Summary
The eruption of Somma-Vesuvius in 79 CE buried several nearby Roman towns, killing the inhabitants and burying under pumice lapilli and ash deposits a unique set of civil and private buildings, monuments, sculptures, paintings, and mosaics that provide a rich picture of life in the empire. The eruption also preserved the forms of many of the dying as the ash compacted around their bodies. While the soft tissue decayed, the outlines of the bodies remained and were recovered by excavators centuries later by filling the cavities with plaster. From skeletal material embedded in the casts, we generated genome-wide ancient DNA and strontium isotopic data to characterize the genetic relationships, sex, ancestry and mobility of five individuals. We show that the individuals’ sexes and family relationships do not match traditional interpretations, exemplifying how modern assumptions about gendered behaviors may not be reliable lenses through which to view data from the past. For example, an adult wearing a golden bracelet with a child on their lap–often interpreted as mother and child–is genetically an adult male biologically unrelated to the child. Similarly, a pair of individuals who were thought to have died in an embrace–often interpreted as sisters–included at least one genetic male. All Pompeiians with genome-wide data consistently derive their ancestry largely from recent immigrants from the eastern Mediterranean, as has also been seen in contemporaneous ancient genomes from the city of Rome, underscoring the cosmopolitanism of the Roman Empire in this period.
Keywords: ancient DNA, bioarchaeology, Roman Empire, strontium
Introduction
Pompeii was a Roman town located in Campania, Italy, 14 miles southeast of Naples. It was destroyed by the 79 CE Plinian eruption of Somma-Vesuvius, also known as the “Pompeii eruption”. The city was buried under a pumice lapilli deposit, laid down during the early phase of the eruption, followed by ash deposits from pyroclastic currents during a later phase. The town remained largely forgotten until its rediscovery in the late 1700s. Its unique preservation and the insight it provides into daily life in the Roman Empire has led to Pompeii becoming one of the world’s best-known archaeological sites and being designated as a UNESCO World Heritage Site.
The earliest stable settlements in the Gulf of Naples in the Iron Age date to the 8th century BCE, when the Osci built houses near the estuary of the river Sarno on a small hill, representing the remnants of multiple local volcanic vents, rising on the surrounding Sarno plain1. Due to its strategic location, Pompeii became an important road and port node. The Greeks, Etruscans, and Samnites all attempted to conquer Pompeii, and it eventually became a Roman colony.
The 79 CE eruption completely destroyed Pompeii, but the pyroclastic deposits that blanketed the city preserved its buildings, streets, and artifacts. Many bodies were also preserved, as were the art, jewelry, book rolls, and other cultural remnants of the inhabitants. During the excavations which began in 1748, numerous victims, both isolated and grouped, were found in the houses and in squares, gardens, and streets just outside the city walls2–5. In the 19th century, archaeologist Giuseppe Fiorelli developed a method of making casts by pouring liquid plaster into the voids left by decay of the victims’ soft tissue. Since then, over 1000 human victims have been discovered among the city’s ruins, and 104 plaster casts preserving the victims’ shapes and encasing their bones have been produced using Fiorelli’s method. In 2015, during restoration of 86 casts, an effort to CT scan or X-ray 26 of them revealed that none contained complete skeletons. The casts had been considerably manipulated and likely creatively restored in the past, with stylistic variations between casts in part reflecting aesthetic preferences of the periods in which they were made6. Popular interpretations of the identity of the victims in Pompeii therefore are influenced not only by the archaeologists first describing them, but also by the restorers who chose to enhance or alter some features of the bodies’ shapes. The imaging results revealed in some cases the introduction of stabilizing elements like metal rods, as well as the frequent removal of bones prior to the casting process, complicating the sex determination on an osteological basis. It was possible to reinterpret some casts such as the formerly imagined distended abdomen of a putative pregnant woman likely being formed by bunched up garments.
Multiple studies have confirmed the possibility of retrieving DNA data from both human and animal remains in Pompeii7–17. Recently, genetic data from human skeletal remains found in the Casa del Fabbro18 showed that this individual’s genetic ancestry fell within the genetic diversity observed in the Imperial Roman Latium (modern Lazio) region which had more Eastern Mediterranean influence compared to the preceding Iron Age19. As a port, Pompeii is typically viewed as a city with a diverse and mobile population. Bioarcheological analysis, however, revealed high frequencies of non-metric traits that may indicate genetic homogeneity or common environmental influences5. Ancient DNA and strontium isotopes offer the possibility of obtaining a better understanding of the diversity and origins of Pompeii’s residents.
We attempted to extract genetic information from the human plaster casts, using enrichment of ancient DNA extracts for mitochondrial DNA and more than a million single nucleotide polymorphism (SNP) targets20. The study was carried out on highly fragmented skeletal remains mixed with plaster recovered from different anatomical elements of 14 of the 86 casts undergoing restoration. Figure S1 presents a map showing where the 14 victims were found, and the casts made. Our goal was to test interpretations suggested in the absence of genetic data about the identity of the victims and their relations to each other, based on the shape and position of the bodies, and to enhance the information on osteological data previously obtained by X-ray and CT imaging of the mostly incomplete skeletons in the casts6. Such inferences have shaped how historians, archaeologists and the public imagine the society recorded so vividly by the catastrophe. In addition, we investigated the victims’ genetic ancestry and compared it with the known genetic diversity from contemporaneous individuals from the city of Rome and its hinterland.
Results and Discussion
DNA preservation and uniparentally inherited markers
In the following, we describe the individuals using the Cast Numbers21 which are commonly used in the bioarchaeological literature about the site. The corresponding Genetic IDs can be found in Table 1 and DataS1 A. We took samples of bone fragments mixed with plaster from 14 different casts (Table S1 and Figure S1) and screened them by quantifying the concentration and degradation of the DNA (Table S2), as well as using a hybridization-based approach to enrich for the mitochondrial DNA22 and 3,000 autosomal SNPs23 (Tables S3 and S4). On the basis of the screening results, we chose to enrich seven partially UDG-treated libraries for around 1.2 million nuclear SNPs (‘1240K’ SNP set) (DataS1 A). Additionally, we radiocarbon-dated four of the selected individuals (DataS1 B).
Table 1.
Summary of genetic results.
| Cast Number | Genetic ID | Discovery Place | SNPs of 1240K set covered | Average coverage on 1240K SNP set | Genetic sex | Quantifiler TRIO Y target | Y Haplogroup | mtDNA Haplogroup | C-to-T at 5’-end (non-UDG library) | C-to-T at 5’-end (UDG library) | ANGSD X-chromosomal contamination estimate: Number of SNPs | ANGSD X-chromosomal contamination estimate: Mean | ANGSD X-chromosomal contamination estimate: C.I. |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 22 | I3690 | House of the Cryptoporticus | 93,727 | 0.09 | M | M | J2b2a1 | N1b1a1 | 0.3 | 0.09 | 19 | n/a | n/a |
| 25 | I3682 | Villa of Mysteries | 53,739 | 0.047 | M | n/a* | E1b1b1b1b | H | n/a | 0.1 | 0 | n/a | n/a |
| 50 | I3683 | House of the Golden Bracelet | n/a | n/a | n/a | M | n/a | H1h1 | 0.23 | n/a | n/a | n/a | n/a |
| 51 | I3686 | House of the Golden Bracelet | 62,030 | 0.054 | M | M | J2a1a4b | T2c1c | 0.15 | 0.04 | 4 | n/a | n/a |
| 52 | I3685 | House of the Golden Bracelet | 364,533 | 0.437 | M | M | T1a1a1b2b2b1a | U1a1 | 0.2 | 0.02 | 350 | 0.0187 | 0–0.039 |
| 53 | I3691 | House of the Golden Bracelet | 286,023 | 0.309 | M | M | E1b1b | H | 0.24 | 0.04 | 208 | 0.0086 | 0–0.026 |
quantification not performed
Five samples provided complete or partial mitochondrial genomes with patterns of base misincorporations at the read ends typical of ancient DNA (Table S3), and were covered on at least 50,000 of the targeted autosomal SNPs, with median coverage on the 1240K SNPs ranging from 0.006 X to 0.437 X (Table 1, DataS1 A). All five individuals (Figure 1) were genetically sexed as male as assessed by DNA quantification using the Quantifiler™ Trio Kit (STAR Methods). We also estimated contamination on the X chromosome for the two individuals for which there was sufficient data to make this quantification, and found it was below 4%. In the other cases the molecular damage pattern and contamination estimates provided by mitochondrial data (Table 1, Table S3, DataS1 A) indicate that the results are compatible with authentic ancient DNA originating from a single individual. All individuals were determined to belong to Y-chromosomal lineages (J2a, J2b, E1b and T1a) that first emerged in Western Asia and are today still found in the highest frequencies in Western and Central Asia, Southern Europe and North Africa20,24–27 (DataS1 C). None of the individuals had evidence of relatedness up to the third degree (DataS1 D).
Figure 1. Pompeii plaster casts and their original locations in Pompeii.

Plaster casts of individuals from whom analyzable ancient DNA was recovered and original map of Pompeii. See also Figure S1 and Table S1.
The plaster cast individuals represent an ancestrally diverse population
We find that the five individuals are shifted away from modern-day Italians as well as Italian populations from the Iron Age and Late Iron Age and Imperial Period Etruscans on a Principal Component Analysis (PCA) constructed on modern-day West Eurasian and North African populations and world-wide populations. Instead, they cluster more with eastern Mediterranean, Levantine and North African Jewish populations (Figures 2A and B). This pattern is similar to the one found for the Imperial Roman population of Central Italy19 and the previously published single individual from Pompei with genome-wide data, which we co-plotted with the five individuals with newly generated data18. In an unsupervised ADMIXTURE analysis at k=6 (Figure 2C, Figures S2 and S3), the Pompeian individuals differ from the roughly contemporaneous individuals associated with the Etruscan culture in their proportions of the ancestry components maximized in Mesolithic European hunter-gatherers (lower in the Pompeiians) as well as hunter-gatherers from the Caucasus (higher in the Pompeiians), making their ancestry composition more similar to the Central Italian Imperial Romans as well as contemporaneous individuals from the Aegean and Anatolia. Individual 52 shows an ancestry composition comparable to Iron Age and Roman period Levantine individuals, characterized by a minor component maximized in modern-day Sub-Saharan African populations and an absence of the component maximized in European hunter-gatherers. This individual most closely clusters with Levantine populations.
Figure 2. Principal components analysis and ADMIXTURE analysis.

PC1 and PC2 were constructed on Human Origins genotyping data of modern-day West Eurasian and North African individuals (A) and a world-wide set of modern-day individuals (B). Ancient individuals covered on at least 20,000 SNPs genotyped on the Affymetrix Human Origins array were projected onto them. Gray dots represent modern-day individuals, colored circles represent published individuals dated to between the 4th century BCE and the 2nd century CE, unfilled diamonds represent contemporaneous individuals from Etruscan cultural context in Northern and Central Italy, black symbols represent individuals from the context of the 79 CE Vesuvius eruption. (C) Results of unsupervised ADMIXTURE analysis, showing k=6 for Pompeian individuals and published ancient individuals (HG=Hunter-Gatherer). Full results for k=2 to k=15 shown in Figures S2 and S3.
