Skip to main content
NCBI home page
Molecules and Cells logoLink to Molecules and Cells
. 2024 Oct 29;47(12):100143. doi: 10.1016/j.mocell.2024.100143

Unveiling the antimetastatic activity of monoterpene indole alkaloids targeting MMP9 in cancer cells, with a focus on pharmacokinetic and cellular insights

Mücahit Varlı 1, Kyungha Lee 2, Kyo Bin Kang 2, Hangun Kim 1,⁎
PMCID: PMC11625137  PMID: 39481856

Abstract

Distant metastasis, together with acquired resistance, limits the therapeutic impact of chemotherapy and molecularly targeted therapies. The properties of the tumor microenvironment determine how sensitive or resistant various cancers are to specific pharmacological treatments. Matrix metalloproteinase 9 (MMP9) is widely known for its ability to break down the extracellular matrix and it also modulates the motility of cancer cells. Here, our goal was to identify compounds that target MMP9 and evaluate their capacity to inhibit the motility of cancer cells. The antimetastatic effect of monoterpene indole alkaloids (MIAs) on cell viability and motility was evaluated by methyl thiazolyl tetrazolium assay, migration assay, invasion assay, quantitative real-time polymerase chain reaction, pathway-focused expression analysis, Western blotting, reporter assay, molecular docking simulation, and target prediction. MIA compounds target MMP9. MIAs inhibited the expression of phospho-epidermal growth factor receptor, phospho-Akt, phospho-JNK, and cyclin D1. Additionally, MIAs had predicted favorable pharmacokinetic profile and drug-like properties. Furthermore, among the MIA compounds, lyaloside and 5(S)-5-carbomethoxystrictosidine had low cytotoxicity and regulated cancer-related signaling, including cell migration, cell invasion, epithelial-mesenchymal transition, and immune evasion. Our findings demonstrated that the MIAs used in this study have potential antimetastasis properties that occur via MMP9-mediated regulation of cancer signaling and have the potential to be used therapeutically at safe doses.

Keywords: 5(S)-5-carbomethoxystrictosidine, Anticancer, Lyaloside, Matrix metalloproteinase 9, Monoterpene indole alkaloids

INTRODUCTION

Many cancer-related deaths are associated with metastasis. Metastasis, which is a distinctive feature of cancer, results from multiple processes (Hanahan and Weinberg, 2011). These processes include the modeling of the tumor microenvironment, the invasion of tumor cells into the lymph and blood, and their spread via the circulation, then infiltration into tissues, and the development of a new microenvironment (Lambert et al., 2017, Owyong et al., 2019). The extracellular matrix (ECM) is an important component of the tumor microenvironment. Physical and chemical environmental conditions, such as the presence of collagen and fibronectin, provide conditions that are vital for tumor cell survival (Kessenbrock et al., 2010, Tzanakakis et al., 2018). Disruption of the ECM and intercellular adhesion are important steps in cancer cell motility and metastasis (Xia et al., 2015).

ECM degradation is involved in the transition from an epithelial cell phenotype to a mesenchymal cell phenotype, a process known as the epithelial-mesenchymal transition (EMT) (Agraval and Yadav, 2019). Proteoglycans, glycoproteins, matrix metalloproteinases (MMPs), and growth factors regulate ECM function (Guan et al., 2018, Kessenbrock et al., 2010, Tzanakakis et al., 2018). MMPs are a family of zinc-dependent endopeptidases that promote cancer cell spread, invasion, and migration. Their role in metastasis occurs because they damage the basement membrane and ECM. In addition, the proteolytic activity of MMPs degrades the physical structure of the ECM. The activation and secretion of MMP9 disrupt the ECM, accelerating EMT (Gialeli et al., 2011) and establishing metastatic niches that facilitate metastatic progression (Zhang et al., 2020).

EMT is evolutionarily conserved and is involved in embryogenesis and other biological processes, as well as the progression of many types of carcinoma (Przybylo and Radisky, 2007a, Varlı et al., 2024). During EMT, cells lose their polarity, detach from the matrix, undergo remodeling of the actin cytoskeleton, undergo changes in cell-cell or cell-matrix adhesion, increase the expression of mesenchymal markers, and lose the expression of epithelial markers (Wu et al., 2012). Moreover, the expression of E-cadherin is reduced, caused by binding of the zinc finger transcriptional repressors SNAIL/SLUG and ZEB1 to the E-cadherin promoter and interaction with the transcriptional corepressor CtBP, which recruits histone deacetylases. Another EMT transcriptional factor, TWIST, also reduces E-cadherin expression and promotes EMT progression (Nagathihalli et al., 2012). Although EMT has several regulators, such as MMP9, it plays an important role in many types of cancer, including lung, colon, and gastric cancer (Li et al., 2019, Nam et al., 2022, Shao et al., 2019 Zhang et al., 2021). Although cancer survival rates are improving, the World Health Organization estimates that there will be 28.4 million new cancer cases worldwide by 2040 (Sung et al., 2021). Therefore, new therapeutics and treatment strategies need to be developed.

Monoterpene indole alkaloids (MIAs) are a class of naturally occurring substances characterized by the presence of a monoterpenoid moiety joined to an indole ring. They are part of a larger group of nitrogenous chemicals called alkaloids, which are mostly produced from amino acids and contain 1 or more nitrogen atoms. MIAs are important in medical research because of their diverse biological functions, such as cytotoxic, antibacterial and antifungal, anti-inflammatory, and immunosuppressant activities, as well as beneficial effects in cardiovascular and central nervous system disorders (Du et al., 2024, Gonçalves et al., 2024, Mohammed et al., 2021). In the present study, we elucidated the targets and pharmacokinetic and drug-like properties of 4 MIAs, including lyaloside and 5(S)-5-carbomethoxystrictosidine. In addition, we determined the effects and underlying mechanisms of lyaloside and 5(S)-5-carbomethoxystrictosidine on cancer cell motility.

MATERIALS AND METHODS

Cell Culture

In this study, human gastric cell line AGS, colorectal cell line CaCo2, and lung cancer cell line H1975 were used. Cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) or Roswell Park Memorial Institute (RPMI) (GenDepot) supplemented with 10% (v/v) fetal bovine serum and 1% (v/v) penicillin-streptomycin solution. Cells were incubated in 5% CO2 and 37°C temperature conditions.

Cell Viability Assay

Cell lines were cultured as 96-well plates at 3 × 103 cells/well. Cells were treated with different concentrations of compounds after seeding overnight. After 48 hours of treatment, 15 µL of methyl thiazolyl tetrazolium (MTT) reagent (Sigma-Aldrich) was added to each well. After 4 hours, the supernatants were removed, and the formazan crystals dissolved in 150 µL of DMSO. Absorbance was measured at 570 nm with a microplate reader.

