Skip to main content
. Author manuscript; available in PMC: 2025 Dec 16.
Published in final edited form as: Curr Biol. 2024 Nov 19;34(24):5728–5738.e4. doi: 10.1016/j.cub.2024.10.062

Key resources table.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit polyclonal anti-TEX14, 1:200 Abcam Cat# ab41733
Rabbit polyclonal anti-DDX4, 1:400 Abcam Cat# ab13840
Mouse monoclonal AF 647 anti-SYCP3, 1:100 Abcam Cat# ab205847
Mouse monoclonal AF 647 anti-MgcRacGAP, 1:100 Santa Cruz Biotechnology Cat# sc-271110
Chicken polyclonal anti-GFP, 1:400 Abcam Cat# ab13970
Donkey AF 488 anti-rabbit, 1:500 Invitrogen Cat# A21206
Donkey AF 488 anti-chicken, 1:500 Abcam Cat# ab13970
Donkey AF 647 anti-rabbit, 1:500 Invitrogen Cat# A31573
Hoechst 3342 solution, 20 mM, 1:10,000 Thermo Fisher Cat # 62249
Chemicals, peptides, and recombinant proteins
Tamoxifen Sigma Cat# T5648
Kolliphor EL Sigma Cat# C5135
Matrigel Basement Membrane Matrix VWR Cat# 47743-722
DMEM/F-12 HEPES, no phenol red Fisher/Gibco Cat# 11039021
Fetal bovine serum Bio-techne Cat# S11550
CK-666 Millipore-Sigma Cat# SML0006-5MG
DMSO Sigma Cat# D2650-5X5ML
Experimental models: Organisms/strains
Mouse: mTmG: (B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J Gift from Dr. Danelle Devenport RRID:IMSR_JAX:007676
Mouse: Oct4Cre-MerCreMer: B6(SJL)-Pou5f1tm1.1(cre/Esr1*)Yseg/J The Jackson Laboratory RRID:IMSR_JAX:016829
Mouse: H2B-miRFP740 Nunley et al51 N/A
Mouse: CD-1 IGS Charles River Laboratory Strain #022
Oligonucleotides
Primer: Tex14 knockout forward: GGCTAACTGGTGTGAGTGGA This paper N/A
Primer: Tex14 knockout reverse: TTCCTGACTCCAAGCCTAGC This paper N/A
Primer: Rbm31 forward: CACCTTAAGAACAAGCCAATACA Tunster et al52 N/A
Primer: Rbm31 reverse: GGCTTGTCCTGAAAACATTTGG Tunster et al52 N/A
Recombinant DNA
sgRNA: Tex14 knockout: AGGCUUUGGGAAUGAAAAGG This paper N/A
sgRNA: Tex14 knockout: GCUGUAAUGAAGGUCCCCCA This paper N/A
Software and algorithms
FIJI https://imagej.net/software/fiji/downloads RRID:SCR_002285
Napari https://zenodo.org/records/13863809 RRID:SCR_022765
Cellpose 2.0 Stringer et al.54 RRID:SCR_021716
Scikit-image https://github.com/scikit-image/scikit-image RRID:SCR_021142
NIS Elements Analysis Nikon RRID:SCR_014329
SnapGene Dotmatics RRID:SCR_015052
MATLAB 2022a MathWorks RRID:SCR_001622
Excel 2019 Microsoft RRID:SCR_016137
Probabilistic fracture model This paper https://zenodo.org/records/11263587