To quantify the contribution of different ancestry sources, we tested various 2- and 3-way models using qpAdm and report the working models using the least number of sources with P>0.01 and coefficients below 1 (DataS2 A and B). Using a distal set of putative ancestral populations, we found working models for all individuals (Figure 3). For each individual from the casts, ancestry related to Anatolia Neolithic farmers (TUR_Marmara_Barcin_N) and/or Levantine Pre-Pottery Neolithic farmers (Levant_PPN) compose the largest inferred proportion (48–75%), while the second largest proportion is inferred to derive from people related to Neolithic farmers from Iran (IRN_Ganj-Dareh_N) (26–45%), with exception of individual 25 who can be modeled as deriving 65.3 ± 4.5% of his ancestry from Levantine Pre-Pottery Neolithic farmers (Levant_PPN) and 34.7 ± 4.5% from Bronze Age steppe pastoralists (Steppe_EMBA), an ancestry source required by none of the other individuals. This model indicates, despite the low coverage of the individual’s genome, a different ancestry history involving European sources that did not contribute to the other individuals.
Figure 3. Distal qpAdm models.

Working qpAdm models using distal ancestry sources with p>0.01. See also DataS2 A and B.
Individuals 22 and 51 can be described as comprised of around 62–69% Anatolia Neolithic farmers (TUR_Marmara_Barcin_N) and 31–38% Neolithic farmers from Iran (IRN_Ganj-Dareh_N) ancestry. Individual 52 is inferred to have no Anatolia Neolithic farmer (TUR_Marmara_Barcin_N) ancestry. Instead, he can be modeled as deriving 57.7 ± 3.1% and 42.3 ± 3.1% of his ancestry from Levantine Pre-Pottery Neolithic farmers (Levant_PPN) and Neolithic farmers from Iran (IRN_Ganj-Dareh_N), respectively. This result corroborates the closer clustering of this individual with contemporaneous Levantine individuals in PCA and ADMIXTURE analysis (Figure 3) and suggests a recent Levantine origin for him or his direct ancestors. Two alternative 3-way models are not rejected for individual 53. In both the largest proportion of ancestry is accounted for by the combination of components derived from Neolithic farmers from Iran (IRN_Ganj-Dareh_N) and Anatolia Neolithic farmers (TUR_Marmara_Barcin_N) – 69–88% and 84–97%, respectively. The third component is derived either from Neolithic farmers from the Levant (Levant_PPN) with 21.2 ± 7.1%, or Chalcolithic individuals with North African ancestry (Mediterranean_CA_NorthAfrican), with 9.8 ± 2.8%.
We also tested the individuals as potentially derived from more proximal sources consisting of late 2nd BCE to early 1st millennium CE individuals from different West Eurasian and North African regions that, within their grouping, are relatively genetically homogeneous according to the PCA (DataS2 C and D). The working models (P>0.01), largely require Eastern Mediterranean, Levantine or North African populations as the main source (DataS2 C). Models with ancestry indistinguishable from one of the sources Turkey_West and Turkey Central work for Individual 22 and Individual 51. Working 2-way models for individual 25 involve an eastern Mediterranean source which contributed the majority of ancestry in combination with a Balkan, Central Mediterranean or Central European source. Similarly, Individual 53 can only be fit as a mixture of ancestry sources, with three tested models, ~80% Turkey_Central with 20% Sardinia_Punic, ~67% Turkey_East with ~33% Sardinia_Punic and ~80% Lebanon with ~20% Italy_IA (Iron Age individuals from the Italian peninsula) all fitting the data. No working 1- or 2-way model was found for individual 52, but the feasible models with the highest P-values (between 1.64E-3 and 2.321E-6) all contain Egypt as the source contributing the majority of the ancestry (~51–73%), suggesting the actual source is genetically similar to the one represented by the Hellenistic Egyptian individuals (DataS2 D). The previously published Individual f1R requires for all working models about 73–84% from the Lebanon source, in combination with a European source.
Demographic and phenotypic characteristics
Only individual 52 provided enough genetic data to detect runs-of-homozygosity (ROH), which can give insight into effective populations size and marriage practices28. Only a single short ROH of 4.71 cM was found in this individual (Figure S4), inconsistent with closely related parents or a small population of origin in which individuals share marked background relatedness. Overall, the genetic heterogeneity seen in the sample of genomes from Pompeii and the absence of long ROH in one individual are consistent with a large, diverse population, as is suggested by its role as a river port and its description as being composed of various local and immigrant cultural groups by ancient authors5. This provides some support for the hypothesis that the high frequencies of some non-metric traits observed among the 79 CE eruption victims could be due to shared environmental variables during developmental stages, rather than a common genetic background. However, among the individuals we studied genetically, only individual 22 exhibited such common non-metric traits, specifically the presence of relatively large ossicles at lambda and Wormian bones in the lambdoid suture5. Targeted genetic analyses of individuals with and without such traits might reveal a level of homogeneity in ancestry among the former.
Phenotypic markers for externally visible characteristics, assessed with the HIrisPlex-S system29, suggest highest probabilities for brown eyes for individuals 25, 51 and 53, and dark skin and black hair for individual 52 (DataS3 A). Several risk alleles associated with different diseases were detected in all the samples analysed but the low coverage and possible interaction between genotype and environment did not allow us to predict any of these traits with certainty (DataS3 B–G).
Combined genetic and osteological findings contradict some of the established popular narratives
Scholars as well as the public’s imagination have interpreted the impressions of body position and shape in the plaster casts in diverse ways, speculating about the identities of the victims and their potential connections to each other. When the restoration and the study of the casts through new scientific approaches began in 2015, there were no peer-reviewed osteological references providing sound data for an individual characterization and the only information available was that provided by the archaeologists. Nevertheless, some interpretations about sex and relationships between individuals found wide appeal with the scholars’ community and the public, being spread through museal exhibitions and educational and publicity materials. Therefore, integrating our newly reported genetic and isotopic data allows us to revisit some of the widespread interpretations.
House of the Golden Bracelet
The House of the Golden Bracelet is situated in Insula 17, Regio VI (Figure 1). The house’s innovative and complex architectural form resulted from a fusion between the Roman-Italic model of the atrium house and that of the suburban villa. Built on three levels, it utilized the city walls and the slope of the hillside. Its rooms were arranged in terraces on the three levels in a panoramic position. The house was especially rich, and colorful frescoes decorated its walls. In 1974, four victims were discovered in close vicinity to each other at the site and were interpreted as constituting a genetically related family30. The first three victims were found at the foot of the staircase that led to the garden and seafront: two adults (Individuals 50 and 52) and a young child (Individual 51), apparently standing on Individual 52’s hip. Individual 52 was traditionally interpreted as a woman and mother, due to the association with the child, and an intricate golden bracelet of exceptional weight (6.1 grams) worn on one arm, which also gave the house its name. The other adult, Individual 50, was interpreted as the father in the genetically related family group. On the basis of limited X-ray analysis, Individuals 50, 51 and 52 were estimated to be a young adult, a 5 to 6-year-old and a younger middle-aged adult, respectively, but a clear sex attribution could not be made for either of the adults or the child6. It has been suggested that these three victims sought refuge in the stairwell and were killed by the staircase that collapsed as they tried to flee their residence for the city’s port30. A few meters away, a body of a child about 4 years old was found (Individual 53), interpreted as a boy due to a bulge in the plaster in the area of the genitalia30. This child was plausibly separated from the family group during the escape along the corridor leading to the garden.
DNA quantification allowed us to estimate the molecular sex of all the individuals, while sex identification on the basis of nuclear genome analysis was only possible for three of the individuals (all but individual 50). All individuals were sexed as genetically male, including the presumed female adult (Individual 52). Furthermore, both the mitochondrial DNA and whole genome data found no evidence of biological relatedness, at least up to the third degree, between any of the individuals, falsifying the prevailing narrative of these four victims as a genetically related family. The preservation of genetic material in the adult individual 50 allowed us to reconstruct only the mitochondrial genome, showing no matrilineal relations with the other three individuals, although we cannot exclude that he could be related to them at the nuclear level. The PCA and ADMIXTURE analyses show a considerable variation in the distribution of these three individuals within the genetic diversity observed for the Italian inhabitants of Imperial Rome (Figure 2)19. The composition of genetic ancestry of the three individuals inferred by qpAdm appears distinct in both distal and proximal modeling (DataS2), which suggests their respective ancestors had origins in different Eastern Mediterranean or North African populations. Trying to reconstruct the appearance of these individuals by inferring phenotypes based on genotypes, we found that individual 52 had black hair and dark skin, while we were able to attest only the eye color for individuals 51 and 53, which was brown (DataS3 A).
House of the Cryptoporticus
The House of the Cryptoporticus is situated in Insula 6, Regio I (Figure 1). The house was originally built in the 3rd century BCE. It takes its current name from the cryptoporticus, an underground passageway with openings, running along three sides of the quadrangular south-opening garden. A living room (the oecus) and four thermal bathing rooms (apodyterium, frigidarium, tepidarium and calidarium, the latter being preceded by a praefurnium) open onto it. The cryptoporticus originally had barrel and cross vaulted ceilings and the walls of the oecus were decorated with a series of scenes inspired by the Iliad, providing one of the finest examples of Pompeian painting from the final stage of the Second style (era of Augustus). The walls of the four bathing rooms were also painted with exquisite scenic images. During the excavations in 1914, nine individuals were found in the garden in front of the house, but it was only possible to produce casts for four of them. Among these four individuals, two (Individuals 21 and 22) were found close to each other in what was interpreted as an embrace (Figure 1) and the archaeologists hypothesized that they could be two sisters, mother and daughter, or lovers21,31–34. CT scanning of skeletal elements preserved within the casts led to an age estimate of 14–19 for Individual 21 and a young adult age for Individual 22. Osteological sex estimation was not possible but the relative gracility of Individual 22’s skull was noted6. The nuclear genetic analysis was successful only for Individual 22 and revealed he was male, excluding the possibility that the pair of victims were sisters or mother and daughter. Like all the other analyzed samples, the individual falls within Mediterranean nuclear genetic variability, with an ancestral origin consistent with contemporaneous Anatolian populations (DataS2 C), and carries the mitochondrial haplogroup N1b1a1, with a presumably Near Eastern/North African origin35,36. Reconstruction of the mitochondrial genome was successful also for individual 21 (DataS1), which carries the two derived SNPs of the distinct haplogroup R and none of the derived SNPs leading to N1b1a1, which is consistent with a lack of maternal relatedness between the two individuals.
