Abstract
Background
Gram-negative bacterial lipopolysaccharide (LPS) is a major component of inflammation and plays a key role in the pathogenesis of sepsis. According to our previous study, the expression of lipoprotein-associated phospholipase A2 (Lp-PLA2) is significantly upregulated in septic patients and is positively correlated with the severity of this disease. Herein, we investigated the potential roles of Lp-PLA2-targeting microRNAs (miRNAs) in LPS-induced inflammation in murine mononuclear macrophages (RAW264.7 cells).
Methods
In LPS-stimulated RAW264.7 cells, Lp-PLA2 was confirmed to be expressed during the inflammatory response. The function of microRNA-494-3p (miR-494-3p) in the LPS-induced inflammatory response of RAW264.7 cells was determined by the transfection of a miR-494-3p mimic or inhibitor in vitro.
Results
Compared to the control, LPS induced a significant increase in the Lp-PLA2 level, which was accompanied by the release of inflammatory mediators. The bioinformatics and qRT‒PCR results indicated that the miR-494-3p level was associated with Lp-PLA2 expression in the LPS-induced inflammatory response of RAW264.7 cells. Dual-luciferase reporter assay results confirmed that the 3’-UTR of Lp-PLA2 was a functional target of microRNA-494-3p. During the LPS-induced inflammatory response of RAW264.7 cells, targeting Lp-PLA2 and transfecting miR-494-3p mimics significantly upregulated the expression of miR-494-3p, leading to a reduction in the release of inflammatory factors and conferring a protective effect on LPS-stimulated RAW264.7 cells.
Conclusion
By targeting Lp-PLA2, miR-494-3p suppresses Lp-PLA2 secretion, thereby alleviating LPS-induced inflammation, which indicates that miR-494-3p may be a potential target for sepsis treatment.
Keywords: Sepsis, microRNAs, miR-494-3p, Lipopolysaccharide, Lipoprotein-associated phospholipase A2
Introduction
Sepsis, described as an uncontrolled inflammatory response that results in life-threatening organ damage, has emerged as an important global health issue [1]. According to global burden of disease studies, the incidence of sepsis decreased from 1990 to 2017, but alarmingly, 19.7% of all deaths in 2017 were related to sepsis [2]. Although prevention and treatment strategies have improved significantly, sepsis remains one of the leading causes of death among critically ill patients worldwide [2]. In gram-negative bacterial infections, lipopolysaccharides (LPS), which are key components of the pathogenesis of sepsis, are released. In sepsis, mononuclear macrophages play an important role as members of the innate immune system [3]. Inflammatory cytokines, such as TNF-α, IL-1β, and IL-6, are released by mononuclear macrophages as part of their function [4]. Sepsis-associated multiple organ failure can occur as a result of the excessive release of inflammatory cytokines [5, 6]. It is therefore clear that the activation of mononuclear macrophages plays an important role in the inflammatory response and multiorgan failure triggered by sepsis [7]. It is highly important to investigate the activation and regulatory mechanisms of monocyte macrophages in sepsis.
MicroRNAs (miRNAs) are a class of short noncoding RNAs that bind to the 3’-untranslated region (UTR) of target mRNAs, degrading those target mRNAs and inhibiting their translation [8, 9]. Several miRNAs have been shown to be associated with LPS-induced macrophage inflammation [10–13]. However, the functions of many miRNAs in inflammatory responses have yet to be explored.
Lipoprotein-associated phospholipase A2 (Lp-PLA2), a unique member of the PLA2 family, is also known as platelet-activating factor acetylhydrolase (PAF-AH) [14, 15]; it is an inflammatory factor that has been widely studied in recent years. Lp-PLA2 is primarily secreted by mononuclear macrophages [16], and after its release, it binds partially to low-density lipoprotein B, which is then oxidized and cleaved into bioactive compounds, such as oxidized phosphatidylcholine, lysophosphatidylcholine, and oxidized free fatty acids, all of which are believed to have inflammation-inducing properties [16, 17]. Our previous studies have shown that Lp-PLA2 is highly expressed in patients with sepsis and is positively correlated with disease severity. Therefore, Lp-PLA2 has prognostic value in the early diagnosis of sepsis and evaluation of prognosis [18].
Methods
Cell culture and stimulation
Murine macrophages (RAW 264.7 cells) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) supplemented with 10% foetal bovine serum (FBS, Gibco, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (C100C5, New Cell and Molecular Biotech, China) in a humidified atmosphere with 5% CO2 at 37 °C. At a dose of 1 µg/mL, LPS (Sigma, USA) was used to establish the septic cellular model. Additionally, parallel cultures of control cells were generated without treatment. A sample of cells or supernatants was collected for analysis at the appropriate time points.
