Skip to main content
Stem Cell Research & Therapy logoLink to Stem Cell Research & Therapy
. 2024 Dec 18;15:483. doi: 10.1186/s13287-024-04068-6

Time-efficient strategies in human iPS cell-derived pancreatic progenitor differentiation and cryopreservation: advancing towards practical applications

Elena Genova 1,#, Paola Rispoli 2,#, Yue Fengming 3,4, Johkura Kohei 3, Matteo Bramuzzo 1, Roberta Bulla 5, Marianna Lucafò 5, Rosalba Monica Ferraro 6, Giuliana Decorti 1,2, Gabriele Stocco 1,2,
PMCID: PMC11658428  PMID: 39695795

Abstract

Background

Differentiation of patient-specific induced pluripotent stem cells (iPS) helps researchers to study the individual sensibility to drugs. However, differentiation protocols are time-consuming, and not all tissues have been studied. Few works are available regarding pancreatic exocrine differentiation of iPS cells, and little is known on culturing and cryopreserving these cells.

Methods

We differentiated the iPS cells of two pediatric Crohn’s disease patients into pancreatic progenitors and exocrine cells, adapting and shortening a protocol for differentiating embryonic stem cells. We analyzed the expression of key genes and proteins of the differentiation process by qPCR and immunofluorescence, respectively. We explored the possibility of keeping differentiated cells in culture and freezing and thawing them to shorten the time needed for the differentiation. We analyzed the cell cycle of undifferentiated and differentiated cells by flow cytometry.

Results

The analysis of mRNA levels of key pancreatic differentiation genes PDX1 and pancreatic amylase indicate that iPS cells were successfully differentiated into pancreatic exocrine cells with expression of PDX1 (one way ANOVA p < 0.0001), and the two isoforms of amylase (one way ANOVA p < 0.05) significantly higher in exocrine cells in comparison to iPS cells. Differentiation efficiency was also confirmed by immunofluorescence analysis of PDX1 and amylase. We confirmed the possibility of shortening the time necessary for obtaining pancreatic cells without losing differentiation efficiency. Pancreatic progenitors and exocrine cells were maintained in culture and cryopreserved. Interestingly, the stemness marker OCT4 resulted significantly lower after subculturing (OCT4 p < 0.001; one-way ANOVA) and after freezing and thawing procedures (p < 0.05, one-way ANOVA) suggesting a reduction of undifferentiated stem cells leading to a purer population of pancreatic progenitor cells. Also, the stemness marker NANOG resulted lower after passaging, corroborating this result.

Conclusions

In this work, we optimized the generation of patient-specific pancreatic differentiated cells and laid the foundation for creating a bank of patient-specific pancreatic lines exploitable for tailored pharmacological assays.

Trial registration

The study was approved by the Ethical Committee of the Institute of Maternal and Child Health IRCCS Burlo Garofolo, with approval number 1556 (internal ID RC 44/22).

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-024-04068-6.

Keywords: Human induced pluripotent stem cells, Pancreatic progenitors, Pancreatic exocrine cells, Patient-specific model, Crohn’s disease.

Background

Human induced pluripotent stem cells (iPS cells) have been widely used in various research fields since their discovery in 2006 [1]. This is principally due to their ability to differentiate, under appropriate stimulation, in almost all cells of the human body, becoming an important tool for regenerative medicine, disease modeling, and drug testing [24]. Particularly, this technology is important in the field of therapy personalization, creating the possibility to investigate the cellular and molecular mechanisms underlying the individual sensibility of patients to drugs.

In the last decade, pancreatic dysfunctions have been modeled using iPS cell differentiation. Indeed, in this context, different papers are available for obtaining pancreatic cells but they mainly focus on the endocrine part rather than the exocrine [5]. Here, we apply a modified version of the differentiation method developed by Shirasawa and colleagues [6] for obtaining pancreatic exocrine acinar cells. The method was initially developed for differentiating human embryonic stem cells (hESC) into pancreatic exocrine cells while we applied it for differentiating iPS cells of two pediatric patients with Crohn’s disease. Indeed, around 5% of patients affected by inflammatory bowel diseases in treatment with thiopurines as immunosuppressants can develop pancreatitis, an idiosyncratic adverse reaction, with a higher incidence in the pediatric population [7]. Using patient-specific iPS cells and differentiated pancreatic exocrine cells it could be possible to shed light on the molecular mechanisms underlying this condition avoiding the development of this adverse effect.

The protocol consists of 4 different steps, leading to definitive endoderm, primitive gut tube cells, pancreatic progenitors, and mature exocrine cells formation in around 15 days of stimulation reducing by half the timing proposed previously without affecting the mRNA level of key differentiation genes or protein levels of important marker of differentiation [6].

One of the most time-consuming steps in this field of research is the time needed to obtain the final cell of interest (i.e. here pancreatic exocrine cells). Indeed, usually protocols for obtaining differentiated cells starting from human iPS cells require an overall long time of cell exposure to appropriate stimuli.

Therefore, beyond the time reduction of the protocol for differentiating human iPS cells in pancreatic cells, we focused on the development of a consistent strategy for maintaining in culture pancreatic progenitors and for freezing and thawing both pancreatic progenitors and exocrine cells obtained from pediatric Crohn’s patient-derived iPS cells. Here, for the first time, we show that it is possible to freeze, thaw, and maintain in culture patient-specific pancreatic progenitors and exocrine cells and to re-plate and expand pancreatic progenitors without affecting mRNA and protein expression levels of key markers involved in pancreatic cell development. Moreover, we studied the cell cycle along the differentiation procedure to obtain information about the replication of differentiated cells only partially available in the literature.

Patient-specific exocrine cells and pancreatic progenitors are precious tools for researchers, giving them the possibility to perform pharmacological assays to study patient response to drugs and to predict adverse effects. The efficient generation of patient-specific differentiated cells will facilitate the research in personalized therapy and disease modeling. Unlike advances in the iPS cell field, in the last decade the differentiation in pancreatic exocrine cells has not been extensively investigated.

Methods

Samples

Human iPS cells used in this paper were obtained by reprogramming peripheral blood mononuclear cells (PBMCs) of two patients with Crohn’s disease under pharmacological treatment. One of the two patients developed pancreatitis after thiopurine treatment as adverse effect. Briefly, PBMCs were isolated by adding an appropriate volume of Ficoll reagent (Sigma-Aldrich, Merck) to the blood of patients, and samples were centrifuged at 600 xg, 15 °C for 40 min. The intermediate phase, containing the PBMCs, was then separated, and cells were washed two times with sterile PBS. Cells were counted, frozen, and stored in liquid nitrogen until the moment of the reprogramming. Sendai virus-based vector was used, and the human iPS cells were characterized for genetic uniqueness, genomic integrity, pluripotency, and differentiation ability as reported elsewhere [8]. The analyses reported in this work were performed on one clone per cell line. The study was approved by the Ethical Committee of the Institute of Maternal and Child Health IRCCS Burlo Garofolo, with approval number 1556 (internal ID of the study RC 44/22).