Villa of the Mysteries
This villa, which was first excavated in 1909–1910 and is still subject to minor investigations arising from protection and conservation concerns today, is located northwest of the town walls, near the ancient seashore (Figure 1). Most of its walls, ceilings, and particularly its frescoes survived the eruption of the Vesuvius largely intact. The name (Villa dei Misteri) comes from a series of frescoes dating back to the 1st century BCE, depicting a ritual probably dedicated to Bacchus, the god of wine, fertility, and religious ecstasy. The villa was very large with many different rooms and functional spaces, as was common for many Roman villas of that period. A wine press was found and restored in its original location, reflecting the fact that it was common for wealthy families to produce their own wine, olive oil, and other products since most villas included some farmland. The bodies of two adults, interpreted as women, and a child were found in the pumice lapilli deposit indicating they were caught in the early stages of the eruption on the upper floor of the farm section and fell to the lower floor. Six bodies were found in the overlaying ash deposits indicating they had survived the first phase of the eruption. Among them, Individual 25 was found alone in a room, lying atop a layer of ash, with an iron ring with an engraved carnelian of a female figurine on the little finger of the left hand, five bronze coins and a whip as personal effects37 (Figure S1). The cast of this victim shows some of the most well preserved anatomical and textile details. The man was about 1,85 m tall, thin, with a convex nasal bridge. According to the traces of his clothes and the ornaments, he was supposed to belong to a low social status and was interpreted as the custodian of the villa who had faithfully remained at his post21. Our genetic analysis confirms a male sex estimation, and mixed genetic ancestry which could possibly be traced to both Eastern Mediterranean and European sources (DataS2 C). To learn more about this individual’s geographic origin and lifetime mobility, we conducted strontium and oxygen isotope analysis (Figure 4). Although the strontium measurement (87Sr/86Sr = 0.7084729 +/− 0.00001) is higher than values found at Pompeii (μ = 0.70806, n=2)38, this value is consistent with the bioavailable Sr range found across the southern Campania plain (Figure 4A (0.7075–0.7085)39). This is outside of the local range described in the Roman population of Latio40,41 and regions across Northern and Southern Italy38,42,43. The δ18Oenamel composition (δ18O VSMOW = 26.77 ‰, δ18O VPDB = −4.03 ‰) is consistent with coastal distributions of δ18O values in the central Italian peninsula (Figure 4B)38,42,44. Isotopic affinities with bioavailable 87Sr/86Sr and δ18O across the central Italian peninsula potentially indicate early residency in and around Pompeii; however, while this assessment suggests local origins that fall within the expected local ranges, similarities in geologic and bioavailable isotope systems are found across the Mediterranean45,46.
Figure 4. Strontium and oxygen analysis of Individual 25 from Villa of the Mysteries.

(A) Bioavailable strontium distributions comparing the Individual 25 (this study, red dot), Pompeii38,39 Nola & Pozzuoli with plant samples from the southern Campania plains39, the sub-urbium of Rome40, Satricum located southeast of Rome41, and Velia located on the western coast of southern Italy44. Violin and box plots show the similarities between sites located in central Italy and differences between populations near Rome. The Villa dei Misteri results fall within Sr ranges found across the Campania region and more broadly within ranges across the central and southern Italian peninsula. (B) Bioavailable strontium and oxygen isotope data for Individual 25 compared with published isotope data (n = 118) from the sub-urbium of Rome40, Satricum located southeast of Rome41, and Velia located on the western coast of southern Italy44. The Villa dei Misteri individual shares isotopic affinities consistent with Sr and O ranges found across the central Italian peninsula (see38,42). No published oxygen isotope data is currently available from Pompeii and the surrounding sites. Sr values higher than 0.7115 and lower than 0.7065 are not displayed in figure (see40). See also STAR Methods.
Besides emphasizing the cosmopolitanism and mobility that shaped urban Roman Imperial populations, this study illustrates how unreliable narratives based on limited evidence can be, often reflecting the worldview of the researchers at the time. In this light, genetic analysis can greatly enrich these narratives when integrated with archaeological data. For example, at two of the villas we analyzed, individuals previously assumed to be women, in absence of careful osteological assessment, were found to be genetically male. These discoveries challenge longstanding interpretations, such as associating jewelry with femininity or interpreting physical closeness as indicators of biological relationships. Similarly, the genetic data complicate simple narratives of kinship: at the House of the Golden Bracelet which is the only site for which we have genetic data from multiple individuals, the four individuals commonly interpreted as parents and their two children, are in fact not genetically related. Instead of establishing new narratives that might also misrepresent these people’s lived experiences, these results encourage reflection on conceptions and construction of gender and family in past societies as well as in academic discourse. Furthermore, it is possible that the exploitation of the casts as vehicles for storytelling led to the manipulation of their poses and relative positioning by restorers in the past. Genetic data, together with other bioarchaeological approaches, provide the opportunity to deepen our understanding of the people who became victim of the Vesuvius eruption and highlight how integrating genetic data with archaeological and historical information, even in a historically rich site like Pompeii, significantly enhances our understanding of past lives and behaviors.
STAR Methods
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Alissa Mittnik (alissa_mittnik@eva.mpg.de).
Materials availability
This study did not generate new unique reagents.
Data and code availability
All data needed to evaluate the conclusions in the paper are present in the paper and/or the supplemental information.
Newly reported ancient sequencing data have been deposited at European Nucleotide Archive (ENA) and are publicly available as of the date of publication with the following accession number ENA:PRJEB74999. Haploid genotypes for the 1240k panel for the newly reported ancient individuals, and genotype data for the newly reported present-day individuals are available at https://reich.hms.harvard.edu/datasets.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request.
Experimental model and study participant details
Ancient individuals
A description of the archaeological context of the ancient human individuals analyzed is provided in STAR Methods, Table S1 and Figure S1.
Method details
Plaster casts
In 79 CE the Mount Somma eruption that led to the formation of Vesuvius, destroyed Pompeii and killed the entire population. As the people slowly died from the painful hot and lethal gases and/or ash, they were covered with pumice and ash. Subsequently, the rainfall caused the bodies to become cemented in the ash and while the soft tissues decomposed, the hardened ash preserved the outline of the bodies. The impressive excavations to unearth the Pompeii city began in 1748 and proceeded sporadically, until the archaeologist Giuseppe Fiorelli began to carry out the research systematically, keeping detailed records of all the findings. In 1863 Fiorelli set up a method to realize plaster casts on some of the victims of the eruption, pouring liquid chalk into the voids left by the bodies in the hardened ash47. This method allowed to recreate the shape of the bodies even with their expression at the time of death (Figure S1). Plaster casts were made for 104 of the estimated approximately 1000 victims found in Pompeii.
Sampling of skeletal material and DNA extraction
During the recent efforts of cast restoration at the Pompeii Archaeological Park, we had the possibility to collect bone fragments and teeth from inside the casts. The skeletal samples were accessible through damaged parts of the casts, and they showed different degrees of preservation. In some cases, the bone material was mixed with plaster and highly fragmented and fragile (Figure S1). A first set of samples (Set 1: Cast Numbers 21, 22, 50, 51, 52 and 53) from six individuals from the House of Cryptoporticus and the House of the Golden Bracelet were chosen for molecular analysis to verify whether the reconstruction of the relations between them made on an archaeological basis was supported. Later on a further set of samples from eight additional individuals (Set 2) was collected (Table S1).
Sampling, DNA extraction and library preparation of all specimens was carried out in the Molecular Anthropology Unit of the University of Florence, a state-of-the-art facility dedicated to the analysis of ancient DNA samples. To remove potential contamination, the outer layer of the bone fragments and teeth was mechanically removed using a rotary sanding tool (Dremel® 300 series). After brushing, each sample was irradiated by ultraviolet light (λ = 254 nm) for 45min in a Biolink DNA Crosslinker (Biometra). DNA was extracted from approximately 50 mg of powder collected from the bones or from the tooth root following a protocol designed for optimizing the retrieval of very short DNA fragments in highly degraded samples48.
Quantification and evaluation of DNA preservation
DNA extracts of Set 1 were quantified in duplicate at the University of Florence, to obtain a preliminary description of the molecular preservation of such peculiar material. The presence of inhibitors and the DNA degradation level were evaluated using the Quantifiler™ Trio DNA Quantification Kit (Thermo Fisher Scientific, Oyster Point, CA). Real-time PCR amplification reactions contained 10.5 μL of Primer-Probe Mix, 12.5 μL of Master Mix, and 2.0 μL of the DNA sample as per the user’s manual49. The data were analyzed using the HID Real-Time PCR Analysis Software v1.2 with the settings provided. The quantification results are summarized in Table S2. No results were obtained from sample 21 for all targets analyzed. The quantification values obtained from samples 22 and 50 were zero for the large autosomal target, presumably due to DNA degradation in too-short fragments. Similar results were achieved for the Y marker in which the concentration varied between 2.8 and 107 pg/μl for all five samples. Positive results for the Y marker suggested that the samples were male. Because no results were obtained for the large autosomal marker from the two samples, the degradation index (DI) measuring typical ancient DNA contamination could only be computed reliably for samples 52, 53, and 51. The estimated DI values for these samples were 19.2, 7.6, and 14.8, respectively. As reported in the user manual49, these DI values indicate that the DNA in the samples was moderately/significantly degraded, consistent with authentic ancient DNA. No significant shift from the non-template control in IPC CT was observed, indicating that if inhibition was present, it was not enough to suppress IPC amplification significantly.
DNA library preparation
Illumina NGS libraries were constructed starting from 20 μl of DNA extract each, following a double-stranded DNA protocol using a unique combination of two indexes per specimen. Libraries without any UDG treatment were made for Set 150, to allow for assessment of the deamination patterns as a criterium of authenticity. We produced libraries with partial-UDG treatment for all the 14 samples51 for screening and potential 1240K SNP capture. Negative controls were checked with both qPCR and Agilent 2100 Bioanalyzer DNA 1000 chip. After adapter ligation blanks had a concentration of 4–5 order lower than the biological samples, while indexing PCR products showed the presence of adapter-indexes dimers only.
Mitochondrial DNA capture and sequencing
At the University of Florence, the non-UDG-treated libraries of Set 1, along with extraction and library blanks, were enriched for mitochondrial DNA following a multiplexed capture protocol22 and sequenced on an Illumina MiSeq instrument for 2×76+8+8 cycles. After demultiplexing, raw sequence data were analysed using a pipeline specific for ancient DNA samples52, using the following tools implemented in the pipeline. Adapters were clipped-off and paired-end reads with a minimum overlap of 10 bp merged in a single sequence using Clip&Merge version 1.7.4. Merged reads were then mapped on the revised Cambridge Reference Sequence, rCRS (GenBank Accession Number NC_012920) by CircularMapper in order to take into account the circularity of the mitochondrial genome. Duplicates were removed using DeDup, a tool that considers both ends of the fragments to recognize them as clonal. Reads with mapping quality below 30 were discarded.
Mapping results of these samples are shown in Table S3. Samples 22, 50, 51, 52, and 53 presented a mean coverage of 55.39, 37.34, 3.43 40.82, and 69.85 respectively, with more than 99% of the mitochondrial genome covered at least by 5 sequences with the exception of sample 51 with lower coverage (more than 80% of the mitochondrial genome covered at least by 2 sequences). No usable data was obtained for sample 21.
Second mitochondrial DNA capture, autosomal capture and sequencing
We screened aliquots of all 14 prepared partial-UDG-treated libraries as well as three extraction and library blanks at the ancient DNA facilities of Harvard Medical School, Boston MA, USA, by in-solution hybridization, enriching for the mitochondrial genome53, along with about 3,000 nuclear SNPs using a previously described bead-based capture23,54 with probes replaced by amplified oligonucleotides synthesized by CustomArray Inc. After the capture, we completed the adapter sites using PCR, attaching dual index combinations to each enriched library. We sequenced the screening products on an Illumina NextSeq500 using v.2 150 cycle kits for 2 × 76 cycles and 2 × 7 cycles. Screening results are summarized in DataS1 A.
For the seven libraries that passed the screening performed at Harvard Medical School, we performed 1240K capture, using two rounds of in-solution enrichment on the targeted set of 1,237,207 SNPs using previously reported protocols55,56. After indexing the enrichment products in a way that assigned a unique index combination to each library57, we sequenced the enriched products on an Illumina NextSeq500 instrument using v.2 150 cycle kits for 2 × 76 cycles and 2 × 7 cycles.
Data processing
We trimmed barcodes and adapters from the raw sequences and merged read pairs with at least 10 or 15 overlapping base pairs according to the length of the sequenced reads and mapped the resulting reads to the human reference genome, hg19 [GRCh37] using the samse command of BWA (version 0.6.1)58.