Cell Migration (Wound-Healing) Assay

Cancer cells were plated at a density of 2 × 104 cells/well on 96-well ImageLock culture plates (Essen BioScience). After overnight, monolayer cells were scratched with a WoundMaker to create precise and reproducible wounds in all wells. The cells were then washed twice with serum-free DMEM media to remove floating cells and incubated in DMEM culture medium supplemented with 2% (v/v) fetal bovine serum. Cells were treated with compounds or DMSO. Plates were imaged using an IncuCyte instrument with a 10× objective and analyzed using the standard scan type. Three images per well were acquired, and scanning was performed every 4 hours. The migration ability of cancer cells were expressed as the density of the wound region relative to the density of the cell region (relative wound density) using IncuCyte Software.

Invasion Assay

Using Transwell chambers (Corning) with polycarbonate membranes having 8-m holes coated with 1% (w/v) gelatin, the invasion of cancer cells was quantified. The AGS, CaCo2, and H1975 cells were seeded in a culture medium containing 0.2% (v/v) bovine serum albumin and incubated with 1 and 2.5 μM of compounds or DMSO control for 24 hours. About 600 µL of DMEM/RPMI containing 0.2% (v/v) bovine serum albumin and 10 µg/mL of fibronectin as a chemoattractant were placed in the lower chamber. The invading cells were fixed with a Diff-Quik kit after 24 hours of incubation. The number of invaded cell images was taken using a microscope, after that i-Solution FL Auto Software (IMT i-Solution Inc; 5 fields/chamber) was used for calculation.

Quantitative Real-Time Polymerase Chain Reaction

AGS, CaCo2, and H1975 cells were seeded into the 6-well plates, after that cells were treated with compounds or DMSO for 48 hours of incubation. After that RNAiso Plus (Takara) was used according to the manufacturer’s instructions. A total of 1 μg of RNA of each treated group was reverse-transcribed to cDNA using Moloney murine leukemia virus reverse transcriptase kit (Invitrogen). The SYBR Green (Enzynomics) reagent was used to analyze relative gene expression. Data analyses were performed by a CFX instrument (Bio-Rad). The list of primers used are mentioned in Table 1.

Table 1.

Primer list for quantitative real-time polymerase chain reaction

Gene symbol Primer sequences
Forward(5′-3′) Reverse (5′-3′)
CDH1 CAGAAAGTTTTCCACCAAAG AAATGTGAGCAATTCTGCTT
CDH2 CTCCTATGAGTGGAACAGGAACG TTGGATCAATGTCATAATCAAGTGCTGTA
VIM TGCCCTAAAGGAACCAATG TCCAGCAGCTTCCTGTAGGT
SNAIL TCCCGGGCAATTTAACAATG TGGGAGACACATCGGTCAGA
TWIST CGGGAGTCCGCA GTCTTA TGAATCTTGCTCAGCTTGTC
ZEB1 ATGACA CAGGAAAGGAAGG AGCAGTGTCTTGTTGTAG
ZEB2 CAAGAGGCGCAAACAAGCC GGTTGGCAATACCGTCATCC
SLUG CGAACTGGACACACATACAGTG CTGAGGATC TCTGGTTGTGGT
CAPN1 CCTGCTTGAGAAGGCCTATG GGTCCACGTTGTTCCACTCT
MMP9 TTGACAGCGACAAGAAGTGG CAGTGAAGCGGTACATAGGG
ACTB ATTGTGAACTTTGGGGGATG GATGAGATTGGCATGGCTTT
Open in a new tab

ACTB; β-actin, CAPN1, calpain 1; CDH1, E-cadherin; CDH2, N-cadherin; MMP9, matrix metalloproteinase 9; VIM, Vimentin.

Pathway-Focused Expression Analysis Using the RT2 Profiler PCR Array

The Human Cell Motility RT2 Profiler PCR Array (Qiagen, SA Biosciences) was used to assess the expression of cell motility–related genes from AGS cells treated with compounds. Cell motility–related 84 key genes were quantified according to the manufacturer's protocol. Fold changes in mRNA expression were calculated based on the cycle threshold values obtained by RT-PCR. Heatmap and a scatterplot of test vs control samples demonstrated the validity of the experiment.

Western Blotting

AGS, CaCo2, and H1975 cells were treated with compounds. After 48 hours, cells lyzed in lysis buffer. Concentrations of protein in lysate were determined by BCA assay (Thermo Fisher Scientific). Proteins from each group were separated by SDS-PAGE, transferred to a blotting membrane, and blocked by skim milk for 1 hour. Membranes were incubated with primary antibodies for 2 hours at room temperature followed by the incubation with horseradish peroxidase–conjugated secondary antibodies (Thermo Fisher Scientific) for 1 hour at room temperature. Protein bands were detected using chemiluminescence imaging and measured by Multi Gauge 3.0. software. Relative density was calculated against the density of the loading control bands.

Reporter Assay

Using a transient transfection of an MMP9 promoter-luciferase reporter construct (pGL4-MMP9), the transcriptional regulation of MMP9 was investigated. Dr. Young Do Jung (Chonnam National University Medical School) generously contributed the plasmid pGL4-MMP9 promoter, which spans nucleotides from −925 to +13 (Xia et al., 2015). HEK239T cells were seeded into 24-well plates and cultured for 12 hours. The cells were then transfected with MMP9 reporter plasmids. Renilla luciferase plasmid (Promega) was used as an internal control. After 1 day, cells were treated with compounds for 1 day. After that, cells were harvested and lyzed with passive lysis buffer (Promega). Luciferase activity was measured using a dual luciferase reporter assay (Promega) and normalized by Renilla luciferase activity.

SWISS Web Tool Analysis

Target Prediction

To identify the target for MIAs, Swiss Target Prediction, a ligand-based target prediction web server, was used. The smile codes of the compounds were obtained from PubChem (Daina et al., 2019, Gfeller et al., 2013).

Absorption, Distribution, Metabolism, and Excretion Prediction

MIA compounds' physicochemical, pharmacokinetic, and absorption, distribution, metabolism, and excretion (ADME) predictions are provided by the SwissADME web tool (Daina et al., 2014, Daina et al., 2017, Daina and Zoete, 2016).

Bioinformatics-Based Gene Expression

Gene Expression Profiling Interactive Analysis (RRID:SCR_018294, http://gepia.cancer-pku.cn/) was used to predict the MMPs' differential expression level in cancerous and healthy groups.

Molecular Docking

These crystal structures of the MMP9 protein were found in the PDB database (PDB ID: 1GKC) to investigate the interaction mechanism between the receptors and ligand-binding sites, and it was decided to use this crystal structure under the guidance of references (Tabti et al., 2023). The molecular docking study of the MIAs is obtained using CB-Dock (http://cao.labshare.cn/cb-dock/) (Liu et al., 2020). Downloaded docking poses were visualized in 2D and 3D with BIOVIA Discovery Studio 2021. Docking scores calculated by CB-Dock were used.

Statistical Analysis

Data represent as means ± standard deviation. All statistical analyses were carried out using the Sigma Plot software.