Cell culture

Human iPS cells were maintained in StemMACS iPS-Brew XF medium (Miltenyi Biotec) on diluted Matrigel (Corning, Life Sciences) coated plates (1:60 Matrigel-DMEM/F12 medium) to allow cell adhesion. Cell passage was performed after reaching 80% of confluence, determined by visual examination of the cultures. Human iPS cells were passed using a standard protocol, avoiding the complete break up of clusters formed. Cells were exposed to Y-27,632 (Rock inhibitor, Miltenyi Biotec) 10 µM for 24 h to facilitate cell adhesion. As a control, we used the normal healthy pancreatic ductal line H6C7 that was maintained in Keratinocyte SFM medium (Invitrogen), and the cells were subcultured weekly when reaching 80–90% of confluence using 0.5% of Trypsin-EDTA. Cell cultures were maintained according to standard procedures in a humidified incubator at 37 °C and with 5% CO2.

Differentiation protocol

The protocol was initially developed to differentiate human ESCs into pancreatic exocrine cells [6] and slightly modified for human iPS cell differentiation, reducing in particular the time needed for obtaining exocrine cells. This protocol is based on a 4 steps procedure: (1) differentiation of human iPS cells into definitive endoderm by activin A (100 ng/mL, Sigma-Aldrich) and CHIR99021 (3 µM, Sigma-Aldrich) for 4 days (stage I); (2) differentiation into primitive gut tube by fibroblast growth factor (FGF-7 50 ng/mL, Abnova) for 3 days (stage II); (3) differentiation into pancreatic progenitor cells by a combination of cyclopamine (0.25 µM, Sigma-Aldrich), noggin (50 ng/mL, Invitrogen) and all-trans retinoic acid (2 µM, Sigma-Aldrich) (stage III) for 3 days; (4) differentiation into pancreatic exocrine cells by a combination of FGF-7 (50 ng/mL, Abnova), glucagon-like peptide 1 (100 ng/mL, RayBiotech) and nicotinamide (10 mM, Sigma-Aldrich) (stage IV) for 4 and 20 days. Cells were grown in RPMI 1640 medium (Sigma-Aldrich) with 1% of penicillin-streptomycin (EuroClone) during the differentiation process. The differentiation protocol is shown in Fig. 1. RNA samples were collected after the end of each differentiation step.

Fig. 1.

Fig. 1

Protocol for the differentiation of human iPS cells into pancreatic exocrine cells

Real-time PCR

Total RNA was extracted with TRIzol reagent (Invitrogen) according to the manufacturer’s instructions and quantified using Nanodrop 2000 spectrophotometer (ThermoFisher Scientific). RNA was reverse-transcribed into cDNA using the High-Capacity RNA-to-cDNA kit (Applied Biosystem, ThermoFisher Scientific). The real-time PCR protocol consists of an initial denaturation for 30 s at 95 °C, followed by 40 cycles of heating at 95 °C (5 s), 60 °C (1 min) and then, a final extension for 5 s at 65 °C. Real-time PCR was performed using pre-designed primers (Table 1) and the KiCqStart SYBR Green qPCR Ready Mix (Sigma-Aldrich) in a Thermal Cycle Dice Real Time System (BIO-RAD). Relative quantification is represented as 1/2−ΔCt with respect to the housekeeping gene beta-actin (ACTB). All experiments were carried out in duplicate and the reproducibility of the observations was confirmed in two or three independent experiments.

Table 1.

Primers (Sigma-Aldrich) for real-time PCR analysis of differentiation markers. ACTB (beta-actin), AMY2A and AMY2B (pancreatic isoforms of α-amylase), FOXA2 (Forkhead Box A2), HNF (hepatocyte nuclear factors), OCT4 (POU class 5 homeobox 1, MYC proto-oncogene), PDX1 (pancreatic and duodenal homeobox 1), SOX17 (SRY-box 17)

Gene Primer Sequence 5’->3’ T melting (°C) Product size (bp)
OCT4 Forward CCTCACTTCACTGCACTGTA 82.5 164
Reverse CAGGTTTTCTTTCCCTAGCT
NANOG Forward CCAGAACCAGAGAATGAAATC 58.0 120
Reverse TGGTGGTAGGAAGAGTAAAG
SOX17 Forward GGCGCAGCAGAATCCAGA 80.5 60
Reverse CCACGACTTGCCCAGCAT
FOXA2 Forward GGGAGCGGTGAAGATGGA 82.5 89
Reverse TCATGTTGCTCACGGAGGAGTA
PDX1 Forward AAAACGTAGTGATTGGAGG 86.0 122
Reverse CCAGACCTTGAAAAGAAGAC
AMY2A Forward ACCTTTCATTTACCAGGAGG 79.0 148
Reverse GTAAGACATCTTCTCTCCATTC
AMY2B Forward CTACAATGATGCTACTCAGG 79.5 181
Reverse AATTGCCTTTATGTCTCCAG
ACTB Forward CGCCGCCAGCTCACCATG 86.5 120
Reverse CACGATGGAGGGGAAGACGC

Immunofluorescence assays

To confirm the successful differentiation of human iPS cells, immunofluorescence analysis was performed analyzing PDX1 expression, a marker specific to pancreatic progenitor cells, and α-amylase expression, a marker characteristic of pancreatic exocrine cells. Undifferentiated human iPS cells and pancreatic exocrine cells (stage IV) were analyzed. Cells were cultured and differentiated in 24-well plates on Matrigel-coated glasses. Cells were washed with 500 µL of PBS, fixed with 4% paraformaldehyde in PBS (pH 7.4) for 30 min, permeabilized with 0.1% Triton X-100 in PBS, and then treated with 1.5% donkey serum to block non-specific staining. After 30 min, the following diluted primary antibodies were added and incubated overnight with the fixed cells at 4 °C using the goat anti-PDX1 (1:200; R&D Systems) and rabbit anti-α-amylase (1:500; Sigma-Aldrich) antibodies. After overnight incubation, cells were washed three times with PBS and incubated with a donkey anti-goat-PerCP 678 (1:1000 in PBS; Santa Cruz Biotechnology) or a donkey anti-rabbit 520 (1:1000 in PBS; Sigma-Aldrich) secondary antibody together with 4,6-diamidino-2-phenylindole dihydrochloride for nuclei staining (DAPI; 1:1000 in PBS). The specimens were observed by a ZEISS Axio Observer Z1 or the Nikon Eclipse E800 and images were processed using the FiJi software.