Four samples provide complete or nearly complete mitochondrial genomes after the mtDNA target enrichment performed on non-UDG-treated libraries prepared in Florence on the first batch of six samples collected. We assessed the authenticity of these mitochondrial genomes by examining the characteristic aDNA damage patterns59 and confirming a single source for mitochondrial sequences using contamMix60 (Table S3). The consensus sequences of the individuals were uploaded to Haplogrep361 to determine mtDNA haplogroups. Mitochondrial haplogroups were also determined for the data obtained from the partial UDG-treated libraries on all the 14 samples through Haplogrep361. For the samples processed in both laboratories, the mitochondrial profiles obtained from the two different library protocols were compared and provided further support to the authenticity of the data.
We determined genetic sex on the 1240K capture data using sexDetERRmine62. Of the seven individuals that passed screening, we were able to determine that five were genetically male (consistent with one X and one Y chromosome and inconsistent with two XX chromosomes and no Y chromosome), while two individuals remained indeterminate due to low coverage (DataS1 A). Damage patterns as assessed with MapDamage 2.059 were lower than in the data generated in the mtDNA capture performed in Florence, which is expected due to the partial UDG-treatment used on the 1240K capture libraries (Table 1). Sex estimates remained constant within the resolution of the confidence intervals after retaining only reads with C-to-T and G-to-A misincorporations at the 5’ and 3’ ends, respectively, using pmdtools v0.6063 (DataS1 A). We estimated heterozygosity on the X-chromosome of males using ANGSD64. For two males with sufficient coverage of at least 200 informative SNPs on the X chromosome we estimated nuclear contamination rates below 4%.
The individuals with working data had a median coverage on the 1240K SNP set of 0.054 (range 0.006 – 0.437). We prepared a genotype dataset for population genetic analysis by using mapped sequences with two bases trimmed from se ends by choosing one allele at random at the 1240K capture sites and retained five individuals for analysis that had at least 10,000 SNPs covered at least once (range 53,739 – 364,533).
We assigned Y-chromosomal haplogroups according to the Yfull 8.09 phylogeny using all trimmed reads mapped to the Y chromosome and report the most downstream diagnostic SNPs (DataS1 C).
Population genetic and relatedness analysis
We compiled a reference dataset consisting of whole genome data from 2,674 ancient individuals65 as well as previously reported whole-genome sequencing data from 346 worldwide modern-day individuals66–69 and merged the five newly reported pseudo-haploid genotypes from Pompeii.
We merged this dataset with 3291 modern-day individuals from 109 worldwide populations genotyped on the Affymetrix Human Origins (HO) SNP54,70–74. We used the smartpca function of EIGENSOFT (57) to perform principal component analysis (PCA) using default parameters, with the settings lsqproject:YES and numoutlier:0. We projected the ancient individuals onto a PCA plot of 1196 modern-day West Eurasian individuals, and 1900 modern-day worldwide individuals, restricting to the HO set of 597,573 SNPs.
We performed clustering using unsupervised ADMIXTURE75, after pruning SNPs in linkage disequilibrium with one another with PLINK58 using the parameter --indep-pairwise 200 25 0.4, which left us with 282,184 SNPs. We performed an ADMIXTURE analysis for values of k between 2 and 15, carrying out 5 replicates at each value of k and retaining the highest likelihood replicate at each k (Figures S2 and S3).
We performed qpWave10,11/qpAdm10 analyses with default parameters and allsnps: YES, precomputing f-statistics with using qpfstats (https://github.com/DReichLab/AdmixTools/blob/master/qpfs.pdf). All tools are implemented in ADMIXTOOLS. As “right” outgroups we used a set of 9 populations: “OldAfrica” (a diverse set of ancient African individuals with no evidence of West Eurasian-related admixture76–78), MAR_Taforalt_EpiP (Epipaleolithic North Africans79), RUS_AfontovaGora3 (Mesolithic hunter-gatherer from Siberia80), RUS_EHG (Hunter-gatherers from north-eastern Europe55,81), GEO_CHG.SG (hunter-gatherer from the Caucasus82), WHGB (Hunter-gatherers from the eastern Baltic and the Balkans55,81), ISR_Natufian_EpiP (Levantine Epipaleolithic hunter-gatherers54), TUR_EpiPal_Pinarbasi (an Anatolian Epipaleolithic hunter-gatherer83) and TUR_C_Boncuklu_PPN (Anatolian pre-ceramic farmers83). As distal source populations we used TUR_Marmara_Barcin_N (North-Western Anatolian Neolithic farmers55), Mediterranean_CA_NorthAfrican (two individuals from Chalcolithic Iberia and Sardinia with fully North African ancestry84,85), WHGA (hunter-gatherers from Western and Central Europe20,55,80,86–88), Levant_PPN (Levantine pre-ceramic farmers54), Steppe_EMBA (pastoralists from the Pontic-Caspian steppes associated with the Yamnaya and Poltavka cultural complexes20,55,89), and IRN_Ganj_Dareh_N (Neolithic farmers from the Zagros region54,90). In the modeling using proximal source populations19,20,24,55,70,71,85,89,91–99, we replaced GEO_CHG.SG with IRN_Ganj_Dareh_N in the outgroups so as to avoid a batch effect of attraction between sources and outgroups produced with the same processing strategy. We additionally added TUR_Marmara_Barcin_N and Steppe_EMBA to the outgroups and applied a “competitive” approach, adding unused sources to the outgroups. Corresponding genetic IDs for all outgroups and source groups are listed in DataS2 A.
We estimated relatedness between the Pompeian individuals using KIN10075 with default parameters, and BREAD R101 specifying a distance of at least 50,000 bp between overlapping sites. Results are shown in DataS1 D.
We used hapROH28 on the individual covered at more than 350,000 SNPs to detect Runs of Homozygosity (Figure S4).
Prediction of phenotypic traits
We explored the genomic data for the five previously selected individuals to predict phenotypic traits related to diseases, and externally visible characteristics (EVCs). We collected information about genetically determined medical conditions available in SNPedia (https://www.snpedia.com/index.php/Category:Is_a_medical_condition updated in October 2023) and sorted in ten macro-areas (Data S3). A total of 94477 SNPs were selected. Then we look for these conditions in GWAS catalog (https://www.ebi.ac.uk/gwas/) for a further description of traits and the list of the genomic variants involved in each trait (DataS3 A–B). BCFTools (v. 1.10.2) with the mpileup function was used to generate a VCF file containing genotype likelihoods in the selected positions for the previous alignment (BAM) files, setting a minimum mapping (-q) and base (-Q) quality thresholds of 20. In general, we obtained a maximum coverage of 3x for the selected SNPs, with most of them covered 1x. The obtained variants were annotated through SNPnexus (https://www.snp-nexus.org/v4/).
For the analysis of phenotypic traits related to externally visible characteristics (EVCs), 41 SNPs were obtained from the HIrisPlex-S panel29 and are related to eye, hair, and skin pigmentation (DataS3 A–B). The same approach described for the disease-linked traits was used to select these variants. Subsequently, the obtained variants related to the SNPs in the HIrisPlex-S panel were analyzed using the R software script provided for the HIrisPlex-S system, which allowed us to convert the results into the format required for the Hirsiplex-S online prediction model.
The variants involved in diseases genotyped for each sample are listed in DataS3 C–G. As shown in this table, several risk alleles have been detected for different diseases, but due to the low coverage and the presence of only a few risk alleles for each disease investigated, no pathological traits could be predicted with certainty. An example of this can be represented by individual 53 who, of the four risk alleles identified for Kawasaki disease102, has only two. Skin, eye and hair colors are the only traits for which a prediction is possible, and it was possible to attest that individual 52 had black hair and dark skin, and individuals 25, 51 and 53 had brown eyes (DataS3 D–G).
Strontium, Carbon, and Oxygen Analysis
Sample processing of the Pompeii tooth (Individual 25, lower premolar) took place in the Bone Chemistry Lab, Department of Anthropology, University of Florida, and all mass spectrometry was conducted in the Department of Geological Sciences, University of Florida. A small chunk of tooth enamel from Individual 25 (UF BCL 4300) was removed from the crown using an NSK dental drill and a Dedeco separating disc. The tooth enamel ‘chunk’ (~30 mg) removed was cleaned of adhering debris and dentine under a dissecting microscope, using a mounted dental drill apparatus outfitted with a carbide tungsten tapered drill bit. Two chunks of ‘cleaned’ tooth enamel (~10 mg each) were produced, one for carbon and oxygen isotope ratios using isotope ratio mass spectrometry (IRMS), and the second for strontium isotope analysis using thermal ionization mass spectrometry (TIMS).
A 10 mg sample targeted for carbon and oxygen isotope analysis was ground using an acid-cleaned agate set and tooth enamel powder was loaded into a pre-weighed 0.5 mL microcentrifuge tube. To oxidize the sample, a 2% sodium hypochlorite (NaCIO) solution was added to the sample for ~8 hours, rinsed to neutral with Milli-Q water, followed by ~8 hours of pretreatment using 0.2M acetic acid (CH3COOH). The pretreated sample was then rinsed to neutral with Milli-Q and the sample was placed in a −20° C freezer. Once frozen, the sample was freeze-dried for ~48 hours, and its final weight recorded prior to sample loading for IRMS. Carbon and oxygen stable isotope ratios were measured in duplicate on Sept. 6, 2017 via IRMS (Finnigan MAT 252) using a Kiel III carbonate prep device. The precision of NBS-19 standards (n=10) during the run for δ13C was 0.02‰ and for δ18O was 0.07‰.
Another 10 mg sample was targeted for radiogenic strontium ratios was transferred to a class 1000 Clean Lab in the Department of Geological Sciences, University of Florida. The tooth enamel chunk was dissolved in 50% nitric acid (HNO3) on a hot plate (100° C) for 24 hours in a pre-cleaned and capped Teflon™ vial. Vials were opened and evaporated to dryness, prior to ion chromatography. The dried residue was dissolved in 3.5 N HNO3 and loaded onto a cation exchange column packed with strontium-spec resin (Eichrom Technologies, Inc.) to separate the strontium from other ions. The Sr sample was then loaded onto a degassed tungsten filament and 87Sr/86Sr was measured on a Micromass Sector 54 TIMS. The sample was run for 200+ ratios at 1.5 V and normalized to 86Sr/88Sr = 0.1194 following methods outlined in103, against repeated analyses of the standard reference NBS-987. Obtained isotope measurements were compared against values in the literature38–42,44.
Supplementary Material
Document S1. Figures S1–S4 and Tables S1–S3
DataS1. Supporting data for sampling, sample processing and data description, related to STAR Methods. A) Overview of sample metainformation, processing and library statistics. B) Results of AMS radiocarbon dating. C) Y-chromosomal haplogroup assignments. D) Results of relatedness analyses using BREADR and KIN.
DataS2. Supporting data for population genetic analysis, related to STAR Methods. A) Individuals included in qpAdm analysis and their population labels. B) Results of qpAdm modeling using distal source populations, related to Figure 3. C) Results of qpAdm modeling using proximal source populations, shown are working models with p>=0.01. D) Results of qpAdm modeling of Individual 52 using proximal source populations.
DataS3. Supporting data for phenotypic and disease risk assessment, related to STAR Methods. A) Phenotype probabilities assessed with the HIrisPlex-S system. B) List of markers used for assessment of phenotypic traits and disease risks. C) Genotyping results for disease risk markers, individual 22. D) Genotyping results for disease risk markers, individual 25. E) Genotyping results for disease risk markers, individual 51. F) Genotyping results for disease risk markers, individual 52. G) Genotyping results for disease risk markers, individual 53.
Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Biological samples | ||
| Ancient skeletal element | This study | I3678; Cast Number 15 |
| Ancient skeletal element | This study | I3679; Cast Number 1 |
| Ancient skeletal element | This study | I3680; Cast Number 79 |
| Ancient skeletal element | This study | I3681; Cast Number 20 |
| Ancient skeletal element | This study | I3682; Cast Number 25 |
| Ancient skeletal element | This study | I3683; Cast Number 50 |
| Ancient skeletal element | This study | I3684; Cast Number 21 |
| Ancient skeletal element | This study | I3685; Cast Number 52 |
| Ancient skeletal element | This study | I3686; Cast Number 51 |
| Ancient skeletal element | This study | I3687; Cast Number 14 |
| Ancient skeletal element | This study | I3688; Cast Number 54 |
| Ancient skeletal element | This study | I3689; Cast Number 62 |
| Ancient skeletal element | This study | I3690; Cast Number 22 |
| Ancient skeletal element | This study | I3691; Cast Number 53 |
| Chemicals, peptides, and recombinant proteins | ||
| Distilled Water DNA free, UltraPure | Thermo Fisher Scientific | Cat# 10977035 |
| 0.5 M EDTA pH 8.0 | Thermo Fisher Scientific | Cat# AM9261 |
| Proteinase K | Thermo Fisher Scientific | Cat# AM2548 |
| Isopropanol | Sigma Aldrich | Cat# I9516 |
| Guanidine hydrochloride | Sigma Aldrich | Cat# G4505 |
| Sodium Acetate Solution (3 M), pH 5.2 | Thermo Fisher Scientific | Cat# R1181 |
| Tween 20 | Sigma Aldrich | Cat# P2287 |
| Buffer PE | Qiagen | Cat# 19065 |
| Buffer PB | Qiagen | Cat# 19066 |
| Tris-EDTA buffer solution | Sigma Aldrich | Cat# 93283 |
| UltraPure™ 0.5M EDTA, pH 8.0 | Thermo Fisher Scientific | Cat# 15575020 |
| NEB Buffer #2 10x | New England Biolabs | Cat# B7002 |
| ATP 10 mM | New England Biolabs | Cat# P0756 |
| BSA 20 mg/mL | New England Biolabs | Cat# B9000 |
| dNTP Mix | Euroclone | Cat# EMR415001 |
| USER enzyme | New England Biolabs | Cat# M5505 |
| Uracil Glycosylase inhibitor (UGI) | New England Biolabs | Cat# M0281 |
| T4 Polynucleotide Kinase | New England Biolabs | Cat# M0201 |
| T4 DNA Polymerase | New England Biolabs | Cat# M0203 |
| Bst DNA Polymerase | New England Biolabs | Cat# M0537L |
| Quick Ligase | New England Biolabs | Cat# M2200 |
| PfuTurbo Cx Hotstart DNA Polymerase | Agilent Technologies | Cat# 600414 |
| Ethanol | Merck | Cat# 1009831000 |
| Agilent D1000 ScreenTapes | Agilent Technologies | Cat# 5067-5582 |
| Agilent D1000 Reagents | Agilent Technologies | Cat# 5067-5583 |
| Agilent HS Screen Tapes | Agilent Technologies | Cat# 5067-5584 |
| Agilent HS Reagents | Agilent Technologies | Cat# 5067-5585 |
| Agarose | Lonza | Cat# 50004 |
| Expand Long Range dNTPack | Roche | Cat# 4829034001 |
| Quick Blunting™ Kit | New England BioLaba | Cat# E1201 |
| AccuPrime Pfx DNA Polymerase | Thermo Fisher Scientific | Cat# 12344024 |
| Herculase II Fusion DNA Polymerase | Agilent Technologies | Cat# 600679 |
| Sodium hydroxide Pellets | Fisher Scientific | Cat# 10306200 |
| Dynabeads M-270 Streptavidin | Thermo Fisher Scientific | Cat# 65305 |
| AmpliTaq Gold™ DNA Polymerase with Gold Buffer and MgCl2 | Thermo Fisher Scientific | Cat# 4311806 |
| Agilent aCGH Hybridization Kit | Agilent | Cat# 5188-5220 |
| 5M NaCl | Sigma Aldrich | Cat# S5150 |
| 1M NaOH | Sigma Aldrich | Cat# 71463 |
| 1 M Tris-HCl pH 8.0 | Sigma Aldrich | Cat# AM9856 |
| Quantifiler™ Trio DNA Quantification Kit | Thermo Fisher Scientific | Cat# 4482910 |
| Cot-1 DNA | Invitrogen | Cat# 15279011 |
| Dynabeads MyOne Streptavidin T1 | Thermo Fisher Scientific | Cat# 65602 |
| Salmon sperm DNA | Thermo Fisher Scientific | Cat# 15632-011 |
| Denhardt’s solution | Sigma-Aldrich | Cat# D9905-5Ml |
| 20x SCC Buffer | Thermo Fisher Scientific | Cat# AM9770 |
| 2x HI-RPM hybridization buffer | Agilent | Cat# 5118-5380 |
| Critical commercial assays | ||
| MinElute PCR Purification Kit | QIAGEN | Cat# 28006 |
| QIAquick PCR Purification Kit | QIAGEN | Cat# 28104 |
| Qubit dsDNA HS Assay Kit, 500 assays | Thermo Fisher Scientific | Cat# Q32854 |
| High Pure Extender Assembly from the Roche High Pure Viral Nucleic Acid Large Volume Kit,40 reactions | Roche | Cat# 5114403001 |
| QIAquick Nucleotide Removal Kit | Quiagen | Cat# 28304 |
| MiSeq Reagent Kit v3 (150 cycle) | Illumina | Cat# MS-102-3001 |
| NextSeq 500/550 High Output Kit v2.5 | Illumina | Cat# 20024906 |
| Deposited data | ||
| Sequencing data from 5 newly reported ancient individuals | This study | ENA: PRJEB74999 |
| Genotype data from 5 ancient newly reported individuals | This study | https://reich.hms.harvard.edu/datasets |
| Oligonucleotides | ||
| IS1_adapter.P5: A*C*A*C*TCTTTCCCTACACGACGCTCTTCCG*A*T*C*T | Meyer & Kircher, 2010. Cold Spring Harb Protoc 6: pdb.prot544850 | Merck |
| IS2_adapter.P7: G*T*G*A*CTGGAGTTCAGACGTGTGCTCTTCCG*A*T*C*T | Meyer & Kircher, 2010. Cold Spring Harb Protoc 6: pdb.prot544850 | Merck |
| IS3_adapter.P5+P7: A*G*A*T*CGGAA*G*A*G*C | Meyer & Kircher, 2010. Cold Spring Harb Protoc 6: pdb.prot544850 | Merck |
| IS6: CAAGCAGAAGACGGCATACGA | Meyer & Kircher, 2010. Cold Spring Harb Protoc 6: pdb.prot544850 | Merck |
| IS5: AATGATACGGCGACCACCGA | Meyer & Kircher, 2010. Cold Spring Harb Protoc 6: pdb.prot544850 | Merck |
| Sol_iPCR-MPI: CAAGCAGAAGACGGCATACGAGAT********GTGACTGGAGTTCAGACGTGT | Kircher et al., 2012. Nucleic Acid Research, 40(1): e3104 | Merck |
| P5_iPCR-LP: AATGATACGGCGACCACCGAGATCTACAC********ACACTCTTTCCCTACACGACGCTCTT | Kircher et al., 2012. Nucleic Acid Research, 40(1): e3104 | Merck |
| Bio-T: Biotin-TCAAGGACATCC*G | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| B: CGGATGTCCTT*G | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO1.P5.F: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-phosphate | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO2.P5.R: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-phosphate | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO3.P7.part1.F: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-phosphate | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO4.P7.part1.R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-phosphate | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO5.P7.part2.F: ATCTCGTATGCCGTCTTCTGCTTG-phosphate | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO6.P7.part2.R: CAAGCAGAAGACGGCATACGAGAT-phosphate | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| BO8.P5.part1.R:GTGTAGATCTCGGTGGTC GCCGTATCATT-Phosphate | Fu et al., 2013. Proc. Natl. Acad. Sci. USA, 110(6): 2223–222756; Fu et al., 2015. Nature 524:216–219105 | Sigma-Aldrich |
| BO10.P5.part2.R:AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-phosphate | Fu et al., 2013. Proc. Natl. Acad. Sci. USA, 110(6): 2223–222756; Fu et al., 2015. Nature 524:216–219105 | Sigma-Aldrich |
| Sol_bridge_P5: AATGATACGGCGACCACCGA | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| Sol_bridge_P7: CAAGCAGAAGACGGCATACGA | Maricic et al., 2010. Plos One 5(11): e1400422 | Merck |
| LongR_mt1_For: GGCTTTCTCAACTTTTAAAGGATA | Meyer et al., 2007. Nucleic Acids Research 35(15)106 | Merck |
| LongR_mt1_Rev: TGTCCTGATCCAACATCGAG | Meyer et al., 2007. Nucleic Acids Research 35(15)106 | Merck |
| LongR_mt2_For: CCGTGCAAAGGTAGCATAATC | Meyer et al., 2007. Nucleic Acids Research 35(15)106 | Merck |
| LongR_mt2_Rev: TTACTTTTATTTGGAGTTGCACCA | Meyer et al., 2007. Nucleic Acids Research 35(15)106 | Merck |
| Probe for 1240K Panel | Haak et al., 2015. Nature 522(7555):207–1123; Mathieson et al., 2015. Nature 528(7583):499–50355 | N/A |
| Software and algorithms | ||
| EAGER version 1.92.55 | Peltzer et al., 2016. Genome Biol 17:6052 | https://github.com/apeltzer/EAGER-GUI |
| CircularMapper version 1.0 | Peltzer et al., 2016. Genome Biol 17:6052 | https://github.com/apeltzer/CircularMapper/releases |
| Dedup v0.12.07 | Peltzer et al., 2016. Genome Biol 17:6052 | https://github.com/apeltzer/DeDup |
| bwa v. 0.7.17-r1188 | Li and Durbin, 2009. Bioinformatics 25(14):1754–6058 | https://github.com/lh3/bwa |
| mapDamage2.0 | Jónsson et al., 2013. Bioinformatics 29(13):1682–459 | https://ginolhac.github.io/mapDamage/ |
| contamMix | Fu et al., 2013. Curr Biol 23(7):553–55960 | |
| Haplogrep3 | Schönherr et al. 2023. Nucleic Acids Res 5161 | https://haplogrep.i-med.ac.at |
| HID Real-Time PCR Analysis Software v1.2 | Thermo Fisher | A24664 |
| SeqPrep 1.1 | https://github.com/jstjohn/SeqPrep | N/A |
| Preseq | Daley and Smith, 2013. Nat Methods 10(4):325–7107 | N/A |
| ANGSD | Korneliussen et al., 2014. BMC Bioinformatics 15:35664 | N/A |
| SAMTools | Li and Durbin, 2009. Bioinformatics 25(14):1754–6058 | N/A |
| EIGENSOFT (version 7.2.1). | https://github.com/DReichLab/EIG | N/A |
| ADMIXTOOLS v.6.0 | https://github.com/dReichLab/AdmixTools | N/A |
| KIN | Popli et al., 2023. Genome Biol 24(1):10100 | N/A |
| BREADR | Rohrlach et al., 2023. bioRxiv 2023.04.17.537144101 | N/A |
| sexDetERRmine | Lamnidis et al., 2018. Nat. Commun. 9(1):501862 | N/A |
| ADMIXTURE | Alexander et al., 2009. Genome Res 19(9):1655–6475 | N/A |
| hapROH | Ringbauer et al., 2021. Nat. Commun. 12(1):542528 | N/A |
Acknowledgments
We thank Aisling Kearns, Rebecca Bernardos, Zhao Zhang, Matthew Ferry, Megan Michel, Jonas Oppenheimer and Kristin Stewardson for support in ancient DNA work, and we thank Domenico Sparice, Michael McCormick and Solenn Troadec for critical comments to the manuscript. The ancient DNA laboratory work and analysis at Florence was funded by PRIN grant number 2020HJXCK9 of the Italian Ministry of Research “Pompeii: A Molecular Portrait” to David Caramelli, and by the European Union grant – Next Generation EU – PNRR M4C2 – Investimento 1.3. PE5-Change. D.R. is an Investigator of the Howard Hughes Medical Institute (HHMI), and the ancient DNA laboratory work and analysis at Harvard were also supported by National Institutes of Health grant HG012287, by John Templeton Foundation grant 61220, by the Allen Discovery Center program, which is a Paul G. Allen Frontiers Group advised program of the Paul G. Allen Family Foundation, and by a gift from J.-F. Clin. We thank Dr. Brendan J. Culleton for conducting radiocarbon dating at Pennsylvania State University. Strontium ratios were measured via TIMS with assistance from Drs. Ann Heatherington and George Kamenov and oxygen and carbon isotope ratios were measured by Dr. Jason Curtis. This article is subject to HHMI’s Open Access to Publications policy. HHMI lab heads have previously granted a nonexclusive CC BY 4.0 license to the public and a sublicensable license to HHMI in their research articles. Pursuant to those licenses, the author-accepted manuscript of this article can be made freely available under a CC BY 4.0 license immediately upon publication.