RESULTS AND DISCUSSION

Target Prediction and Molecular Docking Simulation of MIAs

To determine the molecular mechanism underlying the anticancer activity of MIAs, the possible targetss of MIAs were investigated using SwissTargetPrediction online servers. The results show that lyaloside and 5(S)-5-carbomethoxystrictosidine targeted MMPs (Fig. 1A and B). In addition, strictosamide targeted MMPs (Fig. 1C). Next, we investigated the targets of mitraphylline. Unlike the other compounds, mitraphylline did not target MMPs according to SwissTargetPrediction analysis (Fig. 1D). We also analyzed the expression of MMPs from the database in colon adenocarcinoma, rectum adenocarcinoma, lung adenocarcinoma, and stomach adenocarcinoma types and found that MMP9 expression was overexpressed in 4 cancer types (Supplementary Fig. S1). MMP2 and MMP13 were significantly overexpressed in lung cancer compared with noncancerous tissues, but did not reach statistical significance in other cancer types. This reveals the wide range of effects of MMP9 in different cancer types. MMP9 has a very significant relation with the progression of a wide array of cancers, as it is involved in processes such as remodeling of the ECM, invasion, metastasis, and angiogenesis. Overexpression of MMP9 has often been observed in a large number of cancers, including gastric, colon, and lung cancers (Chen et al., 2015; Rashid and Bardaweel, 2023; Yang et al., 2014; Zhang et al., 2021).

Fig. 1.

Fig. 1

Open in a new tab

Target identification of MIAs. Human target prediction using SwissTargetPrediction of (A) lyaloside (1), (B) 5(S)-5-carbomethoxystrictosidine (2), (C) strictosamide (3), and (D) mitraphylline (4) and molecular docking of (E) lyaloside (1), (F) 5(S)-5-carbomethoxystrictosidine (2), (G) strictosamide (3), and (H) mitraphylline (4) to MMP9 (PDB 1GKC). The predicted binding poses of MMP9 are given. The MMP9 protein showed significant interactions (eg, van der Waals interactions, hydrophobic interactions, and hydrogen bonding) with the compounds using the BIOVIA Discovery Studio visualizer. Docking scores were calculated by CB dock, and the docking scores are given in the figure. (I) HEK293T cells were cotransfected with the pRL-TK (Renilla) plasmid and the MMP9 reporter plasmid (pGL4-MMP9). After 24 hours, transfected cells were treated with 1 or 2.5 µM lyaloside (1), 5(S)-5-carbomethoxystrictosidine (2), strictosamide (3), mitraphylline (4), or DMSO and incubated for 24 hours. Data are represented as the mean ± SD. *P < .05; **P < .01; ***P < .001. (J) AGS, (K) CaCo2, and (L) H1975 cells were treated with the indicated compound for 48 hours. Protein levels of MMP9, p-EGFR, p-Akt, p-JNK, and cyclin D1 were analyzed by Western blotting.

For further investigation, we simulated the docking of lyaloside, 5(S)-5-carbomethoxystrictosidine, strictosamide, and mitraphylline to MMP9. Molecular docking calculations were performed using the crystal structure of MMP9 (PDB: 1GKC). The molecular docking results are as follows: lyaloside (1), −8.0 kcal/mol; 5(S)−5-carbomethoxystrictosidine (2), −7.7 kcal/mol; strictosamide (3), −7.6 kcal/mol; mitraphylline (4), −7.0 kcal/mol (Fig. 1E-H). We compared our results with 2 known MMP inhibitors, prinomastat and ilomastat had a binding score of 9 kcal/mol (Supplementary Fig. S2). However, differences in amino acid interactions provide promising results in terms of expanding new types of MMP9 inhibitor lead compounds. Analyses with 2 known MMP inhibitors show that these inhibitors form bonds with essential amino acids such as His401, His405, and Glu402. Both tested compounds and known inhibitors exhibited significant hydrophobic binding, such as Pi-Pi stacking interactions with His411 and alkyl interactions with Ala189. Such interactions may position the inhibitors in close proximity to the zinc-binding catalytic site of MMP9, thus enhancing inhibitory activity. In addition, the tested compounds exhibited additional interactions not commonly observed in known inhibitors, such as Pi-cation interactions with Arg424. This suggests that the tested compounds may be different type inhibitors. The obtained docking poses show that there are common interaction sites between known inhibitors and the tested compounds, especially similar binding occurs at key regions such as Glu402, His405, and Ala189.

Next, we determined the effects of the compounds on MMP9 promoter activity. Our results showed that all the compounds significantly decreased promoter activity at concentrations of 2.5 µM (Fig. 1I). For further characterization, we determined the protein levels of MMP9, phospho-epidermal growth factor receptor (EGFR), phospho-Akt, phospho-JNK, and cyclin D1. In all cell lines tested, all the compounds downregulated MMP9 protein levels. These results indicate that the compounds downregulate both the promoter activity and the protein level of MMP9. While this inhibition at the protein level of MMP9 may represent a consequence of a direct interaction between the compounds and the MMP9 protein, and also causes feedback inhibition at transcriptional levels. Indeed, when the function of the MMP9 protein is suppressed, the need for new protein synthesis may be reduced and, therefore, contribute to the reduction of transcriptional levels through a feedback mechanism. Furthermore, mitraphylline (4) had the highest inhibitory activity in AGS and CaCo2 cell lines, but weaker inhibitory activity in the H1975 cell line. Lyaloside (1) had the highest inhibitory activity in the H1975 cell line (Fig. 1J-L). 5(S)-5-carbomethoxystrictosidine (4) suppressed p-Akt protein levels in all the cell lines. Overall, our results showed that MIAs bind to MMP9 and inhibit signaling.

ADME Predictions

We used a computational study to predict the ADME properties of MIAs using the SwissADME web tool, including solubility, toxicity risks, lipophilicity, and physicochemical and pharmacokinetic properties. These data showed that mitraphylline, which has a low molecular weight, can more be easily dispersed, absorbed, or transported across the cell membrane than other bulky MIAs. A topological polar surface area (TPSA) value greater than 140 Å2 indicates that a compound has a tendency to weakly penetrate cell membranes (Afza et al., 2023). Lyaloside, 5(S)-5-carbomethoxystrictosidine, and strictosamide had high TPSA values and are predicted to have a poor tendency to penetrate the cell membrane. Literature has been suggested that compounds cross the blood-brain barrier when the TPSA value is lower than 90 Å2(Hitchcock and Pennington, 2006, Pajouhesh and Lenz, 2005), but according to our SwissADME data, mitraphylline does not cross the blood-brain barrier. The skin permeability coefficient Kp is a crucial variable that must be considered when creating topical drug formulations. The Kp value has a linear relationship with both molecular size and lipophilicity (Abdeslem Bouzina et al., 2023). The Kp values of the compounds tested in this study ranged from −9.49 to −7.4. The ADME parameters of all the compounds tested lie within the ideal range (indicated by the polygons in Fig. 2). Mitraphylline having the highest solubility of the compounds tested.