Freezing protocol of differentiated cells

The possibility of freezing pancreatic progenitors and exocrine cells was tested. The differentiation medium was removed and cells were gently washed with 2 mL of PBS. Then, cells were incubated at 37 °C with Versene for 6–9 min or with 0.05% Trypsin-EDTA 0.02% in PBS (Sigma-Aldrich) for 5 min for detaching pancreatic progenitors or exocrine cells, respectively. After the incubation time, the dissociation reagent was removed with floating cells and kept in a falcon tube. Pancreatic progenitors still attached to the well were gently detached with 2 mL of media composed by RPMI 1690 with penicillin 10,000 UI/mL (EuroClone, Milan, Italy), streptomycin 10 mg/mL (EuroClone, Milan, Italy), 1% L-glutamine 200 mM (EuroClone, Milan, Italy) and 1X B27 Supplement (Gibco) while exocrine cells with RPMI 1690 with penicillin 10,000 UI/mL (EuroClone, Milan, Italy), streptomycin 10 mg/mL (EuroClone, Milan, Italy) + 1% L-glutamine 200 mM (EuroClone, Milan, Italy), and fetal bovine serum. The dissociation reagents with floating cells were mixed with detached cells. Cells were centrifuged at 400 xg for 5 min and resuspended in 1 mL of CryoStor® cryopreservation media (Sigma-Aldrich). Cells in the CryoStor® solution were stored in appropriate cryogenic vials in a cryostep container for the first 24 h at -80 °C allowing gradual freezing. The day after, cells were moved in liquid nitrogen for long-term storage.

Thawing protocol

The process of thawing pancreatic progenitors and exocrine cells has to be quick but gentle. Before starting the process, 9 mL of stage III or stage IV differentiation media were pre-warmed in a 37 °C water bath. Then, the vial of interest containing cells was quickly thawed in a 37 °C water bath until only a small ice crystal was observable. Cells were gently transferred to the warmed medium and centrifuged for 5 min at 400 xg. The medium was removed and cells were gently resuspended in an adequate volume of fresh differentiation medium containing 10 µM of Y-27,632. The day after the media was changed with fresh differentiation media of interest. RNA samples were collected before and 4 days after thawing.

Re-plating of differentiated cells

Pancreatic progenitors and exocrine cells were detached incubating them with Versene solution for 6–9 min. Versene was collected together with the floating cells and the cells remained attached to the well with 2 mL of media composed by RPMI with penicillin 10,000 UI/mL (EuroClone, Milan, Italy), streptomycin 10 mg/mL (EuroClone, Milan, Italy), 1% L-glutamine 200 mM (EuroClone, Milan, Italy) and 1X B27 Supplement (Gibco). Cells were centrifuged at 400 xg for 5 min, the supernatant removed and the pellet resuspended in stage III medium composed of RPMI 1640 medium, cyclopamine (0.25 µM, Sigma-Aldrich), noggin (50 ng/mL, Invitrogen) and all-trans retinoic acid (2 µM, Sigma-Aldrich). Cells were seeded in a Matrigel pre-coated plate and exposed to 10 µM of Y-27,632 (Rock inhibitor, Miltenyi Biotec) for 24 h to facilitate cell adhesion. RNA samples were collected before and 3/4 days after re-plating cells.

Cell cycle

The cell cycle of human iPS cells was analyzed using the flow-cytometry propidium iodide cellular uptake assay [9]. For human iPS, cells were cultured for 72 h and harvested before reaching the confluence. Definitive endoderm and pancreatic progenitor cells were collected at the end of the days necessary to differentiate them as indicated in the differentiation protocol.

Cells (2.0 × 106) were fixed in 70% ethanol on ice, washed twice with PBS, and allowed to stay in PBS for 1 h at 4 °C. Cells were stained overnight with 2 mL of a PBS/EDTA 0.5 mM solution containing 200 µL of propidium iodide (0.1 mg/mL) and 25 µL of 1 mg/mL RNase (Sigma-Aldrich). Samples were analyzed by the flow cytometer CYTOMICSTM FC500, Beckman Coulter Inc. Fullerton, CA. All flow cytometric measurements were analyzed with the FCS Express V3.

Statistical analysis

Data were determined as means ± SD obtained from at least three independent experiments. The results were processed using GraphPad Prism 7, and analyzed with Student’s t-test or one-way ANOVA setting p < 0.05 as the significant level.

Results

Differentiation of human iPS cells into pancreatic exocrine cells

Differentiation experiments using the protocol developed for differentiating human embryonic stem cells [6] were performed on two Crohn’s disease patient-derived human iPS cell lines, studying one clone per human iPS cell line [8] (Fig. 1). Differentiation markers were analyzed by real-time PCR. The mRNA levels of OCT4, SOX17, PDX1, and the isoforms AMY2A and AMY2B of α-amylase in undifferentiated cells, definitive endoderm cells (stage I of differentiation), pancreatic progenitors (stage III of differentiation), and exocrine cells were analyzed to evaluate human iPS cell differentiation efficiency. As shown in Fig. 2, OCT4 mRNA was significantly higher in undifferentiated human iPS cells compared to the other stages (one-way ANOVA, p < 0.05, p < 0.001, p < 0.0001, respectively for endoderm cells, pancreatic progenitors, and exocrine cells). The mRNA expression of the other key markers analyzed indicates that human iPS cells were successfully differentiated into pancreatic exocrine cells. In particular, SOX17 resulted more expressed in definitive endoderm cells, despite this difference was not statistically significant probably due to the high standard deviations noticed. Moreover, PDX1 expression was higher in pancreatic progenitors, despite not significantly; on the other hand, its expression was significantly higher in exocrine cells (one-way ANOVA, p < 0.0001) compared to undifferentiated iPS cells. The two isoforms of amylase were also significantly higher in exocrine cells compared to iPS cells (one-way ANOVA, p < 0.05), as expected.

Fig. 2.

Fig. 2

Real-time PCR analysis showing the dynamics of mRNA expression for several key markers of human iPS cells differentiated to pancreatic exocrine cells applying the protocol reported in Fig. 1. Comparison between human iPS cells and differentiated counterpart (one-way ANOVA OCT4 p < 0.0001; one-way ANOVA PDX1 p < 0.0001; one-way ANOVA AMY2A p < 0.05; one-way ANOVA AMY2B p < 0.05; Dunnett’s multiple comparisons test, *: p < 0.05; ***: p < 0.001; ****: p < 0.0001). DE, definitive endoderm; PP pancreatic progenitors, EX exocrine cells

The differentiation efficiency of human iPS cells was also analyzed by immunofluorescence in terms of PDX1 and alpha-amylase protein expression. Almost all pancreatic exocrine cells obtained from human iPS cell differentiation resulted PDX1 and amylase positive, showing respectively a strong nuclear and cytoplasmic signal as expected (Fig. 3).

Fig. 3.

