVCL_1281 |
Experimental models: Organisms/strains | ||
C57BL6N Mice | Janvier-Labs | Cat# C57BL/6NRj Mouse RRID: IMSR_RJ:C57BL-6NRJ |
Oligonucleotides | ||
Fwd PCS2+/PQE30 EcoRI/BamHI HYlight Human E. coli primer: GGCACGTAGAATTCGGATCCATGGGCAGCAAAGACGTGCT |
This paper. | N/A |
Rev PCS2+/PQE30 XhoI/HindIII HYlight Human E. coli primer: GGCACGTACTCGAGAAGCTTTTAGCCGCTTTCATCGCGCA |
This paper. | N/A |
Forward Sequencing HYlight primer: GATCTACCAGAACCGTCAGATCCG |
This paper. | N/A |
Reverse Sequencing HYlight primer: GATGTTCTAGAGTCCGGAAGCTG |
This paper. | N/A |
pCS2+ vector Forward Sequencing primer: TGTTCTTTTTGCAGGATCCCATCG |
This paper. | N/A |
pCS2+ vector Reverse Sequencing primer: TCACTGCATTCTAGTTGTGGTTTG |
This paper. | N/A |
pQE-30 vector Forward Sequencing primer: AGGAGAAATTAACTATGAGAGG |
This paper. | N/A |
pQE-30 vector Reverse Sequencing plasmid: CCAGATGGAGTTCTGAGGTC |
This paper. | N/A |
Recombinant DNA | ||
HYlight codon-optimized E. coli/H. sapiens | This paper, generated by Twist Bioscience | https://www.twistbioscience.com/ |
pQE-30 vector | Qiagen | https://www.qiagen.com/ko-us |
pCS2+ vector | pCS2+HyPer7 was a gift from Vsevolod Belousov | Addgene plasmid # 136466; http://n2t.net/addgene:136466; RRID:Addgene_136466 |
HYlight codon-optimized M. musculus | Provided by John N. Koberstein | Koberstein et al.5 |
Software and algorithms | ||
Snapgene | Snapgene | https://www.snapgene.com/; RRID: SCR_015052 |
TubeSeq Services Eurofins Genomics | Eurofins Genomics | https://eurofinsgenomics.eu/en/custom-dna-sequencing/eurofins-services/tubeseq-services/ |
NIS-Elements | Nikon | https://www.microscope.healthcare.nikon.com/products/software/nis-elements; RRID: SCR_014329 |
Fiji | https://doi.org/10.1038/nmeth.2019 | https://fiji.sc/; RRID: SCR_002285 |
GraphPad Prism | GraphPad Software | https://www.graphpad.com/; RRID: SCR_002798 |
SoftMax Pro | Molecular Devices | https://es.moleculardevices.com/products/microplate-readers/acquisition-and-analysis-software/softmax-pro-software; RRID: SCR_014240 |
Amersham ImageQuant 800 | Cytiva | https://www.cytivalifesciences.com/en/be/shop/protein-analysis/molecular-imaging-for-proteins/imaging-systems/amersham-imagequant-800-systems-p-11546 |
Xcalibur software | Thermo Scientific | Cat# OPTON-30965; RRID: SCR_014593 |
ColabFold | Milot Mirdita | https://github.com/sokrypton/ColabFold; RRID: SCR_025453 |
AlphaFold2 | Google DeepMind | https://deepmind.google/technologies/alphafold/; RRID: SCR_025454 |
AlphaFill | Netherlands Cancer Institute | https://alphafill.eu/ |
PyMOL | Schrödinger | https://www.pymol.org/; RRID: SCR_000305 |
Proteome Discoverer Software | Thermofisher Scientific | https://www.thermofisher.com/be/en/home/industrial/mass spectrometry/liquid-chromatography-mass-spectrometry-lc-ms/lc-ms-software/multi-omics-data-analysis/proteome-discoverer-software.html; RRID: SCR_014477 |
FragPipe 20.0 | Alexey Nesvizhskii’s proteome bioinformatics group | https://fragpipe.nesvilab.org/; RRID: SCR_022864 |
Other | ||
μ-Slide 8 Well high ibiTreat cell plate | Ibidi | Cat# 80806 |
Lipofectamine™ 3000 Transfection Reagent | Thermofisher Scientific | Cat# L3000001 |
Nb207 Agarose Beads | Kindly provided by Jan Steyaert Laboratory | https://doi.org/10.1038/s41592-020-01001-6 |
Cytiva Disposable PD-10 Columns | Cytiva | Cat# GE17-0851-01 |
4–15% Mini-PROTEAN® TGX™ Precast Protein Gels | Bio-rad | Cat# 4561086 |
InstantBlue® Coomassie Protein Stain (ISB1L) | Abcam | Cat# ab119211 |
Filtropur S 0.45 μm | Sarstedt | Cat# 83.1826 |
Ni2+-Sepharose High-Performance Agarose Beads | Cytiva | Cat# 17526802 |
Vivaspin® 20 Centrifugal Concentrator Polyethersulfone 10 kDa | Sartorius | Cat# VS2001 |
HiLoad 16/600 Superdex 200 pg | Cytiva | Cat# 28989335 |
MICROPLATE, 96 WELL, UV-STAR®, COC, F-BOTTOM | Greiner Bio-one | Cat# 655809 |
6-well plates, TC treated | VWR | Cat# 7341599 |
U(H)PLC Column ACQUITY HSS T3 C18, 100 Å, 1.8 μm, 2.1 × 150 mm | Waters | Cat# WT186003540 |
Acclaim™ PepMap™ 100 C18 HPLC Columns | Thermofisher Scientific | Cat# 164946 |
Acclaim PepMap RSLC, 0.075 × 250 mm | Thermofisher Scientific | Cat# 164569 |
Lab Vision™ Ultra V Block | Thermofisher Scientific | Cat# TA-060-UB |
VECTASHIELD® Antifade Mounting Medium with DAPI | VectorLabs | Cat# H-1200 |