Reagents and tools table
| Reagent/resource | Reference or source | Identifier or catalog number |
|---|---|---|
| Experimental models | ||
| Pax7CreERT2 (M. musulus) | Jackson Lab (Lepper et al, 2009) | Stock #: 012476 |
| Rosa26YFP (M. musulus) | Jackson Lab (Srinivas et al, 2001) | Stock #: 006148 |
| Mpp7flox (M. musulus) | This paper | Available upon request |
| Amotflox (M. musulus) | from Dr. Joseph L Kissil (Shimono and Behringer, 2003) | |
| YapfloxTazflox (M. musulus) | Jackson Lab (Reginensi et al, 2013) | Strain #: 030532 |
| Recombinant DNA | ||
| pCDNA3-V5-Mpp7 (human cDNA) | This paper | Available upon request |
| pCDNA3-V5-Mpp7 △L27 | Modified from pCDNA3-V5-Mpp7; This paper | Available upon request |
| pCDNA3-V5-Mpp7 △PDZ | Modified from pCDNA3-V5-Mpp7; This paper | Available upon request |
| pCDNA3-V5-Mpp7 △△GukSH3 | Modified from pCDNA3-V5-Mpp7; This paper | Available upon request |
| pCDNA3-Flag-Mpp7 | Modified from pCDNA3-V5-Mpp7; This paper | Available upon request |
| pCDNA3-Flag-Mpp7 △L27 | Modified from pCDNA3-Flag-Mpp7; This paper | Available upon request |
| pCDNA3-Flag-Mpp7 △PDZ | Modified from pCDNA3-Flag-Mpp7; This paper | Available upon request |
| pCDNA3-Flag-Mpp7 △△SH3GUK | Modified from pCDNA3-Flag-Mpp7; This paper | Available upon request |
| HA-Amot p130 (human cDNA) | Addgene (Zhao et al, 2011) | Catalog #32821 |
| HA-Amot p130 △PDM | From Dr. Joseph L Kissil (Moleirinho S et al, 2017) | |
| HA-Amot p130 S175A | From Dr. Joseph L Kissil (Moleirinho S et al, 2017) | |
| HA-Amot p130 S175E | From Dr. Joseph L Kissil (Moleirinho S et al, 2017) | |
| HA-Amot p130 3PY | From Dr. Joseph L Kissil (Moleirinho S et al, 2017) | |
| Flag-Taz (human cDNA) | From Dr W Hong (Chan et al, 2011) | |
| Flag-Taz wwm (W152A, P155A) | From Dr W Hong (Chan et al, 2011) | |
| Myc-Carm1 (human cDNA) | Origene | Catalog #RC217483 |
| HA-YY1 (human cDNA) | Addgene (Weintraub et al, 2017) | Catalog #104395 |
| Flag-L27-Taz | Modified from pCDNA3-Flag-Mpp7 and Flag-Taz; This paper | Available upon request |
| pGL4-Carm1 | This paper | Available upon request |
| 8xGTIIC-luciferase | Addgene (Dupont et al, 2011) | Catalog #34615 |
| Antibodies | ||
| Rabbit anti-MPP7 | Proteintech | Catalog #12983-1-AP |
| Mouse anti-AMOT IgG2b | Santa Cruz | Catalog #sc-166924 |
| Mouse anti-PAX7 IgG1 | Developmental Studies Hybridoma Bank | Catalog #PAX7, Registration ID: AB_528428 |
| Rabbit anti-MYOD | Santa Cruz | Catalog #sc-304 |
| Chicken anti-LAMININ | Antibodiesonline.com | Catalog #ABIN573807 |
| Mouse anti-N-Cadherin IgG1 | Santa Cruz | Catalog #sc-393933 |
| Mouse anti-M-Cadherin IgG1 | Santa Cruz | Catalog #81471 |
| Mouse anti-beta-catenin | Santa Cruz | Catalog #sc-7963 |
| Rabbit anti-PAR3 | Millipore | Catalog #07-330 |
| Rabbit anti-CARM1 | Bethyl | Catalog #IHC-00045 |
| Rabbit anti-YAP | Cell Signaling | Catalog #14074 |
| Rabbit anti-TAZ | Cell Signaling | Catalog #83669 |
| Mouse anti-YY1 | Santa Cruz | Catalog #sc-7341 |
| Rabbit anti-FLAG | Cell Signaling | Catalog #14793 |
| Rabbit anti-HA | Cell Signaling | Catalog #3724 |
| Mouse anti-HA | Cell Signaling | Catalog #2367 |
| Chicken anti-GFP | Aves Lab | Catalog #GFP-1020 |
| Chicken anti-c-MYC Tag | Bethyl | Catalog #A190-103A |
| Rabbit anti-V5 | Cell Signaling | Catalog #13202 |
| Goat anti-mouse IgG1 cross-adsorbed secondary antibody, Alexa 568 | Thermo Fisher Scientific | Catalog #A-21123 |
| Goat anti-rabbit IgG (H + L) cross-adsorbed secondary antibody, Alexa 568 | Thermo Fisher Scientific | Catalog #A-11011 |
| Goat anti-mouse IgG2b cross-adsorbed secondary antibody, Alexa 568 | Thermo Fisher Scientific | Catalog #A-21144 |
| Goat anti-chicken IgY Secondary Antibody, FITC | Aves Lab | Catalog #F-1005 |
| Anti-V5 Agarose | Millipore Sigma | Catalog #A7345 |
| Anti-FLAG M2 magnetic beads | Millipore Sigma | Catalog #M8823 |