Fig. 3

Double immunostaining shows that positive cells for PDX1 (red) and amylase (green) are present in pancreatic exocrine cells obtained after human iPS cell differentiation (A, B). Negative control, represented by undifferentiated human iPS cells (C). In blue the nuclear staining (DAPI) is represented

To optimize the time necessary for obtaining differentiated cells, we focused on mRNA levels of exocrine cells after 4 and 20 days of stimuli exposure. Results showed no differences in terms of key marker expression (Fig. 4) between the two differentiation times. We compared pancreatic exocrine cells differentiated for 4 or 20 days to the immortalized healthy ductal pancreatic line H6C7; no differences were identified except for PDX1 levels, which resulted significantly higher (p < 0.05, one-way ANOVA) in exocrine cells differentiated for 20 days in comparison to H6C7 line. To corroborate our result, we also analyzed by immunofluorescence the protein expression of PDX1 and amylase after 4 and 20 days of stimuli exposure, respectively (Fig. 5). From this analysis, the expression of PDX1 in exocrine cells differentiated for 20 days resulted lower, indicating a reduction in terms of pancreatic progenitor cells. However, there were no changes in the expression of amylase. These results, along with those of real-time PCR analyses, suggested that it is possible to reduce the number of days of differentiation in the last step without affecting the percentage of exocrine cells obtained. Precisely, the quantification of immunofluorescence images indicated that exocrine cells differentiated for 4 days express about 40% of amylase-positive cells, while cells differentiated for 20 days present about 45% of amylase-positive cells. On the other hand, about 37% and 27% of PDX1-positive cells were found in the population differentiated for 4 and 20 days, respectively.

Fig. 4.

Fig. 4

Real-time PCR analysis showing the dynamics of mRNA expression for several key markers of pancreatic differentiation. Comparison between pancreatic exocrine cells differentiated for 4 and 20 days and the healthy pancreatic ductal cell line H6C7 (one-way ANOVA PDX1 p < 0.05; Tukey’s multiple comparisons test *: p < 0.05)

Fig. 5.

Fig. 5

Double immunostaining showing positive cells for PDX1 (red) and amylase (green) pancreatic exocrine cells obtained after human iPS cell differentiation for 4 (A) or 20 days (B). In blue the nuclear staining (DAPI) is represented. Scale bar: 20 μm (A), 50 μm (B)

No differences were identified between the two patient cell lines in terms of mRNA or protein expression (supplementary figure).

Re-plating of differentiated cells

We explored the possibility of maintaining in culture pancreatic progenitors, re-plating them twice. The mRNA levels of differentiation key genes were assessed by real-time PCR. The expression levels of all the markers considered (SOX2, NANOG, SOX17, PDX1, AMY2A, and AMY2B) were not statistically different respecting the not re-plated control (one-way ANOVA, p > 0.05) (Fig. 6), except for OCT4 level, which resulted significantly lower after re-plating cells one and two times (one-way ANOVA, p < 0.001). Also, the stemness marker NANOG was reduced after subculturing, despite this difference was not statistically significant. In addition, an increment in PDX1 and AMY2A mRNAs expression was noticed after one passage of re-plating, even if not significant.

Fig. 6.

Fig. 6

Real-time PCR analysis of mRNA expression for key markers of differentiation. Analysis of mRNA level of pancreatic progenitors maintained in culture (pancreatic progenitors) and re-plated at half density two times (passed x1, passed x2). One-way ANOVA OCT4 p < 0.001; Dunnett’s multiple comparison test ***: p < 0.001

Freezing, thawing, and re-plating of differentiated cells

We explored the possibility of freezing and thawing differentiated cells for keeping thawed cells in culture. For pancreatic progenitors, no statistically significant differences in terms of mRNA levels of all marker genes (one-way ANOVA, p > 0.05) were identified with respect to control (pancreatic progenitors not frozen and thawed), except for OCT4 level which resulted significantly reduced after freezing, thawing, and re-plating steps (one way ANOVA, p < 0.05, Dunnett’s multiple comparison test vs. pancreatic progenitors * p < 0.05) (Fig. 7). In addition, expression levels of PDX1, AMY2A, and AMY2B were higher after thawing, despite not significantly.

Fig. 7.

Fig. 7

Real-time PCR analysis shows mRNA expression dynamics for several key markers of pancreatic differentiation. Comparison of mRNA level of pancreatic progenitors after thawing and passaging. One-way ANOVA OCT4 p < 0.05; Dunnett’s multiple comparison test *: p < 0.05

Exocrine cells showed no significant differences in terms of all the mRNA levels after freezing, thawing, and re-plating steps compared to control (one-way ANOVA, p > 0.05 vs. control exocrine cells not frozen and thawed) (Fig. 8). Also in this case, expression levels of PDX1, AMY2A, and AMY2B resulted higher after thawing, even though not significantly.

Fig. 8.

Fig. 8

Real-time PCR analysis shows mRNA expression dynamics for several key markers of pancreatic differentiation. Comparison of mRNA levels of pancreatic exocrine cells in culture after thawing

For both pancreatic progenitors and exocrine pancreatic cells, no differences were identified between the two patient cell lines.

Effect of differentiation on cell cycle

The cell cycle was analyzed for human iPS cells, definitive endoderm, and pancreatic progenitors. Higher G0 percentages were shown in definitive endoderm (one-way ANOVA, p < 0.05) and progenitor cells in comparison to undifferentiated human iPS cells. No differences were highlighted in the S phase, while statistically lower levels of G2/M were identified in definitive endoderm compared to iPS (one-way ANOVA, p < 0.01) (Fig. 9). No differences were identified between the two patient cell lines.

Fig. 9.

Fig. 9

Analysis of cell cycle measured by propidium iodide uptake of human iPS cells, definitive endoderm, and pancreatic progenitor cells (G0 one-way ANOVA p < 0.05, G2/M one-way ANOVA p < 0.01, Dunnett’s multiple comparison test *: p < 0.05; **: p < 0.01)

Human iPS cell stage: the definitive endoderm was obtained after 4 days of stimulation with activin A and CHIR99021. Stage I: during the next 3 days, the medium was changed and fibroblast growth factor 7 (FGF7) was added. Stage II: the culture medium was changed and cyclopamine, noggin, and retinoic acid were added for 3 days. Stage III: the media was changed and supplemented with FGF7, glucagon-like peptide 1, and nicotinamide for 4 days. Stage IV: exocrine pancreatic cells. Cell markers: endodermal cell markers (SOX17), pancreatic progenitor cell marker (PDX1) pancreatic exocrine cell marker (alpha-amylase). The differentiation stimuli and procedure is a slightly modified version of a previously published protocol [6].

Supplementary figure. Real-time PCR analysis expression of key marker gene for each step of differentiation (human iPS – definitive endoderm DE, pancreatic progenitors PP, exocrine cells EX) compared between the two patients.

Discussion

Since their discovery in 2006 [1], human iPS cells have proven to be a useful tool for disease modeling, regenerative medicine, drug discovery, and personalized medicine [1012]. Over the years, there have been many advances in human iPS cell culture and differentiation technologies, and today, different protocols are available for differentiating them in almost every cellular type of the human body [13]. Nonetheless, available protocols often have some issues, such as the long time needed for the differentiation, the heterogenicity of differentiated cells obtained, and a lack of studies regarding the culture of cells after differentiation [14, 15].