Footnotes
Declaration of interests: The authors declare no competing interests.
References
- 1.Amato V, Covolan M, Dessales H, and Santoriello A (2022). Seismic Microzonation of the Pompeii Archaeological Park (Southern Italy): Local Seismic Amplification Factors. Geosciences 12. 10.3390/geosciences12070275. [DOI] [Google Scholar]
- 2.De Carolis E, Patricelli G, and Ciarallo A (1998). Rinvenimenti di corpi umani nell’area urbana di Pompei. Riv. di Stud. Pompeiani 9, 75–123. [Google Scholar]
- 3.De Carolis E, and Patricelli G (2003). Le vittime dell’eruzione. In Storie di un’eruzione. Pompei Ercolano Oplontis, D’Ambrosio A, Guzzo PG, and Mastroroberto M, eds. [Google Scholar]
- 4.Luongo G, Perrotta A, Scarpati C, De Carolis E, Patricelli G, and Ciarallo A (2003). Impact of the AD 79 explosive eruption on Pompeii, II. Causes of death of the inhabitants inferred by stratigraphic analysis and areal distribution of the human casualties. J. Volcanol. Geotherm. Res. 126, 169–200. 10.1016/S0377-0273(03)00147-1. [DOI] [Google Scholar]
- 5.Lazer E (2009). Resurrecting Pompeii (Routledge; ). [Google Scholar]
- 6.Lazer E, Welch K, Vu D, Vu M, Middleton A, Canigliula R, Luyck S, Babino G, and Osanna M (2021). INSIDE THE CASTS OF THE POMPEIAN VICTIMS: RESULTS FROM THE FIRST SEASON OF THE POMPEII CAST PROJECT IN 2015. Pap. Br. Sch. Rome 89, 101–136. 10.1017/S0068246220000264. [DOI] [Google Scholar]
- 7.Cipollaro M, Di Bernardo G, Galano G, Galderisi U, Guarino F, Angelini F, and Cascino A (1998). Ancient DNA in human bone remains from Pompeii archaeological site. Biochem. Biophys. Res. Commun. 247, 901–904. 10.1006/bbrc.1998.8881. [DOI] [PubMed] [Google Scholar]
- 8.Di Bernardo G, Del Gaudio S, Galderisi U, and Cipollaro M (2004). 2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains. J. Exp. Zool. B. Mol. Dev. Evol. 302, 550–556. 10.1002/jez.b.21017. [DOI] [PubMed] [Google Scholar]
- 9.Corbino CA, Comegna C, Amoretti V, Modi A, Cannariato C, Lari M, Caramelli D, and Osanna M (2023). Equine exploitation at Pompeii (AD 79). J. Archaeol. Sci. Reports 48, 103902. 10.1016/j.jasrep.2023.103902. [DOI] [Google Scholar]
- 10.Di Bernardo G, Galderisi U, Del Gaudio S, D’Aniello A, Lanave C, De Robertis MT, Cascino A, and Cipollaro M (2004). Genetic characterization of Pompeii and Herculaneum Equidae buried by Vesuvius in 79 AD. J. Cell. Physiol. 199, 200–205. 10.1002/jcp.10461. [DOI] [PubMed] [Google Scholar]
- 11.Guarino FM, Buccelli C, Graziano V, La Porta P, Mezzasalma M, Odierna G, Paternoster M, and Petrone P (2017). Recovery and amplification of ancient DNA from Herculaneum victims killed by the 79 AD Vesuvius hot surges. Turkish J. Biol 41. [Google Scholar]
- 12.Di Bernardo G, Del Gaudio S, Galderisi U, Cascino A, and Cipollaro M (2009). Ancient DNA and Family Relationships in a Pompeian House. Ann. Hum. Genet. 73, 429–437. 10.1111/j.1469-1809.2009.00520.x. [DOI] [PubMed] [Google Scholar]
- 13.Cipollaro M, Di Bernado G, Forte A, Galano G, De Masi L, Galderisi U, Guarino FM, Angelini F, and Cascino A (1999). Histological analysis and ancient DNA amplification of human bone remains found in caius iulius polybius house in pompeii. Croat. Med. J. 40, 392–397. [PubMed] [Google Scholar]
- 14.Di Bernardo G, Del Gaudio S, Cammarota M, Galderisi U, Cascino A, and Cipollaro M (2002). Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains. Nucleic Acids Res. 30, e16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Manca P, Farina V, Gadau S, Lepore G, Genovese A, and Zedda M Phenotypic features of the domestic pigs bred in the Roman settlements of Pompeii and Caralis. Ital. J. Anat. Embryol. 109, 105–114. [PubMed] [Google Scholar]
- 16.Cipollaro M (2011). Strengthening ancient mtDNA equid sequences from pompeii. J. Cell. Biochem. 112, 363–364. 10.1002/jcb.22965. [DOI] [PubMed] [Google Scholar]
- 17.Gurney SMR (2010). Revisiting ancient mtDNA equid sequences from Pompeii. J. Cell. Biochem. 111, 1080–1081. 10.1002/jcb.22914. [DOI] [PubMed] [Google Scholar]
- 18.Scorrano G, Viva S, Pinotti T, Fabbri PF, Rickards O, and Macciardi F (2022). Bioarchaeological and palaeogenomic portrait of two Pompeians that died during the eruption of Vesuvius in 79 AD. Sci. Rep. 12, 6468. 10.1038/s41598-022-10899-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, Oberreiter V, Calderon D, Devitofranceschi K, Aikens RC, et al. (2019). Ancient Rome: A genetic crossroads of Europe and the Mediterranean. Science 366, 708–714. 10.1126/science.aay6826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Mathieson I, Alpaslan-Roodenberg S, Posth C, Szécsényi-Nagy A, Rohland N, Mallick S, Olalde I, Broomandkhoshbacht N, Candilio F, Cheronet O, et al. (2018). The genomic history of southeastern Europe. Nature 555, 197–203. 10.1038/nature25778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Osanna M, Capurso A, and Masseroli SM (2021). I calchi di Pompei da Giuseppe Fiorelli ad oggi (L’Erma di Bretschneider; ). [Google Scholar]
- 22.Maricic T, Whitten M, and Pääbo S (2010). Multiplexed DNA sequence capture of mitochondrial genomes using PCR products. PLoS One 5, e14004. 10.1371/journal.pone.0014004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Haak W, Lazaridis I, Patterson N, Rohland N, Mallick S, Llamas B, Brandt G, Nordenfelt S, Harney E, Stewardson K, et al. (2015). Massive migration from the steppe was a source for Indo-European languages in Europe. Nature 522, 207–211. 10.1038/NATURE14317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lazaridis I, Alpaslan-Roodenberg S, Acar A, Açikkol A, Agelarakis A, Aghikyan L, Akyüz U, Andreeva D, Andrijašević G, Antonović D, et al. (2022). The genetic history of the Southern Arc: A bridge between West Asia and Europe. Science (80-.). 377, eabm4247. 10.1126/science.abm4247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Battaglia V, Fornarino S, Al-Zahery N, Olivieri A, Pala M, Myres NM, King RJ, Rootsi S, Marjanovic D, Primorac D, et al. (2009). Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe. Eur. J. Hum. Genet. 17, 820–830. 10.1038/ejhg.2008.249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Trombetta B, Cruciani F, Sellitto D, and Scozzari R (2011). A new topology of the human Y chromosome haplogroup E1b1 (E-P2) revealed through the use of newly characterized binary polymorphisms. PLoS One 6, e16073. 10.1371/journal.pone.0016073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Mendez FL, Karafet TM, Krahn T, Ostrer H, Soodyall H, and Hammer MF (2011). Increased resolution of Y chromosome haplogroup T defines relationships among populations of the Near East, Europe, and Africa. Hum. Biol. 83, 39–53. 10.3378/027.083.0103. [DOI] [PubMed] [Google Scholar]
- 28.Ringbauer H, Novembre J, and Steinrücken M (2021). Parental relatedness through time revealed by runs of homozygosity in ancient DNA. Nat. Commun. 12, 5425. 10.1038/s41467-021-25289-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chaitanya L, Breslin K, Zuñiga S, Wirken L, Pośpiech E, Kukla-Bartoszek M, Sijen T, de Knijff P, Liu F, and Branicki W (2018). The HIrisPlex-S system for eye, hair and skin colour prediction from DNA: Introduction and forensic developmental validation. Forensic Sci. Int. Genet. 35, 123–135. [DOI] [PubMed] [Google Scholar]
- 30.Rocco T (2003). The House of the Golden Bracelet (VI, 17. 42). In Tales from an Eruption: Pompeii, Herculaneum, Oplontis: Guide to the Exhibition, Guzzo PG, ed. (Mondadori Electa; ). [Google Scholar]
- 31.Guzzo PG (2003). Tales from an Eruption: Pompeii, Herculaneum, Oplontis Guide to the Exhibition (Electa; ). [Google Scholar]
- 32.De Carolis E, and Patricelli G (2018). Impronte Pompeiane (L’Erma di Bretschneider; ). [Google Scholar]
- 33.Spinazzola V (1914). Di un gruppo di fuggiaschi sepolti nella cenere, e di alcune impronte che se ne trassero. In L’Archeologia dell’amore. Dal Neanderthal al Taj Mahal (Neo Edizioni), pp. 257–263. [Google Scholar]
- 34.Spinazzola V (1953). Pompei alla luce degli scavi nuovi di via dell’Abbondanza (anni 1910–1923) (Libreria dello Stato, Roma: ). [Google Scholar]
- 35.Rando JC, Pinto F, González AM, Hernández M, Larruga JM, Cabrera VM, and Bandelt HJ (1998). Mitochondrial DNA analysis of northwest African populations reveals genetic exchanges with European, near-eastern, and sub-Saharan populations. Ann. Hum. Genet. 62, 531–550. 10.1046/j.1469-1809.1998.6260531.x. [DOI] [PubMed] [Google Scholar]
- 36.Richards M, Macaulay V, Hickey E, Vega E, Sykes B, Guida V, Rengo C, Sellitto D, Cruciani F, Kivisild T, et al. (2000). Tracing European founder lineages in the Near Eastern mtDNA pool. Am. J. Hum. Genet. 67, 1251–1276. [PMC free article] [PubMed] [Google Scholar]
- 37.Maiuri A (1931). La Villa dei Misteri (Libreria dello Stato, Roma: ). [Google Scholar]
- 38.Lugli F, Cipriani A, Bruno L, Ronchetti F, Cavazzuti C, and Benazzi S (2022). A strontium isoscape of Italy for provenance studies. Chem. Geol. 587, 120624. 10.1016/j.chemgeo.2021.120624. [DOI] [Google Scholar]
- 39.Arienzo I, Rucco I, Di Vito MA, D’Antonio M, Cesarano M, Carandente A, De Angelis F, Romboni M, and Rickards O (2020). Sr isotopic composition as a tool for unraveling human mobility in the Campania area. Archaeol. Anthropol. Sci. 12, 157. 10.1007/s12520-020-01088-0. [DOI] [Google Scholar]
- 40.Killgrove K, and Montgomery J (2016). All Roads Lead to Rome: Exploring Human Migration to the Eternal City through Biochemistry of Skeletons from Two Imperial-Era Cemeteries (1st-3rd c AD). PLoS One 11, e0147585. 10.1371/journal.pone.0147585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Sengeløv A, van de Wijdeven G, Snoeck C, Laffoon J, de Hond R, Gnade M, and Waters-Rist A (2020). Understanding the post-Archaic population of Satricum, Italy: A bioarchaeological approach. J. Archaeol. Sci. Reports 31, 102285. 10.1016/j.jasrep.2020.102285. [DOI] [Google Scholar]