Fig. 2.

Fig. 2

Open in a new tab

Physicochemical and pharmacokinetic properties of the monoterpene indole alkaloids. The bioavailability of (A) lyaloside (1), (B) 5(S)-5-carbomethoxystrictosidine (2), (C) strictosamide (3), and (D) mitraphylline (4) was determined using the SwissADME predictor. The ideal range for each property (lipophilicity, size, polarity, solubility, saturation, and flexibility) is shown by the pink area. (E) The ADME parameters. MW, molecular weight; TPSA, topological polar surface area; GI, gastrointestinal absorption; P-gp, P-glycoprotein substrate.

Cytochrome P450 2D6 (CYP2D6) is involved in the metabolism of about 25% of clinically prescribed drugs (Feick et al., 2023). Inhibition of cytochrome enzymes is one of the main mechanisms that cause pharmacokinetic drug-drug interactions (Zhao et al., 2021). Our ADME prediction results showed that only mitraphylline inhibits the CYP2D6 enzyme. However, all the compounds were substrates for P-glycoprotein. In addition, limitations of computational predictions are recommended to be taken into consideration; therefore, future studies need to focus on experimental verification of ADME properties of MIAs.

Lyaloside and 5(S)-5-Carbomethoxystrictosidine Suppress Cancer Cell Motility

The cytotoxicity of lyaloside and 5(S)-5-carbomethoxystrictosidine were tested against several human cancer cell lines, namely AGS (gastric), CaCo2 (colorectal), and H1975 (lung) cells. Lyaloside and 5(S)-5-carbomethoxystrictosidine had the poor cytotoxicity activity on the human cancer cell line (Fig. 3A-C). However, in the cell motility tests, we will perform, 1 and 2.5 μM concentrations were used in the study to evaluate the activity of the compound in suppressing cell motility independently of its cytotoxic effect. Wound-healing assays were carried out to observe the effect of nontoxic concentrations of the compounds (1 and 2.5 μM) on cell migration. Cell migration was significantly reduced after lyaloside or 5(S)-5-carbomethoxystrictosidine treatment (Fig. 3D and E). For distant metastasis to occur, primary tumor cells must break through the ECM and invade surrounding tissues (Hanahan and Weinberg, 2011). The results of a Transwell cell invasion assay showed that the ability of cells to penetrate the Transwell filter membrane in 1% (w/v) gelatin-coated Transwell was suppressed after treatment with lyaloside or 5(S)-5-carbomethoxystrictosidine (Fig. 3F and G). These results suggest that lyaloside and 5(S)-5-carbomethoxystrictosidine inhibit the motility of cancer cells.

Fig. 3.

Fig. 3

Open in a new tab

The effects of lyaloside (1) and 5(S)-5-carbomethoxystrictosidine (2) on the cell viability and motility of AGS, Caco2, and H1975 cells. (A-C) The cell viability of AGS, CaCo2, and H1975 cells treated with lyaloside and 5(S)-5-carbomethoxystrictosidine for 48 hours. (D and E) Representative images of each wound area and quantitative data of the relative wound density in the scratch wound migration assay using the IncuCyte system. (F and G) Representative images of each insert and the relative number of invaded cells in the Transwell invasion assay. Cells were treated with 1 and 2.5 μM lyaloside and 5(S)-5-carbomethoxystrictosidine at concentrations for 24 hours. Data are represented as the mean ± SD. *P < .05; **P < .01; ***P < .001.

Lyaloside and 5(S)-5-Carbomethoxystrictosidine Downregulate EMT Effectors and EMT Transcription Factors

EMT plays a role in the metastasis of lung, colon, and gastric cancer (Li et al., 2019, Loboda et al., 2011, Soltermann et al., 2008). EMT involves phenotypic alterations such as altered cell shape, decreased expression of epithelial markers, and increased expression of mesenchymal markers. During the EMT, the expression of E-cadherin (CDH1) decreases, while the expression of N-cadherin (CDH2) and vimentin, which are responsible for the mesenchymal phenotype, increases (Zhang et al., 2012). We used quantitative real-time polymerase chain reaction (qRT-PCR) to measure the mRNA expression of EMT effectors and EMT transcription factors. When AGS, CaCo2, and H1975 cells were treated with nontoxic concentrations of lyaloside and 5(S)-5-carbomethoxystrictosidine, the expression of several EMT effectors and EMT transcription factors decreased. The compounds increased CDH1 mRNA expression in some of the tested cell lines, whereas CDH2 expressions were significantly reduced in all the cell lines tested. Lyaloside did not alter VIM expression in the CaCo2 cell line, but downregulated VIM expression in AGS and H1975 cell lines. 5(S)-5-carbomethoxystrictosidine downregulated vimentin expression in all the cell lines tested (Fig. 4A-C). These results suggest that lyaloside and 5(S)-5-carbomethoxystrictosidine suppress EMT.

Fig. 4.

Fig. 4

Open in a new tab

Lyaloside and 5(S)-5-carbomethoxystrictosidine modulated the expression of EMT effectors and transcription factors. (A-C) The mRNA expression levels of EMT effectors (CDH1, CDH2, VIM) and EMT transcription factors (TWIST, SNAIL, SLUG, ZEB1, and ZEB2) were analyzed by qRT-PCR. The mRNA levels were normalized against β-actin. Data are represented as the mean ± SD. *P < .05; **P < 0.01; ***P < .001.

Lyaloside and 5(S)-5-Carbomethoxystrictosidine Modulate Genes and Signaling Pathways Associated With Cell Motility

We conducted a pathway-focused gene expression analysis using a human cell motility RT2 Profiler PCR array to elucidate the processes by which lyaloside and 5(S)-5-carbomethoxystrictosidine modulate cell motility (Fig. 5A-C). The expression of many genes was downregulated in AGS cells treated with 2.5 µM lyaloside or 5(S)-5-carbomethoxystrictosidine; the results are shown as a heatmap. There was a marked fold-change in the expression of calpain 1 (CAPN1) and MMP9 genes in treated cells compared with DMSO-treated cells. We then performed qRT-PCR analysis using CAPN1 and MMP9 primer pairs to analyze changes in CAPN1 and MMP9 expressions quantitatively in 3 cell lines. Our results showed that both compounds significantly reduced CAPN1 and MMP9 mRNA expression in the AGS cell line, which confirmed the results of the RT2 PCR array. In CaCo2 cells, neither compound altered the expression of CAPN1 but both compounds reduced the expression of MMP9, with lyaloside having a greater inhibitory effect than 5(S)-5-carbomethoxystrictosidine. In H1975 cells, CAPN1 expression was downregulated by lyaloside but not by 5(S)-5-carbomethoxystrictosidine, and MMP9 expression was downregulated by both compounds. These results provide evidence that the anticancer activity of MIAs is mediated by effects on CAPN1 and MMP9 expression (Fig. 5D-F).