In this work, we successfully differentiated patient-specific iPS cells into pancreatic exocrine cells, applying a protocol previously developed for ESCs [6], indicating that the protocol is versatile for both types of stem cells. This also suggests that iPS cells differentiate similarly to ESCs [16, 17], also in the context of exocrine pancreatic differentiation.

Furthermore, given that the majority of human iPS cell differentiation protocols are time-consuming, for the first time, we successfully optimized the protocol for exocrine pancreatic differentiation shortening its duration by reducing the time needed for obtaining exocrine cells. To shorten the time required for differentiation, we first examined whether shortening the pancreatic progenitors’ exposure to the final differentiation step’s stimuli would affect the expression of important marker genes. To produce mature exocrine cells, Takizawa-Shirasawa and colleagues [6] suggested subjecting pancreatic progenitors to particular stimuli for 15 days to obtain mature exocrine cells. Since 10 days are needed to obtain pancreatic progenitors from human iPS cells, the complete differentiation into exocrine pancreatic cells requires 25 days in total. Hence, there is a need to optimize the protocol as much as possible, reducing the time for obtaining exocrine pancreatic cells. Our findings suggest that it is possible to reduce from 15 to only 4 days the time necessary for differentiating pancreatic progenitors in amylase-producing cells without losing differentiation efficiency, and from 25 to 14 days the total time required. Indeed, our immunofluorescence assays indicated similar percentages of amylase-positive cells in the populations obtained after 4 (40%) and 20 days (45%) of differentiation, respectively. In this regard, the differentiation of pancreatic progenitors into acinar cells physiologically occurs from embryonic day 12 to 15 in mice [18, 19], suggesting that also in vitro a short time could be needed for obtaining exocrine pancreatic cells from iPS-derived pancreatic progenitors. Therefore, our findings are in line with this observation, suggesting that it is possible to get an efficient exocrine differentiation in only 4 days. Although human pancreatic embryogenesis is less well understood [20], the overall process is thought to be comparable to that of mice [21]. Moreover, the reduction in terms of PDX1 positive cells from about 37% after 4 days of differentiation to 27% after 20 days, as shown in our immunostaining assay, indicates a depletion of pancreatic progenitors leading to a purer culture of pancreatic exocrine cells. This finding is in line with the current literature, reporting that PDX1 is down-regulated after late embryonic development, with only a restricted subset of exocrine pancreatic cells expressing it in the postnatal pancreas [22, 23]. Even if there is a lack of studies regarding the improvement of differentiation protocols for obtaining exocrine cells, some evidence is available for other cell types [2426].

Another important issue related to human iPS cell differentiation is the difficulty of keeping in culture differentiated cells, mainly due to biological and technical factors [27]. In this context, differentiated cells generally exhibit a reduced DNA synthesis and a low replication capacity compared to their undifferentiated counterpart [28]. Nonetheless, some differentiated cells, among which pancreatic progenitors, maintain the ability to proliferate when cultured under optimal conditions [29, 30], being these cells multipotent [31]. Therefore, due to the challenges in culturing differentiated cells, we explored the possibility of keeping in culture pancreatic progenitors and exocrine pancreatic cells and freezing and thawing them after differentiation.

For the purpose of reducing the time needed for obtaining differentiated cells, we successfully maintained in culture fresh human iPS-derived pancreatic progenitors performing cell passages, without recording any reduction in PDX1 and amylase mRNAs over time, rather observing an increment of PDX1 mRNA after the first passage. In this regard, studies reported in the literature indicate that subculturing pancreatic progenitors leads to a notable increase in the proportion of PDX1 + cells. One example in this field was provided by Nakamura and co-authors in 2022 [30], who demonstrated that pancreatic progenitors’ long-term expansion leads to enrichment in PDX1 + cells. In particular, the increment over time of PDX1 in pancreatic progenitors positively affects pancreatic differentiation efficiency, being PDX1 an indispensable precursor of pancreatic development [32]. In this way, the possibility of keeping in culture pancreatic progenitors allows us to avoid starting each time from human iPS cells to obtain differentiated cells. Furthermore, PDX1-positive pancreatic progenitors are versatile cells that can be further differentiated into both exocrine and endocrine pancreatic cells [33]. Therefore, the possibility of maintaining this cellular population in culture constitutes an advantage and allows to reduce time consumption. Moreover, the stemness marker OCT4 mRNA resulted significantly lower after subculturing, suggesting a strong reduction of undifferentiated iPS cells leading to a purer population of pancreatic progenitors. Also, the stemness marker NANOG mRNA resulted lower after passaging, corroborating this result. It is known that the regulation of OCT4 expression is influenced by epigenetic changes that occur during differentiation; these modifications can silence the genes responsible for maintaining pluripotency, thus contributing to their decreased expression after passaging [34]. In summary, the decrease of OCT4 mRNA after passaging pancreatic progenitors may be primarily driven by differentiation processes [35], regulatory network changes [34], and the effect of passaging. These factors collectively contribute to the transition from a pluripotent state toward a purer differentiated pancreatic lineage. Altogether, these findings suggest that to obtain purer progenitor cultures, at least one passage should be done. This is in line with the findings reported by Konagaya and Iwata in 2019 [29], who noticed an increase in pancreatic progenitors’ markers, such as PDX1, after several passages of pancreatic progenitors.

Then, we focused on freezing, thawing, and keeping in culture thawed differentiated cells, exploring a field poorly discussed in the literature in the context of pancreatic cells. Interestingly, in our analysis we noticed a significant decrease in OCT4 mRNA expression in iPS-derived pancreatic progenitors after freezing and thawing procedures, and also in thawed pancreatic progenitors maintained in culture, in comparison to unfrozen cells, suggesting a probable reduction of undifferentiated cells. In this regard, different studies reported in the literature [3638] indicate that the cryo-preservative agent DMSO reduces OCT4-positive cells in embryoid bodies and stimulates differentiation into definitive endoderm cells, and their differentiated counterpart (i.e. pancreatic progenitors or hepatic cells). In this regard, as shown by Sousa and colleagues in 2020 [39], DMSO improves responsiveness for differentiation into multiple lineages by promoting a higher percentage of cells in the G1 phase of the cell cycle, which is crucial for effective differentiation [39]. According to these findings, even if we did not assess the cell cycle in thawed cells, we can speculate that the decrease of OCT4 could be related to this mechanism. Indeed, the solution that we used for freezing differentiated cells, the CryoStor® reagent, contains 10% DMSO, a high concentration that can be responsible for the increase of the differentiation capability. Moreover, SOX17, PDX1, and amylase mRNA levels were also increased after thawing in both pancreatic progenitors and exocrine pancreatic cells indicating an increase of differentiation. Furthermore, although the expansion of thawed pancreatic progenitors reduced PDX1 mRNA levels compared to thawed cells, it did not alter it compared to the control (not thawed), suggesting that cells can be further expanded. To the best of our knowledge, only few previous works report on the possibility of freezing, thawing, and culturing iPS-derived cells, and specifically pancreatic progenitors. For example, recently Trott and co-workers [40] and Konagaya and Iwata [29] identified different stimuli to maintain in culture pancreatic progenitors from human iPS cell lines, which were able to effectively proliferate, even after thawing, in a chemically defined medium without losing differentiation efficiency, as in our case. Although we did not notice any reduction in pancreatic progenitor proliferation, we could further implement our protocol with other combinations of stimuli [29, 40] to investigate the possibility of keeping cells in culture for a longer time and restoring the higher PDX1, AMY2A, and AMY2B mRNA levels reported after thawing. In addition, despite Trott et al. [40] and Konagaya and Iwata [29] used stimuli different from those used in our work, in 2017 other authors [41] used noggin, and B27, which are also present in our culture conditions, indicating that our mix of stimuli is suitable for maintaining proliferative pancreatic progenitor cells, strengthening the results of our study.