- 42.Emery MV, Stark RJ, Murchie TJ, Elford S, Schwarcz HP, and Prowse TL (2018). Mapping the origins of Imperial Roman workers (1st-4th century CE) at Vagnari, Southern Italy, using (87) Sr/(86) Sr and δ(18) O variability. Am. J. Phys. Anthropol. 166, 837–850. 10.1002/ajpa.23473. [DOI] [PubMed] [Google Scholar]
- 43.Zaugg C, Guggisberg MA, Vach W, Cooper MJ, and Gerling C (2023). Mapping Strontium Isotope Geographical Variability as a Basis for Multi-regional Human Mobility: The Sybaris Region (S Italy) in the Early 1st Millennium BC. Environ. Archaeol 10.1080/14614103.2023.2260622. [DOI] [Google Scholar]
- 44.Stark RJ, Emery MV, Schwarcz H, Sperduti A, Bondioli L, Craig OE, and Prowse TL (2021). Dataset of oxygen, carbon, and strontium isotope values from the Imperial Roman site of Velia (ca. 1st-2nd c. CE), Italy. Data Br. 38, 107421. 10.1016/j.dib.2021.107421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Nikita E, Mardini M, Mardini M, and Degryse P (2022). SrIsoMed: An open access strontium isotopes database for the Mediterranean. J. Archaeol. Sci. Reports 45, 103606. 10.1016/j.jasrep.2022.103606. [DOI] [Google Scholar]
- 46.Farese M, Soncin S, Robb J, Fernandes R, and Tafuri MA (2023). The Mediterranean archive of isotopic data, a dataset to explore lifeways from the Neolithic to the Iron Age. Sci. Data 10, 917. 10.1038/s41597-023-02783-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ministero per i beni e le Attività Culturali Soprintendenza speciale per i Beni Archeologici di Napoli e Pompei (2010). Uno alla volta i calchi. Mondadori Electra S.p.A.
- 48.Dabney J, Knapp M, Glocke I, Gansauge M-T, Weihmann A, Nickel B, Valdiosera C, García N, Pääbo S, Arsuaga J-L, et al. (2013). Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc. Natl. Acad. Sci. 110, 15758–15763. 10.1073/pnas.1314445110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Quantifiler ® HP and Trio DNA Quantification Kits User Guide.
- 50.Meyer M, and Kircher M (2010). Illumina Sequencing Library Preparation for Highly Multiplexed Target Capture and Sequencing. Cold Spring Harb. Protoc 2010, pdb.prot5448. 10.1101/pdb.prot5448. [DOI] [PubMed] [Google Scholar]
- 51.Rohland N, Harney E, Mallick S, Nordenfelt S, and Reich D (2015). Partial uracil – DNA – glycosylase treatment for screening of ancient DNA. Philos. Trans. R. Soc. B Biol. Sci 370. 10.1098/rstb.2013.0624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Peltzer A, Jäger G, Herbig A, Seitz A, Kniep C, Krause J, and Nieselt K (2016). EAGER: efficient ancient genome reconstruction. Genome Biol. 17, 60. 10.1186/s13059-016-0918-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Meyer M, Fu Q, Aximu-Petri A, Glocke I, Nickel B, Arsuaga J-L, Martínez I, Gracia A, de Castro JMB, Carbonell E, et al. (2014). A mitochondrial genome sequence of a hominin from Sima de los Huesos. Nature 505, 403–406. 10.1038/nature12788. [DOI] [PubMed] [Google Scholar]
- 54.Lazaridis I, Nadel D, Rollefson G, Merrett DC, Rohland N, Mallick S, Fernandes D, Novak M, Gamarra B, Sirak K, et al. (2016). Genomic insights into the origin of farming in the ancient Near East. Nature 536, 419–424. 10.1038/nature19310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Mathieson I, Lazaridis I, Rohland N, Mallick S, Patterson N, Roodenberg SA, Harney E, Stewardson K, Fernandes D, Novak M, et al. (2015). Genome-wide patterns of selection in 230 ancient Eurasians. Nature 528, 499–503. 10.1038/nature16152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Fu Q, Meyer M, Gao X, Stenzel U, Burbano HA, Kelso J, and Pääbo S (2013). DNA analysis of an early modern human from Tianyuan Cave, China. Proc. Natl. Acad. Sci. U. S. A. 110, 2223–2227. 10.1073/pnas.1221359110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Rohland N, and Reich D (2012). Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, 939–946. 10.1101/gr.128124.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Li H, and Durbin R (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754–1760. 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Jónsson H, Ginolhac A, Schubert M, Johnson PLF, and Orlando L (2013). mapDamage2.0: fast approximate Bayesian estimates of ancient DNA damage parameters. Bioinformatics 29, 1682–1684. 10.1093/bioinformatics/btt193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Fu Q, Mittnik A, Johnson PLF, Bos K, Lari M, Bollongino R, Sun C, Giemsch L, Schmitz R, Burger J, et al. (2013). A revised timescale for human evolution based on ancient mitochondrial genomes. Curr. Biol. 23, 553–559. 10.1016/j.cub.2013.02.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Schönherr S, Weissensteiner H, Kronenberg F, and Forer L (2023). Haplogrep 3 - an interactive haplogroup classification and analysis platform. Nucleic Acids Res. 10.1093/nar/gkad284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Lamnidis TC, Majander K, Jeong C, Salmela E, Wessman A, Moiseyev V, Khartanovich V, Balanovsky O, Ongyerth M, Weihmann A, et al. (2018). Ancient Fennoscandian genomes reveal origin and spread of Siberian ancestry in Europe. Nat. Commun. 9, 5018. 10.1038/s41467-018-07483-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Skoglund P, Northoff BH, Shunkov MV, Derevianko AP, Pääbo S, Krause J, and Jakobsson M (2014). Separating endogenous ancient DNA from modern day contamination in a Siberian Neandertal. Proc. Natl. Acad. Sci. U. S. A. 111, 2229–2234. 10.1073/pnas.1318934111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Korneliussen TS, Albrechtsen A, and Nielsen R (2014). ANGSD: Analysis of Next Generation Sequencing Data. BMC Bioinformatics 15. 10.1186/S12859-014-0356-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Mallick S, Micco A, Mah M, Ringbauer H, Lazaridis I, Olalde I, Patterson N, and Reich D (2024). The Allen Ancient DNA Resource (AADR) a curated compendium of ancient human genomes. Sci. Data 11, 182. 10.1038/s41597-024-03031-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Mallick S, Li H, Lipson M, Mathieson I, Gymrek M, Racimo F, Zhao M, Chennagiri N, Nordenfelt S, Tandon A, et al. (2016). The Simons Genome Diversity Project: 300 genomes from 142 diverse populations. Nature 538, 201–206. 10.1038/nature18964. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Meyer M, Kircher M, Gansauge M-T, Li H, Racimo F, Mallick S, Schraiber JG, Jay F, Prüfer K, de Filippo C, et al. (2012). A high-coverage genome sequence from an archaic Denisovan individual. Science 338, 222–226. 10.1126/science.1224344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Prüfer K, Racimo F, Patterson N, Jay F, Sankararaman S, Sawyer S, Heinze A, Renaud G, Sudmant PH, de Filippo C, et al. (2014). The complete genome sequence of a Neanderthal from the Altai Mountains. Nature 505, 43–49. 10.1038/nature12886. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Skoglund P, Mallick S, Bortolini MC, Chennagiri N, Hünemeier T, Petzl-Erler ML, Salzano FM, Patterson N, and Reich D (2015). Genetic evidence for two founding populations of the Americas. Nature 525, 104–108. 10.1038/nature14895. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Lazaridis I, Mittnik A, Patterson N, Mallick S, Rohland N, Pfrengle S, Furtwängler A, Peltzer A, Posth C, Vasilakis A, et al. (2017). Genetic origins of the Minoans and Mycenaeans. Nature 548, 214–218. 10.1038/nature23310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Reitsema LJ, Mittnik A, Kyle B, Catalano G, Fabbri PF, Kazmi ACS, Reinberger KL, Sineo L, Vassallo S, Bernardos R, et al. (2022). The diverse genetic origins of a Classical period Greek army. Proc. Natl. Acad. Sci. U. S. A. 119, e2205272119. 10.1073/pnas.2205272119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Biagini SA, Solé-Morata N, Matisoo-Smith E, Zalloua P, Comas D, and Calafell F (2019). People from Ibiza: an unexpected isolate in the Western Mediterranean. Eur. J. Hum. Genet. 27, 941–951. 10.1038/s41431-019-0361-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Jeong C, Balanovsky O, Lukianova E, Kahbatkyzy N, Flegontov P, Zaporozhchenko V, Immel A, Wang C-C, Ixan O, Khussainova E, et al. (2019). The genetic history of admixture across inner Eurasia. Nat. Ecol. Evol. 3, 966–976. 10.1038/s41559-019-0878-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Patterson N, Moorjani P, Luo Y, Mallick S, Rohland N, Zhan Y, Genschoreck T, Webster T, and Reich D (2012). Ancient admixture in human history. Genetics 192, 1065–1093. 10.1534/GENETICS.112.145037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Alexander DH, Novembre J, and Lange K (2009). Fast model-based estimation of ancestry in unrelated individuals. Genome Res. 19, 1655–1664. 10.1101/GR.094052.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Skoglund P, Thompson JC, Prendergast ME, Mittnik A, Sirak K, Hajdinjak M, Salie T, Rohland N, Mallick S, Peltzer A, et al. (2017). Reconstructing Prehistoric African Population Structure. Cell 171, 59–71.e21. 10.1016/J.CELL.2017.08.049/ATTACHMENT/778640B8-6CB2-4996-85AF-84C35FD3C82A/MMC7.XLSX. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Lipson M, Sawchuk EA, Thompson JC, Oppenheimer J, Tryon CA, Ranhorn KL, de Luna KM, Sirak KA, Olalde I, Ambrose SH, et al. (2022). Ancient DNA and deep population structure in sub-Saharan African foragers. Nature 603, 290–296. 10.1038/s41586-022-04430-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Wang K, Goldstein S, Bleasdale M, Clist B, Bostoen K, Bakwa-Lufu P, Buck LT, Crowther A, Dème A, McIntosh RJ, et al. (2020). Ancient genomes reveal complex patterns of population movement, interaction, and replacement in sub-Saharan Africa. Sci. Adv. 6, eaaz0183. 10.1126/sciadv.aaz0183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.van de Loosdrecht M, Bouzouggar A, Humphrey L, Posth C, Barton N, Aximu-Petri A, Nickel B, Nagel S, Talbi EH, El Hajraoui MA, et al. (2018). Pleistocene North African genomes link Near Eastern and sub-Saharan African human populations. Science 360, 548–552. 10.1126/science.aar8380. [DOI] [PubMed] [Google Scholar]