Fig. 5.

Fig. 5

Open in a new tab

Lyaloside and 5(S)-5-carbomethoxystrictosidine suppress the expression of cell motility–related genes. We used pathway-focused gene expression profiling in AGS cells to investigate the signaling pathways through which the compounds affect cell motility using a human cell motility RT2 Profiler PCR array. Cells were treated with 2.5 µM lyaloside and 5(S)-5-carbomethoxystrictosidine for 48 hours. Cells were then harvested, and the total RNA was extracted and converted to cDNA. (A) The hierarchical clustering of gene signatures was determined using the results from the RT2 Profiler PCR array. The treatment groups were DMSO, lyaloside (1), and 5(S)-5-carbomethoxystrictosidine (2). (B-C) A scatter-plot comparison of genes from the PCR array between the DMSO-lyaloside (1)- and 5(S)-5-carbomethoxystrictosidine (2)-treated groups. (D-F) Quantitative analysis of mRNA expression levels of CAPN1 and MMP9 in AGS, CaCo2, and H1975 cells. (G-I) Relative activities of promoters related to AP-1, STAT, and NF-kB signaling pathways. HEK293T cells were cotransfected with the pRL-TK (Renilla) plasmid and the AP-1-luc (g), STAT-luc (h), and NF-kβ-luc (i) reporter plasmids (firefly). After 24 hours, transfected cells were treated with 1 or 2.5 µM lyaloside (1) and 5(S)-5-carbomethoxystrictosidine (2) or DMSO and incubated for 24 hours. The relative firefly luciferase activity of treated vs control groups is shown. Data are represented as the mean ± SD. *P < .05; **P < .01; ***P < .001. (J) AGS cells were treated with EGF (40 ng/mL) or TGF-β (10 ng/mL) together with lyaloside and 5(S)-5-carbomethoxystrictosidine for 48 hours, then cells were harvested and lyzed. Western blot analysis was conducted for the indicated marker. β-actin served as a loading control. The relative protein levels were given under the bands. (K) A schematic representation of the proposed mechanism of action of lyaloside and 5(S)-5-carbomethoxystrictosidine. Both compounds inhibit multiple signaling pathways to inhibit CAPN1 and MMP9 expression and suppress cancer cell motility. AP-1, activator protein-1; NF-kB, nuclear factor-κB; STAT, signal transducer and activator of transcription.

CAPN1 promotes the development of cancer (Chen et al., 2020). The family of calcium-dependent intracellular cysteine proteases, which includes CAPN1, is widely expressed in vivo. Calpains are involved in protein degradation, and are essential for cell growth, cytoskeleton remodeling, apoptosis, cell-cycle control, glucose transport, and signal transduction (Miller et al., 2013, Ono et al., 2016, Tadic et al., 2017). Recent reports suggest that CAPN1 is an important therapeutic target to improve sensitivity to EGFR tyrosine kinase inhibitors (Chen et al., 2020; Ono et al., 2016). On the other hand, EGFR signaling has an important role in the regulation and activation of MMPs. As initiators of pathogenic EMT, MMPs are involved in cancer progression, including metastasis (Anand et al., 2011, Chatterjee et al., 2018, Przybylo and Radisky, 2007a). However, studies have revealed that MMPs play a key role in EGFR activation, regulating EMT-related downstream signaling (Roelle et al., 2003, Tan et al., 2005). EGFR, a transmembrane glycoprotein, has tyrosine kinase activity, activating cellular signaling pathways, including PI3K/Akt, RAS/Raf/ERK/JNK, and signal transducer and activator of transcription (STAT) to create a malignant phenotype (Chen et al., 2020). Based on this information, we tested the effects of lyaloside and 5(S)-5-carbomethoxystrictosidine on several signaling pathways. We first examined activator protein-1 (AP-1), STAT, and nuclear factor-κB (NF-kB) promoter activities. Lyaloside and 5(S)-5-carbomethoxystrictosidine treatment suppressed AP-1 and STAT promoter activity but did not suppress NF-kB activity (Fig. 5G-I). MMP9 expression is regulated by many transcriptional factors; the promoter region of the MMP9 gene contains AP-1 and NF-kB-binding sites (Want et al., 2018). Our reporter assay results show both lyaloside and 5(S)-5-carbomethoxystrictosidine can regulate MMP9 expression independently of NF-kB. For further investigation, we used Western blotting assays to determine the protein levels on AGS cells stimulated with EGF and TGF-β. EGF (40 ng/mL) treatment upregulated p-EGFR, p-JNK, p-Akt, and β-catenin protein expression. Lyaloside tended to inhibit EGF-mediated increases in the expression of these markers, and 5(S)-5-carbomethoxystrictosidine markedly inhibited EGF-mediated increases in marker expression (Fig. 5J).

A study on breast cancer reported that inhibition of MMP9 attenuates cancer progression and promotes CD8+ T-cell infiltration and activation (Owyong et al., 2019). In addition, MMP expression is increased in inflamed human tissues, particularly the expression of gelatinases MMP2 and MMP9 (Taş et al., 2019). Another study reported a correlation between MMP9 and PD-L1/2 expression in primary tongue squamous cell carcinoma (Furukawa et al., 2021). These studies indicate that the expression of MMP9 is associated with the immune response, and our findings are in agreement with this notion; we showed that lyaloside and 5(S)-5-carbomethoxystrictosidine altered levels of PD-L1, an immune checkpoint that is important in immune evasion. Lyaloside and 5(S)-5-carbomethoxystrictosidine downregulated EGF- and TGF-β-induced PD-L1 levels, and 5(S)-5-carbomethoxystrictosidine potently suppressed PD-L1 protein levels. Moreover, TGF-β/Smad signaling promotes the induction of MMP9 expression (Hsieh et al., 2010).

Current antimetastatic drugs targeting processes such as cell motility and cell-environment interactions (EMT progress), angiogenesis (VEGF), MMPs, immune checkpoints (PD-1/PD-L1), and receptor tyrosine kinases (EGFR, HER4, TGF-β, BRAF, ALK, etc.), mutated genes (BRCA1/BRCA2, KRAS, and TP53) among others, with the hope that invasive and disseminative properties of tumor cells may be blocked (Gamage et al., 2024, Varlı et al., 2023, Varlı et al., 2024, Wang and Huang, 2017). The results obtained in this work contribute significantly to the continuous efforts in antimetastatic drug development. Our findings support one of the promising classes of drugs, which include inhibitors of MMP that prevent metastatic disease dissemination, by showing the potential of MIAs. More specifically, these data suggest that targeting more specifically, MMP9-targeted therapy may be most effective in tumor subpopulations with high expression levels of the MMP9. Overall, this may provide new opportunities to identify new targets for therapy and combination therapies directed against distinct molecular profiles of metastatic diseases.