Despite the encouraging dynamic of mRNA marker levels described above, our analysis showed an overall decrease of all mRNA markers after the second seeding of mature exocrine cells. To date, no works are available regarding the culture of differentiated exocrine cells. Although this field is poorly discussed in the literature, we can speculate that the decrease in mRNA markers could be related to culturing conditions. Particularly, achieving high purity and functionality of iPS-derived exocrine pancreatic cells remains a challenge, mainly due to incomplete differentiation protocols, which constitutes the first issue. Moreover, it is important to optimize as much as possible the culture conditions. Indeed, exocrine pancreatic cells require a medium rich in nutrients and growth factors to support the metabolic needs of the cells. In this regard, the medium that we used is rich in growth factors necessary for pancreatic cell survival, e.g. FGF7, and GLP1 [6, 42], but it could be further enriched in nutrients. Therefore, the optimization of the culture medium is a pivotal point to address in the future. In support of this, in 2023, Inui et al. [43] developed a method for culturing, cryopreserving, and thawing human iPS cell-derived hepatocytes, overcoming issues due to the loss of hepatic functions after reseeding by applying different culture conditions and dissociation agents. Finding the optimal culture conditions for improving cell expansion and maintaining appropriate levels of specific markers could also be resolutive in our case, and our study could be optimized for long-term and stable maintenance of human iPS cell-derived pancreatic progenitors, and exocrine cells. Nonetheless, it is important to highlight that, differently from exocrine pancreatic cells, hepatocytes still retain the ability to proliferate, due to the maintenance of stemness features (e.g. high telomerase activity) [44]. Instead, as already mentioned, terminally differentiated cells, such as exocrine cells, generally exhibit a reduced DNA synthesis and a low replication capacity compared to their undifferentiated counterpart [28]. Therefore, we assume that contrary to pancreatic progenitors, which still maintain multipotent stemness characteristics, pancreatic exocrine cells cannot be extensively expanded given their terminally differentiated nature, but can probably be maintained in culture for the time necessary for performing long-term experiments, such as toxicological assays.

In the present study, we also analyzed the cell cycle of human iPS cells, definitive endoderm cells, and pancreatic progenitors using the flow-cytometry propidium iodide cellular uptake assay. Our results indicated a lower percentage of cells in the G0 phase in undifferentiated iPS cells compared to pancreatic progenitors and definitive endoderm cells. This result is in line with the well-known proliferation ability of stem cells [45] and suggests that differentiated cells are in a higher percentage in a quiescent state, as expected [28]. Then, the analyses showed similar percentages of cells in the S phase between undifferentiated iPS cells, definitive endoderm, and pancreatic progenitor cells, suggesting that, similarly to undifferentiated cells, differentiated cells can replicate DNA in culture. Lastly, a significantly larger proportion of iPS cells were in G2/M phases compared to definitive endoderm. These results are consistent with the available literature, indicating that G2-specific pathways actively promote the pluripotent state [46]. Altogether, little evidence about cell cycle progression and regulation in human iPS-derived differentiated cells is reported. A better understanding of the cell cycle in iPS and differentiated cells can be useful for example to study more accurately the cytotoxicity of cell cycle-specific drugs [47]. Therefore, despite some evidence already existing in the literature, there is a strong need for a better knowledge of the cell cycle in human iPS cells, especially in differentiated cells, which constitute a poorly investigated field.

Overall, there are still major limits in the field of iPS differentiation, such as the purity of the culture obtained, the long time needed to differentiate iPS, and the set-up of the appropriate culture conditions important for maintaining unaltered the genetic background of the patient. In addition, our study has some limitations, such as the need for a deeper characterization of differentiated cells by omics approaches. Moreover, despite the decrease of stemness markers after passaging, our population of differentiated cells is still not completely pure, due to the presence of some undifferentiated iPS cells, as indicated by other studies [48, 49]. Indeed, in order to use iPS cells or their differentiated counterpart for clinical applications, technology must be standardized to ensure safety and efficacy. Despite this aspect being currently inadequately investigated [50], in recent years many studies, among which our work, have been focusing on these challenges, making great progress in this field.

Conclusions

The results highlighted in this study are a promising starting point for optimizing existing technologies in patient-specific iPS-derived pancreatic cell differentiation and culture. In this work, we successfully differentiated patient-specific iPS cells into pancreatic exocrine cells, reduced the time needed for exocrine cell generation, and kept in culture patient-specific pancreatic cells. Our work advances the tailored therapy field, leading to relevant clinical research-related applications laying the foundation for creating a bank of patient-specific pancreatic cell lines exploitable for tailored pharmacological assays.

Electronic supplementary material

Below is the link to the electronic supplementary material.

13287_2024_4068_MOESM1_ESM.docx (127.4KB, docx)

Supplementary Material 1: Supplementary figure. Real-time PCR analysis expression of key marker gene for each step of differentiation (human iPS – definitive endoderm DE, pancreatic progenitors PP, exocrine cells EX) compared between the two patients.

Acknowledgements

The authors declare that they have not use AI-generated work in this manuscript.

Abbreviations

DMSO

Dimethyl sulfoxide

ESCs

Embryonic stem cells

FGF7

Fibroblast growth factor 7

GLP

Glucagon-like peptide

iPS cells

Induced pluripotent stem cells

HNF

Hepatocyte nuclear factor

OCT4

Octamer-binding transcription factor 4

PBMCs

Peripheral blood mononuclear cells

PDX1

Pancreatic and duodenal homeobox 1

SOX17

SRY-box transcription factor 17

SOX2

SRY-box transcription factor 2

Author contributions

EG and PR performed, analyzed, and interpreted the data and were the major contributors in writing the manuscript. RB performed cytofluorimeter experiments. FY, ML, GD, and GS interpreted the data. All authors read and approved the final manuscript.

