Table 1.
PCR Reaction & Cycling | ||||
---|---|---|---|---|
Acsl4-Flox | ||||
Primer | Sequence (5’→3′) | Primer Type | ||
P1 | AGTTAGCAGAGGGAGGCTGA | Forward | ||
P2 | GGCTTGCTTGTGGCACATTA | Reverse | ||
PCR Reaction System | Reaction Component | Volume (μl) | ||
ddH2O | 7.0 | |||
2 × transTaq-T PCR SuperMix | 10.0 | |||
P1 (10 pmol/μl) | 0.5 | |||
P2 (10 pmol/μl) | 0.5 | |||
Genomic DNA(50–100 ng/μl) | 2 | |||
Total | 20 | |||
2 × transTaq-T PCR SuperMix from TransGen Biotech (Code number:AS122) | ||||
Cycling Reaction | Step | Temp | Time | Note |
1 | 94 °C | 3 min | ||
2 | 94 °C | 30 s | ||
3 | 60 °C | 30 s | ||
4 | 72 °C | 30 s | 34 repeats to 2 | |
5 | 72 °C | 5 min | ||
6 | 12 °C | Hold | ||
Genotype | Wild type:one band with 318 bp | |||
Heterozygote:two bands with 318 and 372 bp | ||||
Homozygote:one band with 372 bp |
Pdgftb-creERT2 | ||||
---|---|---|---|---|
Primer | Sequence (5’→3′) | Primer Type | ||
P3 | GAACTGTCACCGGGAGGA | Transgene Forward | ||
P4 | AGGCAAATTTTGGTGTACGG | Transgene Reverse | ||
P5 | CAAATGTTGCTTGTCTGGTG | Internal Positive Control Forward | ||
P6 | GTCAGTCGAGTGCACAGTTT | Internal Positive Control Reverse | ||
PCR Reaction System | Reaction Component | Volume (μl) | ||
ddH2O | 6.0 | |||
2 × transTaq-T PCR SuperMix | 10.0 | |||
P3 (10 pmol/μl) | 0.5 | |||
P4 (10 pmol/μl) | 0.5 | |||
P5 (10 pmol/μl) | 0.5 | |||
P6 (10 pmol/μl) | 0.5 | |||
Genomic DNA(50–100 ng/μl) | 2 | |||
Total | 20 | |||
2 × transTaq-T PCR SuperMix from TransGen Biotech (Code number:AS122) | ||||
Cycling Reaction | Step | Temp | Time | Note |
1 | 94 °C | 3 min | ||
2 | 94 °C | 30 s | ||
3 | 60 °C | 30 s | ||
4 | 72 °C | 30 s | 34 repeats to 2 | |
5 | 72 °C | 5 min | ||
6 | 12 °C | Hold | ||
Genotype | Tg:∼400 bp | |||
Control:200 bp |