MIAs are potential antimetastasis agents with drug-like and favorable ADME properties. MIAs regulate cell motility, EMT processes, and cancer cell signaling by targeting MMP9. Our study provides important findings for the development of new therapeutic strategies targeting MMP9, which is overexpressed in various types of cancer and is associated with poor clinical outcomes.

Author Contributions

Mücahit Varlı: Writing—original draft, investigation, and conceptualization. Kyungha Lee: Resources. Kyo Bin Kang: Resources. Hangun Kim: Writing—review and editing, supervision, and conceptualization.

Declaration of Competing Interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This work was supported by the National Research Foundation of Korea grant (RS-2024-00413760) funded by the Korean Government (MSIT).

Footnotes

Appendix A

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.mocell.2024.100143.

Contributor Information

Mücahit Varlı, Email: mucahitvarli@s.scnu.ac.kr.

Kyungha Lee, Email: khlee21@sookmyung.ac.kr.

Kyo Bin Kang, Email: kbkang@sookmyung.ac.kr.

Hangun Kim, Email: hangunkim@sunchon.ac.kr.

ORCID

Mücahit Varlı: https://orcid.org/0000-0001-6175-4015

Hangun Kim: https://orcid.org/0000-0001-5889-8907

Appendix A. Supplementary material

Supplementary material

mmc1.docx (895.5KB, docx)

.