Funding

This work was supported by the Italian Ministry of Health, through the contribution given to the Institute for Maternal and Child Health IRCCS Burlo Garofolo, Trieste, Italy. The funding for the research done in this study was provided by the Institute of Maternal and Child Health IRCCS Burlo Garofolo (Trieste) with the research grant n. RC 07/14 and 44/22.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The study was approved by the Ethical Committee of the Institute of Maternal and Child Health IRCCS Burlo Garofolo, with approval number 1556 (internal ID of the study RC 07/14 and RC 44/22). Title of the approved project: “ Patient-derived induced pluripotent stem cells for personalizing therapy: the paradigm of thiopurine pancreatitis in Crohn’s disease” and “Comparison of 2D and 3D patient-derived pancreatic exocrine models for the study of thiopurine induced pancreatitis in pediatric IBD patients: an innovative approach therapy personalization”; Name of the institutional approval committee: Ethical Committee of the Institute of Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy); Approval number: 1556; Date of approval: 14.07.2014.

Informed consent

Obtained from all subjects involved in the study.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Elena Genova and Paola Rispoli contributed equally to this work.

References

  • 1.Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126(4):663–76. [DOI] [PubMed] [Google Scholar]
  • 2.Ohnuki M, Takahashi K. Present and future challenges of induced pluripotent stem cells. Philos Trans R Soc Lond B Biol Sci. 2015;370(1680):20140367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rispoli P, Scandiuzzi Piovesan T, Decorti G, Stocco G, Lucafò M. iPSCs as a groundbreaking tool for the study of adverse drug reactions: a new avenue for personalized therapy. WIREs Mech Dis. 2024;16(1):e1630. [DOI] [PubMed] [Google Scholar]
  • 4.Yamanaka S. A fresh look at iPS cells. Cell. 2009;137(1):13–7. [DOI] [PubMed] [Google Scholar]
  • 5.Genova E, Cavion F, Lucafò M, Leo LD, Pelin M, Stocco G, et al. Induced pluripotent stem cells for therapy personalization in pediatric patients: focus on drug-induced adverse events. World J Stem Cells. 2019;11(12):1020–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Takizawa-Shirasawa S, Yoshie S, Yue F, Mogi A, Yokoyama T, Tomotsune D, et al. FGF7 and cell density are required for final differentiation of pancreatic amylase-positive cells from human ES cells. Cell Tissue Res. 2013;354(3):751–9. [DOI] [PubMed] [Google Scholar]
  • 7.Genova E, Stocco G, Decorti G. Induced pluripotent stem cells as an innovative model to study drug induced pancreatitis. World J Gastroenterol. 2021;27(35):5796–802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Lanzi G, Masneri S, Ferraro RM, Genova E, Piovani G, Barisani C, et al. Generation of 3 clones of induced pluripotent stem cells (iPSCs) from a patient affected by Crohn’s disease. Stem Cell Res. 2019;40:101548. [DOI] [PubMed] [Google Scholar]
  • 9.DeSouza N, Zhou M, Shan Y. Cell cycle analysis of CML Stem cells using Hoechst 33342 and Propidium Iodide. Methods Mol Biol Clifton NJ. 2016;1465:47–57. [DOI] [PubMed] [Google Scholar]
  • 10.Aboul-Soud MAM, Alzahrani AJ, Mahmoud A. Induced Pluripotent Stem cells (iPSCs)-Roles in Regenerative therapies, Disease Modelling and Drug Screening. Cells. 2021;10(9):2319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Talug B, Tokcaer-Keskin Z. Induced Pluripotent Stem cells in Disease Modelling and Regeneration. Adv Exp Med Biol. 2019;1144:91–9. [DOI] [PubMed] [Google Scholar]
  • 12.Rispoli P, Scandiuzzi Piovesan T, Decorti G, Stocco G, Lucafò M. A closer look at Induced Pluripotent Stem cells: IPSCS as an innovative Tool for adverse drug reactions Assessment and Therapy personalization. Advances in Health and Disease. Lowell T. Duncan; 2023. pp. 213–301.
  • 13.Philonenko ES, Shutova MV, Chestkov IV, Lagarkova MA, Kiselev SL. Current progress and potential practical application for human pluripotent stem cells. Int Rev Cell Mol Biol. 2011;292:153–96. [DOI] [PubMed] [Google Scholar]
  • 14.Paik DT, Tian L, Lee J, Sayed N, Chen IY, Rhee S, et al. Large-scale single-cell RNA-Seq reveals Molecular signatures of heterogeneous populations of Human Induced Pluripotent Stem cell-derived endothelial cells. Circ Res. 2018;123(4):443–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sun YL, Hurley K, Villacorta-Martin C, Huang J, Hinds A, Gopalan K, et al. Heterogeneity in Human Induced Pluripotent Stem Cell-derived alveolar epithelial type II cells revealed with ABCA3/SFTPC reporters. Am J Respir Cell Mol Biol. 2021;65(4):442–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yoder MC. Differentiation of pluripotent stem cells into endothelial cells. Curr Opin Hematol. 2015;22(3):252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Marei HE, Althani A, Lashen S, Cenciarelli C, Hasan A. Genetically unmatched human iPSC and ESC exhibit equivalent gene expression and neuronal differentiation potential. Sci Rep. 2017;7(1):17504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Alvarez Fallas ME, Pedraza-Arevalo S, Cujba AM, Manea T, Lambert C, Morrugares R, et al. Stem/progenitor cells in normal physiology and disease of the pancreas. Mol Cell Endocrinol. 2021;538:111459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Edlund H. Pancreatic organogenesis–developmental mechanisms and implications for therapy. Nat Rev Genet. 2002;3(7):524–32. [DOI] [PubMed] [Google Scholar]
  • 20.Hohwieler M, Müller M, Frappart PO, Heller S. Pancreatic progenitors and organoids as a prerequisite to Model Pancreatic diseases and Cancer. Stem Cells Int. 2019;2019:9301382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jennings RE, Scharfmann R, Staels W. Transcription factors that shape the mammalian pancreas. Diabetologia. 2020;63(10):1974–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Miyatsuka T, Kaneto H, Shiraiwa T, Matsuoka T, aki, Yamamoto K, Kato K, et al. Persistent expression of PDX-1 in the pancreas causes acinar-to-ductal metaplasia through Stat3 activation. Genes Dev. 2006;20(11):1435–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Stoffers DA, Heller RS, Miller CP, Habener JF. Developmental expression of the homeodomain protein IDX-1 in mice transgenic for an IDX-1 promoter/lacZ transcriptional reporter. Endocrinology. 1999;140(11):5374–81. [DOI] [PubMed] [Google Scholar]
  • 24.Liu Q, Pedersen OZ, Peng J, Couture LA, Rao MS, Zeng X. Optimizing dopaminergic differentiation of pluripotent stem cells for the manufacture of dopaminergic neurons for transplantation. Cytotherapy. 2013;15(8):999–1010. [DOI] [PubMed] [Google Scholar]