| Oligonucleotides and sequence-based reagents | ||
| Carm1-1-ChIP-qPCR |
Forward: cattccgggggcgtgc Reverse: aggcgctttgtgccacc |
|
| Carm1-2-ChIP-qPCR |
Forward: ccgtcccttgacaaaaagatgc Reverse: cccaggagggacggttacta |
|
| Acat3-ChIP-qPCR |
Forward: gtcccggctgaatcatcaga Reverse: tcccttttctgtctgtttttgtgt |
|
| Ints8-ChIP-qPCR |
Forward: cgaagacatcgaactcgctt Reverse: tagattctggcggggctct |
|
| Narfl-ChIP-qPCR |
Forward: agggaaactgggaaaggggat Reverse: ttgccaggaggattcttgtttt |
|
| Nrp-ChIP-qPCR |
Forward: cagtgcgcttagccccttta Reverse: cacgactccagggtttcgat |
|
| Mtif3-ChIP-qPCR |
Forward: tggataccatgtgggtgctg Reverse: tggcccagaggttaagagtc |
|
| Basp1-ChIP-qPCR |
Forward: agttctaaaatggctgtccctg Reverse: atccaggaggcttgaacacc |
|
| Ankrd1-ChIP-qPCR |
Forward: aaaaagggcagtgatgtggtg Reverse:gaagagggaggggaggacaa |
Zanconato et al, 2015 |
| Amotl2-ChIP-qPCR |
Forward: tgccaggaatgtgagagtttc Reverse: aggagggagcgggagaag |
Zanconato et al, 2015 |
| Mrpl11-ChIP-qPCR |
Forward: ttaccctagccgaacacgag Reverse: cttagctcgcctcggagaag |
Chen et al, 2019 |
| Uqcrh-ChIP-qPCR |
Forward: ctgctcctctgtttgacgat Reverse: agaggtcagcttttaggaccg |
Chen et al, 2019 |
| Chemicals, enzymes and other reagents | ||
| Cardiotoxin | Millipore Sigma | Catalog #11061-96-4 |
| Tamoxifen | Millipore Sigma | Catalog #10540-29-1 |
| EdU(5-ethynyl-2 ´-deoxyuridine) | Millipore Sigma | Catalog #61135-33-9 |
| 4-hydroxytamoxifen (4-OH-TMX) | Tocris Bioscience | Catalog #3412 |
| Collagenase, Type 2 | Worthington Biochemical | Catalog #LS004176 |
| Dispase II | Thermo Fisher Scientific | Catalog #17105041 |
| Matrigel | Corning | Catalog #354234 |
| GlutaMax | Thermo Fisher Scientific | Catalog #A1286001 |
| Chicken embryo extract | MP Biomedicals | Catalog #MP92850145 |
| FGF2 | R&D Systems | Catalog #3718-FB-010 |
| TransfeX Reagent | ATCC | Catalog #ACS-4005 |
| Lipofectamine 3000 | Thermo Fisher Scientific | Catalog #L3000008 |
| Y-27632 | Tocris Bioscience | Catalog #1254 |
| Blebbinstatin | Tocris Bioscience | Catalog #1852 |
| Cytochalasin B | Tocris Bioscience | Catalog #5474 |
| Narciclasine | Tocris Bioscience | Catalog #3715 |
| Jasplakinolide | Tocris Bioscience | Catalog #2792 |
| TRIzol LS Reagent | Thermo Fisher Scientific | Catalog #10296010 |
| Mouse on Mouse (M.O.M) blocking reagent | Vector Laboratories | Catalog #BMK-2202 |
| Carbo-free blocking solution | Vector Laboratories | Catalog #SP-5040-125 |
| BD insulin syringe | BD | Catalog #324792 |
| PFA | Electron Microscopy Sciences | Catalog #15710-SP |
| FSC 22 frozen section media | Leica | Catalog #3801480 |
| Isopentane | VWR | Catalog #MK196759 |
| Normal goat serum | Gibco | Catalog #16210-072 |
| Normal donkey serum | Millipore Sigma | Catalog #S30-M |
| Software | ||
| Fiji | Open Source | RRID:SCR_002285; http://fiji.sc |
| GraphPad Prism | Licensed Software | RRID:SCR_002798; http://www.graphpad.com |
| CellProfiler Image Analysis Software | Open Source | RRID:SCR_007358; http://cellprofiler.org |
| ChEA3 | Open Source | RRID:SCR_005403; http://amp.pharm.mssm.edu/lib/chea.jsp |
| JASPAR | Open Source | RRID:SCR_003030; http://jaspar.genereg.net |
| PROMO | Open Source | RRID:SCR_016926; http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3 |
| Imaris | Licensed Software | RRID:SCR_007370; http://www.bitplane.com/imaris |
| Others | ||
| Dual-Luciferase Reporter Assay System | Promega | Catalog #E1910 |
| Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye | Thermo Fisher Scientific | Catalog #C10340 |
| Direct-zol RNA Miniprep Kits | Zymo Research | Catalog #R2050 |
| TruSeq RNA Library Prep Kit | Illumina | Catalog #RS-122-2001 |
| Ribo-Zero rRNA Removal Kit | Epicentre | Catalog #RZH1086 |
| CUTANA ChIC/CUT&RUN kit | EpiCypher | Catalog #14-1048 |
| Duolink In Situ Red Starter Kit Mouse/Rabbit | Millipore Sigma | Catalog #DUO92101 |
| Dual-Luciferase Reporter Assay System | Promega | Catalog #E1910 |