References

  1. Afza N., Fatma S., Ghous F., Shukla S., Rai S., Srivastava K., Bishnoi A. An efficient multicomponent synthesis, characterization, SAR, In-silico ADME prediction and molecular docking studies of 2-Amino-7-(substituted-phenyl)-3-cyano-4-phenyl-4,5,6,7-tetrahydropyrano[2,3-b] pyrrole-5-carboxylic acid derivatives and their in-vitro antimicrobial activity. J. Mol. Struct. 2023;1276 doi: 10.1016/J.MOLSTRUC.2022.134721. [DOI] [Google Scholar]
  2. Agraval H., Yadav U.C.S. MMP-2 and MMP-9 mediate cigarette smoke extract-induced epithelial-mesenchymal transition in airway epithelial cells via EGFR/Akt/GSK3β/β-catenin pathway: amelioration by fisetin. Chem.-biol. interact. 2019;314:108846. doi: 10.1016/j.cbi.2019.108846. [DOI] [PubMed] [Google Scholar]
  3. Anand M., Van Meter T.E., Fillmore H.L. Epidermal growth factor induces matrix metalloproteinase-1 (MMP-1) expression and invasion in glioma cell lines via the MAPK pathway. J. Neuro-Oncol. 2011;104(3):679–687. doi: 10.1007/S11060-011-0549-X/FIGURES/6. [DOI] [PubMed] [Google Scholar]
  4. Bouzina A., Bouone Y.O., Sekiou O., Aissaoui M., Ouk T.-S., Djemel A., Mansouri R., Ibrahim-Ouali M., Bouslama Z., Aouf N.E. In vitro antitumor activity, molecular dynamics simulation, DFT study, ADME prediction, and Eg5 binding of enastron analogues. RSC Adv. 2023;13(28):19567–19584. doi: 10.1039/D3RA02904B. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chatterjee K., Jana S., DasMahapatra P., Swarnakar S. EGFR-mediated matrix metalloproteinase-7 up-regulation promotes epithelial-mesenchymal transition via ERK1-AP1 axis during ovarian endometriosis progression. FASEB J. 2018;32(8):4560–4572. doi: 10.1096/FJ.201701382RR. [DOI] [PubMed] [Google Scholar]
  6. Chen J., Liu X., Jiao H., Peng L., Huo Z., Yang W., Shen Q., Li T., Liu Q. Prognostic and clinical significance of STAT3 and MMP9 in patients with gastric cancer: a meta-analysis of a Chinese cohort. Int. J. Clin. Exp. Med. 2015;8(1):546. /pmc/articles/PMC4358484/ [PMC free article] [PubMed] [Google Scholar]
  7. Chen Y., Tang J., Lu T., Liu F. CAPN1 promotes malignant behavior and erlotinib resistance mediated by phosphorylation of c-Met and PIK3R2 via degrading PTPN1 in lung adenocarcinoma. Thorac. Cancer. 2020;11(7):1848–1860. doi: 10.1111/1759-7714.13465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Daina A., Michielin O., Zoete V. ILOGP: A simple, robust, and efficient description of n-octanol/water partition coefficient for drug design using the GB/SA approach. J. Chem. Inform. Model. 2014;54(12):3284–3301. doi: 10.1021/CI500467K. [DOI] [PubMed] [Google Scholar]
  9. Daina A., Michielin O., Zoete V. SwissADME: a free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules. Sci. Rep. 2017;7(1):1–13. doi: 10.1038/srep42717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Daina A., Michielin O., Zoete V. SwissTargetPrediction: updated data and new features for efficient prediction of protein targets of small molecules. Nucleic Acids Res. 2019;47(W1):W357–W364. doi: 10.1093/NAR/GKZ382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Daina A., Zoete V. A BOILED-egg to predict gastrointestinal absorption and brain penetration of small molecules. ChemMedChem. 2016;11(11):1117–1121. doi: 10.1002/CMDC.201600182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Du K., Liang Y., Song Z., Zheng C., Lai L., Zong K., Wang Y., Meng D. Monoterpenoid indole alkaloids from Melodinus axillaris W.T.Wang exhibit anti-inflammatory activities by inhibiting the NF-κB signaling pathways. J. Ethnopharmacol. 2024;324 doi: 10.1016/J.JEP.2024.117771. [DOI] [PubMed] [Google Scholar]
  13. Feick D., Rüdesheim S., Marok F.Z., Selzer D., Loer H.L.H., Teutonico D., Frechen S., van der Lee M., Moes D.J.A.R., Swen J.J., et al. Physiologically-based pharmacokinetic modeling of quinidine to establish a CYP3A4, P-gp, and CYP2D6 drug–drug–gene interaction network. CPT Pharmacometr. Syst. Pharmacol. 2023;(1):1–14. doi: 10.1002/PSP4.12981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Furukawa K., Kawasaki G., Yoshida T., Umeda M. Clinicopathological and prognostic analysis of PD-L1 and PD-L2 expression in surgically resected primary tongue squamous cell carcinoma. Anticancer Res. 2021;41(1):101–111. doi: 10.21873/ANTICANRES.14755. [DOI] [PubMed] [Google Scholar]
  15. Gamage C.D.B., Kim J.-H., Zhou R., Park S.-Y., Pulat S., Varlı M., Nam S.-J., Kim H. Plectalibertellenone A suppresses colorectal cancer cell motility and glucose metabolism by targeting TGF-β/Smad and Wnt pathways. BioFactors. 2024 doi: 10.1002/BIOF.2120. Epub ahead of print. [DOI] [PubMed] [Google Scholar]
  16. Gfeller D., Michielin O., Zoete V. Shaping the interaction landscape of bioactive molecules. Bioinformatics. 2013;29(23):3073–3079. doi: 10.1093/BIOINFORMATICS/BTT540. [DOI] [PubMed] [Google Scholar]
  17. Gialeli C., Theocharis A.D., Karamanos N.K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 2011;278(1):16–27. doi: 10.1111/J.1742-4658.2010.07919.X. [DOI] [PubMed] [Google Scholar]
  18. Gonçalves B.M.F., Duarte N., Ramalhete C., Barbosa F., Madureira A.M., Ferreira M.J.U. Monoterpene indole alkaloids with anticancer activity from Tabernaemontana species. Phytochem. Rev. 2024:1–37. doi: 10.1007/S11101-024-09964-6. [DOI] [Google Scholar]
  19. Guan H., Guo Y., Liu L., Ye R., Liang W., Li H., Xiao H., Li Y. INAVA promotes aggressiveness of papillary thyroid cancer by upregulating MMP9 expression. Cell Biosci. 2018;8(8):26. doi: 10.1186/s13578-018-0224-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hanahan D., Weinberg R.A. Hallmarks of cancer: the next generation. Cell. 2011;144(5):646–674. doi: 10.1016/J.CELL.2011.02.013. [DOI] [PubMed] [Google Scholar]
  21. Hitchcock S.A., Pennington L.D. Structure-brain exposure relationships. J. Med. Chem. 2006;49(26):7559–7583. doi: 10.1021/JM060642I. [DOI] [PubMed] [Google Scholar]
  22. Hsieh H.L., Wang H.H., Wu W.B., Chu P.J., Yang C.M. Transforming growth factor-β1 induces matrix metalloproteinase-9 and cell migration in astrocytes: Roles of ROS-dependent ERK- and JNK-NF-κB pathways. J. Neuroinflamm. 2010;7(1):1–17. doi: 10.1186/1742-2094-7-88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kessenbrock K., Plaks V., Werb Z. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell. 2010;141(1):52–67. doi: 10.1016/J.CELL.2010.03.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lambert A.W., Pattabiraman D.R., Weinberg R.A. Emerging biological principles of metastasis. Cell. 2017;168(4):670–691. doi: 10.1016/J.CELL.2016.11.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li W., Zhang X., Wu F., Zhou Y., Bao Z., Li H., Zheng P., Zhao S. Gastric cancer-derived mesenchymal stromal cells trigger M2 macrophage polarization that promotes metastasis and EMT in gastric cancer. Cell Death Dis. 2019;10(12):1–16. doi: 10.1038/s41419-019-2131-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu Y., Grimm M., Dai W.T., Hou M.C., Xiao Z.X., Cao Y. CB-Dock: a web server for cavity detection-guided protein–ligand blind docking. Acta Pharmacol. Sin. 2020;41(1):138–144. doi: 10.1038/s41401-019-0228-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Loboda A., Nebozhyn M.V., Watters J.W., Buser C.A., Shaw P.M., Huang P.S., Van’T Veer L., Tollenaar R.A., Jackson D.B., Agrawal D., et al. EMT is the dominant program in human colon cancer. BMC Med. Genom. 2011;4(1):1–10. doi: 10.1186/1755-8794-4-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Miller D.J., Adams S.E., Hallett M.B., Allemann R.K. Calpain-1 inhibitors for selective treatment of rheumatoid arthritis: what is the future? Future Med. Chem. 2013;5(17):2057–2074. doi: 10.4155/FMC.13.172. [DOI] [PubMed] [Google Scholar]