  • 25.Swistowski A, Peng J, Han Y, Swistowska AM, Rao MS, Zeng X. Xeno-free defined conditions for culture of human embryonic stem cells, neural stem cells and dopaminergic neurons derived from them. PLoS ONE. 2009;4(7):e6233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Swistowski A, Peng J, Liu Q, Mali P, Rao MS, Cheng L, et al. Efficient generation of functional dopaminergic neurons from human induced pluripotent stem cells under defined conditions. Stem Cells Dayt Ohio. 2010;28(10):1893–904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Weiskirchen S, Schröder SK, Buhl EM, Weiskirchen R. A beginner’s guide to Cell Culture: practical advice for preventing needless problems. Cells. 2023;12(5):682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Aze A, Maiorano D. Recent advances in understanding DNA replication: cell type-specific adaptation of the DNA replication program. F1000Research. 2018;7:F1000 Faculty Rev-1351. [DOI] [PMC free article] [PubMed]
  • 29.Konagaya S, Iwata H. Chemically defined conditions for long-term maintenance of pancreatic progenitors derived from human induced pluripotent stem cells. Sci Rep. 2019;9(1):640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nakamura A, Wong YF, Venturato A, Michaut M, Venkateswaran S, Santra M, et al. Long-term feeder-free culture of human pancreatic progenitors on fibronectin or matrix-free polymer potentiates β cell differentiation. Stem Cell Rep. 2022;17(5):1215–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schaffer AE, Freude KK, Nelson SB, Sander M. Nkx6 transcription factors and Ptf1a function as antagonistic lineage determinants in multipotent pancreatic progenitors. Dev Cell. 2010;18(6):1022–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Fc SA, Xp B. W. PDX-1 and the pancreas. Pancreas [Internet]. 2004 Mar [cited 2024 Oct 6];28(2). https://pubmed.ncbi.nlm.nih.gov/15028942/ [DOI] [PubMed]
  • 33.Ebrahim N, Shakirova K, Dashinimaev E. PDX1 is the cornerstone of pancreatic β-cell functions and identity. Front Mol Biosci. 2022;9:1091757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kallas A, Pook M, Trei A, Maimets T. SOX2 is regulated differently from NANOG and OCT4 in human embryonic stem cells during early differentiation initiated with Sodium Butyrate. Stem Cells Int. 2014;2014:298163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Jiang Y, Chen C, Randolph LN, Ye S, Zhang X, Bao X, et al. Generation of pancreatic progenitors from human pluripotent stem cells by small molecules. Stem Cell Rep. 2021;16(9):2395–409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Adler S, Pellizzer C, Paparella M, Hartung T, Bremer S. The effects of solvents on embryonic stem cell differentiation. Toxicol Vitro Int J Publ Assoc BIBRA. 2006;20(3):265–71. [DOI] [PubMed] [Google Scholar]
  • 37.Chetty S, Pagliuca FW, Honore C, Kweudjeu A, Rezania A, Melton DA. A simple tool to improve pluripotent stem cell differentiation. Nat Methods. 2013;10(6):553–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Czysz K, Minger S, Thomas N. DMSO efficiently down regulates pluripotency genes in human embryonic stem cells during definitive endoderm derivation and increases the proficiency of hepatic differentiation. PLoS ONE. 2015;10(2):e0117689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sousa MI, Correia B, Branco AF, Rodrigues AS, Ramalho-Santos J. Effects of DMSO on the pluripotency of cultured mouse embryonic stem cells (mESCs). Stem Cells Int. 2020;2020:8835353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Trott J, Tan EK, Ong S, Titmarsh DM, Denil SLIJ, Giam M, et al. Long-term culture of self-renewing pancreatic progenitors derived from human pluripotent stem cells. Stem Cell Rep. 2017;8(6):1675–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.S DM, Q W, F TJS. Z, Y X, Culturing and transcriptome profiling of progenitor-like colonies derived from adult mouse pancreas. Stem Cell Res Ther [Internet]. 2017 Jul 26 [cited 2024 Oct 6];8(1). https://pubmed.ncbi.nlm.nih.gov/28747214/ [DOI] [PMC free article] [PubMed]
  • 42.Wewer Albrechtsen NJ, Albrechtsen R, Bremholm L, Svendsen B, Kuhre RE, Poulsen SS, et al. Glucagon-like peptide 1 receptor signaling in Acinar cells causes growth-dependent release of pancreatic enzymes. Cell Rep. 2016;17(11):2845–56. [DOI] [PubMed] [Google Scholar]
  • 43.Inui J, Ueyama-Toba Y, Mitani S, Mizuguchi H. Development of a method of passaging and freezing human iPS cell-derived hepatocytes to improve their functions. PLoS ONE. 2023;18(5):e0285783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Rj FC, Hy JKS, By L. H, A R, Broad Distribution of Hepatocyte Proliferation in Liver Homeostasis and Regeneration. Cell Stem Cell [Internet]. 2020 Feb 1 [cited 2024 Oct 6];26(1). https://pubmed.ncbi.nlm.nih.gov/31866223/ [DOI] [PMC free article] [PubMed]
  • 45.Rivera T, Zhao Y, Ni Y, Wang J. Human-Induced Pluripotent Stem Cell Culture methods under cGMP conditions. Curr Protoc Stem Cell Biol. 2020;54(1):e117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Gonzales KAU, Liang H, Lim YS, Chan YS, Yeo JC, Tan CP, et al. Deterministic restriction on pluripotent state dissolution by cell-cycle pathways. Cell. 2015;162(3):564–79. [DOI] [PubMed] [Google Scholar]
  • 47.Genova E, Cavion F, Lucafò M, Pelin M, Lanzi G, Masneri S, et al. Biomarkers and Precision Therapy for primary immunodeficiencies: an in Vitro Study based on Induced Pluripotent stem cells from patients. Clin Pharmacol Ther. 2020;108(2):358–67. [DOI] [PubMed] [Google Scholar]
  • 48.Mitchell A, Drinnan CT, Jensen T, Finck C. Production of high purity alveolar-like cells from iPSCs through depletion of uncommitted cells after AFE induction. Differ Res Biol Divers. 2017;96:62–9. [DOI] [PubMed] [Google Scholar]
  • 49.Lin B, Kim J, Li Y, Pan H, Carvajal-Vergara X, Salama G, et al. High-purity enrichment of functional cardiovascular cells from human iPS cells. Cardiovasc Res. 2012;95(3):327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Doss MX, Sachinidis A. Current challenges of iPSC-Based Disease modeling and therapeutic implications. Cells. 2019;8(5):403. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13287_2024_4068_MOESM1_ESM.docx (127.4KB, docx)

Supplementary Material 1: Supplementary figure. Real-time PCR analysis expression of key marker gene for each step of differentiation (human iPS – definitive endoderm DE, pancreatic progenitors PP, exocrine cells EX) compared between the two patients.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Stem Cell Research & Therapy are provided here courtesy of BMC

RESOURCES