- 80.Fu Q, Posth C, Hajdinjak M, Petr M, Mallick S, Fernandes D, Furtwängler A, Haak W, Meyer M, Mittnik A, et al. (2016). The genetic history of Ice Age Europe. Nature 534, 200–205. 10.1038/nature17993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Mittnik A, Wang C-C, Pfrengle S, Daubaras M, Zariņa G, Hallgren F, Allmäe R, Khartanovich V, Moiseyev V, Tõrv M, et al. (2018). The genetic prehistory of the Baltic Sea region. Nat. Commun. 9, 442. 10.1038/s41467-018-02825-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Jones ER, Gonzalez-Fortes G, Connell S, Siska V, Eriksson A, Martiniano R, McLaughlin RL, Gallego Llorente M, Cassidy LM, Gamba C, et al. (2015). Upper Palaeolithic genomes reveal deep roots of modern Eurasians. Nat. Commun. 6, 8912. 10.1038/ncomms9912. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Feldman M, Fernández-Domínguez E, Reynolds L, Baird D, Pearson J, Hershkovitz I, May H, Goring-Morris N, Benz M, Gresky J, et al. (2019). Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia. Nat. Commun. 10, 1218. 10.1038/s41467-019-09209-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Olalde I, Brace S, Allentoft ME, Armit I, Kristiansen K, Booth T, Rohland N, Mallick S, Szécsényi-Nagy A, Mittnik A, et al. (2018). The Beaker phenomenon and the genomic transformation of northwest Europe. Nature 555, 190–196. 10.1038/nature25738. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Fernandes DM, Mittnik A, Olalde I, Lazaridis I, Cheronet O, Rohland N, Mallick S, Bernardos R, Broomandkhoshbacht N, Carlsson J, et al. (2020). The spread of steppe and Iranian-related ancestry in the islands of the western Mediterranean. Nat. Ecol. Evol. 4, 334–345. 10.1038/s41559-020-1102-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Lipson M, Szécsényi-Nagy A, Mallick S, Pósa A, Stégmár B, Keerl V, Rohland N, Stewardson K, Ferry M, Michel M, et al. (2017). Parallel palaeogenomic transects reveal complex genetic history of early European farmers. Nature 551, 368–372. 10.1038/nature24476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Villalba-Mouco V, van de Loosdrecht MS, Posth C, Mora R, Martínez-Moreno J, Rojo-Guerra M, Salazar-García DC, Royo-Guillén JI, Kunst M, Rougier H, et al. (2019). Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula. Curr. Biol. 29, 1169–1177.e7. 10.1016/j.cub.2019.02.006. [DOI] [PubMed] [Google Scholar]
- 88.Rivollat M, Jeong C, Schiffels S, Küçükkalipçi İ, Pemonge M-H, Rohrlach AB, Alt KW, Binder D, Friederich S, Ghesquière E, et al. (2020). Ancient genome-wide DNA from France highlights the complexity of interactions between Mesolithic hunter-gatherers and Neolithic farmers. Sci. Adv. 6, eaaz5344. 10.1126/sciadv.aaz5344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Patterson N, Isakov M, Booth T, Büster L, Fischer C-E, Olalde I, Ringbauer H, Akbari A, Cheronet O, Bleasdale M, et al. (2022). Large-scale migration into Britain during the Middle to Late Bronze Age. Nature 601, 588–594. 10.1038/s41586-021-04287-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Narasimhan VM, Patterson N, Moorjani P, Rohland N, Bernardos R, Mallick S, Lazaridis I, Nakatsuka N, Olalde I, Lipson M, et al. (2019). The formation of human populations in South and Central Asia. Science 365. 10.1126/science.aat7487. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, Dulias K, Edwards CJ, Gandini F, Pala M, et al. (2019). The genomic history of the Iberian Peninsula over the past 8000 years. Science 363, 1230–1234. 10.1126/science.aav4040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Brunel S, Bennett EA, Cardin L, Garraud D, Barrand Emam H, Beylier A, Boulestin B, Chenal F, Ciesielski E, Convertini F, et al. (2020). Ancient genomes from present-day France unveil 7,000 years of its demographic history. Proc. Natl. Acad. Sci. U. S. A. 117, 12791–12798. 10.1073/pnas.1918034117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Schuenemann VJ, Peltzer A, Welte B, van Pelt WP, Molak M, Wang C-C, Furtwängler A, Urban C, Reiter E, Nieselt K, et al. (2017). Ancient Egyptian mummy genomes suggest an increase of Sub-Saharan African ancestry in post-Roman periods. Nat. Commun. 8, 15694. 10.1038/ncomms15694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Harney É, Cheronet O, Fernandes DM, Sirak K, Mah M, Bernardos R, Adamski N, Broomandkhoshbacht N, Callan K, Lawson AM, et al. (2021). A minimally destructive protocol for DNA extraction from ancient teeth. Genome Res. 31, 472–483. 10.1101/GR.267534.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Broushaki F, Thomas MG, Link V, López S, van Dorp L, Kirsanow K, Hofmanová Z, Diekmann Y, Cassidy LM, Díez-Del-Molino D, et al. (2016). Early Neolithic genomes from the eastern Fertile Crescent. Science 353, 499–503. 10.1126/science.aaf7943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Posth C, Zaro V, Spyrou MA, Vai S, Gnecchi-Ruscone GA, Modi A, Peltzer A, Mötsch A, Nägele K, Vågene ÅJ, et al. (2021). The origin and legacy of the Etruscans through a 2000-year archeogenomic time transect. Sci. Adv. 7, eabi7673. 10.1126/sciadv.abi7673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Aneli S, Saupe T, Montinaro F, Solnik A, Molinaro L, Scaggion C, Carrara N, Raveane A, Kivisild T, Metspalu M, et al. (2022). The Genetic Origin of Daunians and the Pan-Mediterranean Southern Italian Iron Age Context. Mol. Biol. Evol. 39. 10.1093/molbev/msac014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Marcus JH, Posth C, Ringbauer H, Lai L, Skeates R, Sidore C, Beckett J, Furtwängler A, Olivieri A, Chiang CWK, et al. (2020). Genetic history from the Middle Neolithic to present on the Mediterranean island of Sardinia. Nat. Commun. 11, 939. 10.1038/s41467-020-14523-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Allentoft ME, Sikora M, Sjögren K-G, Rasmussen S, Rasmussen M, Stenderup J, Damgaard PB, Schroeder H, Ahlström T, Vinner L, et al. (2015). Population genomics of Bronze Age Eurasia. Nature 522, 167–172. 10.1038/nature14507. [DOI] [PubMed] [Google Scholar]
- 100.Popli D, Peyrégne S, and Peter BM (2023). KIN: a method to infer relatedness from low-coverage ancient DNA. Genome Biol. 24, 10. 10.1186/s13059-023-02847-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Rohrlach AB, Tuke J, Popli D, and Haak W (2023). BREADR: An R Package for the Bayesian Estimation of Genetic Relatedness from Low-coverage Genotype Data. bioRxiv. [Google Scholar]
- 102.Onouchi Y, Ozaki K, Burns JC, Shimizu C, Terai M, Hamada H, Honda T, Suzuki H, Suenaga T, Takeuchi T, et al. (2012). A genome-wide association study identifies three new risk loci for Kawasaki disease. Nat. Genet. 44, 517–521. 10.1038/ng.2220. [DOI] [PubMed] [Google Scholar]
- 103.Hodell DA, Quinn RL, Brenner M, and Kamenov G (2004). Spatial variation of strontium isotopes (87Sr/86Sr) in the Maya region: a tool for tracking ancient human migration. J. Archaeol. Sci. 31, 585–601. 10.1016/j.jas.2003.10.009. [DOI] [Google Scholar]
- 104.Kircher M, Sawyer S, and Meyer M (2012). Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Res. 40, e3–e3. 10.1093/NAR/GKR771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Fu Q, Hajdinjak M, Moldovan OT, Constantin S, Mallick S, Skoglund P, Patterson N, Rohland N, Lazaridis I, Nickel B, et al. (2015). An early modern human from Romania with a recent Neanderthal ancestor. Nature 524, 216–219. 10.1038/nature14558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Meyer M, Stenzel U, Myles S, Prüfer K, and Hofreiter M (2007). Targeted high-throughput sequencing of tagged nucleic acid samples. Nucleic Acids Res. 35, e97. 10.1093/nar/gkm566. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.Daley T, and Smith AD (2013). Predicting the molecular complexity of sequencing libraries. Nat. Methods 10, 325–327. 10.1038/nmeth.2375. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Document S1. Figures S1–S4 and Tables S1–S3
DataS1. Supporting data for sampling, sample processing and data description, related to STAR Methods. A) Overview of sample metainformation, processing and library statistics. B) Results of AMS radiocarbon dating. C) Y-chromosomal haplogroup assignments. D) Results of relatedness analyses using BREADR and KIN.
DataS2. Supporting data for population genetic analysis, related to STAR Methods. A) Individuals included in qpAdm analysis and their population labels. B) Results of qpAdm modeling using distal source populations, related to Figure 3. C) Results of qpAdm modeling using proximal source populations, shown are working models with p>=0.01. D) Results of qpAdm modeling of Individual 52 using proximal source populations.
DataS3. Supporting data for phenotypic and disease risk assessment, related to STAR Methods. A) Phenotype probabilities assessed with the HIrisPlex-S system. B) List of markers used for assessment of phenotypic traits and disease risks. C) Genotyping results for disease risk markers, individual 22. D) Genotyping results for disease risk markers, individual 25. E) Genotyping results for disease risk markers, individual 51. F) Genotyping results for disease risk markers, individual 52. G) Genotyping results for disease risk markers, individual 53.
Data Availability Statement
All data needed to evaluate the conclusions in the paper are present in the paper and/or the supplemental information.
Newly reported ancient sequencing data have been deposited at European Nucleotide Archive (ENA) and are publicly available as of the date of publication with the following accession number ENA:PRJEB74999. Haploid genotypes for the 1240k panel for the newly reported ancient individuals, and genotype data for the newly reported present-day individuals are available at https://reich.hms.harvard.edu/datasets.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this work paper is available from the lead contact upon request.