  29. Mohammed A.E., Abdul-Hameed Z.H., Alotaibi M.O., Bawakid N.O., Sobahi T.R., Abdel-Lateff A., Alarif W.M. Chemical diversity and bioactivities of monoterpene indole alkaloids (MIAs) from six apocynaceae genera. Molecules. 2021;26(2):488. doi: 10.3390/MOLECULES26020488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nagathihalli N.S., Massion P.P., Gonzalez A.L., Lu P., Datta P.K. Smoking induces epithelial-to-mesenchymal transition in non-small cell lung cancer through HDAC-mediated downregulation of E-cadherin. Mol. Cancer Ther. 2012;11(11):2362–2372. doi: 10.1158/1535-7163.MCT-12-0107/84672/AM/SMOKING-INDUCES-EPITHELIAL-TO-MESENCHYMAL. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nam M.W., Kim C.W., Choi K.C. Epithelial-mesenchymal transition-inducing factors involved in the progression of lung cancers. Biomol. Ther. 2022;30(3):213. doi: 10.4062/BIOMOLTHER.2021.178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ono Y., Saido T.C., Sorimachi H. Calpain research for drug discovery: challenges and potential. Nat. Rev. Drug Disco. 2016;15(12):854–876. doi: 10.1038/nrd.2016.212. [DOI] [PubMed] [Google Scholar]
  33. Owyong M., Chou J., van den Bijgaart R.J.E., Kong N., Efe G., Maynard C., Talmi-Frank D., Solomonov I., Koopman C., Hadler-Olsen E., et al. MMP9 modulates the metastatic cascade and immune landscape for breast cancer anti-metastatic therapy. Life Sci. Alliance. 2019;2(6) doi: 10.26508/LSA.201800226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pajouhesh H., Lenz G.R. Medicinal chemical properties of successful central nervous system drugs. NeuroRx. 2005;2(4):541. doi: 10.1602/NEURORX.2.4.541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Przybylo J.A., Radisky D.C. Matrix metalloproteinase-induced epithelial-mesenchymal transition: tumor progression at Snail’s pace. Int. J. Biochem. Cell Biol. 2007;39:1082–1088. doi: 10.1016/j.biocel.2007.03.002. [DOI] [PubMed] [Google Scholar]
  36. Rashid Z.A., Bardaweel S.K. Novel matrix metalloproteinase-9 (MMP-9) inhibitors in cancer treatment. Int. J. Mol. Sci. 2023;24(15):12133. doi: 10.3390/IJMS241512133/S1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Roelle S., Grosse R., Aigner A., Krell H.W., Czubayko F., Gudermann T. Matrix metalloproteinases 2 and 9 mediate epidermal growth factor receptor transactivation by gonadotropin-releasing hormone. J. Biol. Chem. 2003;278(47):47307–47318. doi: 10.1074/jbc.M304377200. [DOI] [PubMed] [Google Scholar]
  38. Shao H., Jin F., Hu J., Zhu Z., Tian F., Tao M., Teng Y. Urothelial carcinoma associated 1 promotes trophoblast invasion by regulating MMP9. Cell Biosci. 2019;9:78. doi: 10.1186/s13578-019-0341-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Soltermann A., Tischler V., Arbogast S., Braun J., Probst-Hensch N., Weder W., Moch H., Kristiansen G. Prognostic significance of epithelial-mesenchymal and mesenchymal-epithelial transition protein expression in non–small cell lung cancer. Clin. Cancer Res. 2008;14(22):7430–7437. doi: 10.1158/1078-0432.CCR-08-0935. [DOI] [PubMed] [Google Scholar]
  40. Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021;71(3):209–249. doi: 10.3322/CAAC.21660. [DOI] [PubMed] [Google Scholar]
  41. Tabti K., Ahmad I., Zafar I., Sbai A., Maghat H., Bouachrine M., Lakhlifi T. Profiling the structural determinants of pyrrolidine derivative as gelatinases (MMP-2 and MMP-9) inhibitors using in silico approaches. Comput. Biol. Chem. 2023;104:1476–9271. doi: 10.1016/j.compbiolchem.2023.107855. [DOI] [PubMed] [Google Scholar]
  42. Tadic V., Klein C., Hinrichs F., Münchau A., Lohmann K., Brüggemann N. CAPN1 mutations are associated with a syndrome of combined spasticity and ataxia. J. Neurol. 2017;264(5):1008–1010. doi: 10.1007/S00415-017-8464-5. [DOI] [PubMed] [Google Scholar]
  43. Tan X., Egami H., Abe M., Nozawa F., Hirota M., Ogawa M. Involvement of MMP-7 in invasion of pancreatic cancer cells through activation of the EGFR mediated MEK–ERK signal transduction pathway. J. Clin. Pathol. 2005;58(12):1242–1248. doi: 10.1136/JCP.2004.025338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Taş İ., Zhou R., Park S.Y., Yang Y., Gamage C.D.B., Son Y.J., Paik M.J., Kim H. Inflammatory and tumorigenic effects of environmental pollutants found in particulate matter on lung epithelial cells. Toxicol. Vitro. 2019;59:300–311. doi: 10.1016/J.TIV.2019.05.022. [DOI] [PubMed] [Google Scholar]
  45. Tzanakakis G., Kavasi R.M., Voudouri K., Berdiaki A., Spyridaki I., Tsatsakis A., Nikitovic D. Role of the extracellular matrix in cancer-associated epithelial to mesenchymal transition phenomenon. Dev. Dyn. 2018;247(3):368–381. doi: 10.1002/DVDY.24557. [DOI] [PubMed] [Google Scholar]
  46. Varlı M., Bhosle S.R., Kim E., Yang Y., Taş İ., Zhou R., Pulat S., Gamage C.D.B., Park S.Y., Ha H.H., et al. Usnic acid targets 14-3-3 proteins and suppresses cancer progression by blocking substrate interaction. JACS Au. 2024;4(4):1521–1537. doi: 10.1021/JACSAU.3C00774/ASSET/IMAGES/LARGE/AU3C00774_0007.JPEG. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Varlı M., Kim E., Oh S., Pulat S., Zhou R., Gamage C.D.B., Gökalsın B., Sesal N.C., Kim K.K., Paik M.J., et al. Chrysophanol inhibits of colorectal cancer cell motility and energy metabolism by targeting the KITENIN/ErbB4 oncogenic complex. Cancer Cell Int. 2024;24(1):1–17. doi: 10.1186/S12935-024-03434-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Varlı M., Ngo M.T., Kim S.M., Taş İ., Zhou R., Gamage C.D.B., Pulat S., Park S.Y., Sesal N.C., Hur J.S., et al. A fatty acid-rich fraction of an endolichenic fungus Phoma sp. suppresses immune checkpoint markers via AhR/ARNT and ESR1. Heliyon. 2023;9(9) doi: 10.1016/j.heliyon.2023.e19185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang C., Huang S. Focus: drug development: drug development against metastatic cancers. Yale J. Biol. Med. 2017;90(1):119. [PMC free article] [PubMed] [Google Scholar]
  50. Wu C.H., Tang S.C., Wang P.H., Lee H., Ko J.L. Nickel-induced epithelial-mesenchymal transition by reactive oxygen species generation and E-cadherin promoter hypermethylation. J. Biol. Chem. 2012;287(30):25292–25302. doi: 10.1074/jbc.M111.291195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang T., Jin X., Liao Y., Sun Q., Luo C., Wang G., Zhao F., Jin Y. Association of NF-κB and AP-1 with MMP-9 overexpression in 2-chloroethanol exposed rat astrocytes. Cells. 2018;7(8):96. doi: 10.3390/CELLS7080096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Xia, Y., Lian, S., Ngoc Khoi, P., Joong Yoon, H., Eun Joo, Y., Oh Chay, K., Keun Kim, K., and Do Jung, Y. (2015). Chrysin inhibits tumor promoter-induced MMP-9 expression by blocking AP-1 via suppression of ERK and JNK pathways in gastric cancer cells. doi:10.1371/journal.pone.0124007. [DOI] [PMC free article] [PubMed]
  53. Yang B., Tang F., Zhang B., Zhao Y., Feng J., Rao Z. Matrix metalloproteinase-9 overexpression is closely related to poor prognosis in patients with colon cancer. World J. Surg. Oncol. 2014;12(1):1–6. doi: 10.1186/1477-7819-12-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhang H., Liu H., Borok Z., Davies K.J. A., Ursini F., Forman H.J. Cigarette smoke extract stimulates epithelial-mesenchymal transition through Src activation. Free Radic Biol Med. 2012;52(8):1437–1442. doi: 10.1016/j.freeradbiomed.2012.01.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zhang H., Zhao B., Zhai Z.G., Zheng J.D., Wang Y.K., Zhao Y.Y. Expression and clinical significance of MMP-9 and P53 in lung cancer. Eur. Rev. Med. Pharmacol. Sci. 2021;25(3):1358–1365. doi: 10.26355/EURREV_202102_24844. [DOI] [PubMed] [Google Scholar]
  56. Zhang J., Han X., Shi H., Gao Y., Qiao X., Li H., Wei M., Zeng X. Lung resided monocytic myeloid-derived suppressor cells contribute to premetastatic niche formation by enhancing MMP-9 expression. Mol. Cell. Probes. 2020;50 doi: 10.1016/J.MCP.2019.101498. [DOI] [PubMed] [Google Scholar]
  57. Zhang N., Ng A.S., Cai S., Li Q., Yang L., Kerr D. Novel therapeutic strategies: targeting epithelial–mesenchymal transition in colorectal cancer. Lancet Oncol. 2021;22(8):e358–e368. doi: 10.1016/S1470-2045(21)00343-0. [DOI] [PubMed] [Google Scholar]
  58. Zhao M., Ma J., Li M., Zhang Y., Jiang B., Zhao X., Huai C., Shen L., Zhang N., He L., et al. Cytochrome p450 enzymes and drug metabolism in humans. Int. J. Mol. Sci. 2021;22(23):12808. doi: 10.3390/IJMS222312808/S1. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material

mmc1.docx (895.5KB, docx)

Articles from Molecules and Cells are provided here courtesy of Korean Society for Molecular and Cellular Biology

RESOURCES