Cell transfection
The miR-494-3p mimic (5′-UGAAACAUACACGGGAAACCUC-3′; 50 nM), mimic negative control (mimic NC, 5′-UUUGUACUACACAAAAGUACUG-3′; 50 nM), miR-494-3p inhibitor (5′-ACUUUGUAUGUGCCCUUUGGAG-3′; 50 nM), and inhibitor NC (5′-CAGUACUUUUGUGUAGUACAAA-3′; 50 nM) were synthesized, and those oligonucleotides were transfected using a RiboFECT™ CP Transfection Kit (all from RiboBio, Guangzhou, China) in accordance with the manufacturer’s instructions. After 24 h of transfection, cells in 6-well culture plates (1.2 × 106 cells/well) were stimulated with 1 µg/ml LPS at 37 °C in 5% CO2 for 24 h. The expression levels of miR-494-3p, Lp-PLA2, TNF-α, IL‐6 and IL‐1β were evaluated by qRT‒PCR and ELISAs.
Cell proliferation assay
The RNA mimic, mimic NC, inhibitor and inhibitor NC were transfected into 30–50% confluent RAW 264.7 cells. The cells were resuspended for two days and then seeded into 96-well culture plates (5000 cells/well) overnight. Complete culture medium containing LPS (1 µg/mL) was added, and the cells were incubated for 24 h. Then, 10 µL of CCK-8 solution (C0039, Beyotime, Shanghai, China) was added to each well, followed by incubation at 37 °C and 5% CO2 for 1.5 h. The optical density at a wavelength of 450 nm (OD450) was measured. Cell proliferation was analysed by EdU staining (C0071S, BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 488, Beyotime, Shanghai, China). We incubated the cells with EdU for 2 h, fixed the cells with 4% paraformaldehyde for 30 min, and permeabilized the cells with 0.3% Triton X-100 for another 30 min. The cells were incubated with the Click Reaction Mixture for 30 min at room temperature in the dark before being incubated with Hoechst 33,342 for 10 min.
Determination of nitric oxide (NO) content
The supernatants from each well were collected, and the relative content of nitric oxide (NO) in the supernatants was measured. The relative NO content was measured with a NO assay kit (S0021, Beyotime Institute of Biotechnology, Shanghai, China) according to the instructions provided by the manufacturer. Each experiment was independently performed three times.
Measurement of acid phosphatase (ACP) activity
Acid phosphatase (ACP) activity was measured with a commercially available acid phosphatase assay kit (P0326, Beyotime, Shanghai, China) according to the manufacturer’s instructions. After treatment using the aforementioned method in 6-well culture plates, lysed cells were harvested, and the supernatant was collected. The absorbance of each well at 405 nm was quantified.
Enzyme-linked immunosorbent assays (ELISAs)
ELISA kits for the detection of Lp-PLA2 (CSB-E08321m, Cusabio, USA), TNF-α (SEKM-0034, Solarbio, China), IL-6 (SEKM-0007, Solarbio, China) and IL-1β (SEKM-0002, Solarbio, China) were obtained from Solarbio (Solarbio, Beijing, China). The levels of Lp-PLA2, TNF-α, IL-6 and IL-1β were analysed with corresponding ELISA kits according to the manufacturer’s instructions. Then, the absorbance of the coloured product was measured at 405 nm by an automated plate reading system (FlexStation 3, Molecular Device, Sunnyvale, CA, USA). Each experiment was independently performed three times.
Dual-luciferase reporter assays
The 3′-UTR sequence of Lp-PLA2 was cloned and inserted into the pmiR-RB-Report™ reporter plasmid to verify that miR-494-3p can bind to the miR-494-3p target Lp-PLA2. With respect to the pmiR-RB-Report™ vector (RiboBio, Guangzhou, China), the wild-type and mutant 3′-UTR fragments were cloned downstream of the luciferase reporter gene. Before transfection, RAW 264.7 cells were seeded into 96-well plates at a density of 1 × 104 cells/well. Then, the cells were cotransfected with the luciferase reporter vectors and the miR-494-3p mimic or the corresponding negative control using a RiboFECT™ CP Transfection Kit. After 24 h, luciferase activity was analysed using the Dual-Luciferase® Reporter Assay system (Promega Corporation). The relative changes in luciferase activity via Renilla fluorescence were calculated to identify the regulatory effect of miRNAs on this gene.
RNA isolation, reverse transcription‒PCR and real-time quantitative PCR (qRT‒PCR)
Total RNA was isolated from cells by using RNAiso Plus (Takara, Beijing, China) and dissolved in RNase-free water according to the manufacturer’s instructions. Quality inspection and control were conducted using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) with optical density measurements at A260/A280 = 1.8 − 2.2. Reverse transcription was performed using HiScript® II Q RT SuperMix for qRT‒PCR (+ gDNA wiper) (Vazyme, Nanjing, China). Then, 1 µg of total RNA, RNase-free ddH2O and 4× gDNA wiper mix were incubated at 42 °C for 2 min to remove genome contamination, and 5× HiScript II qRT SuperMix II was added to the reaction mixture. The mixture was gently blown and mixed well and then incubated at 50 °C for 15 min and 85 °C for 5 s. A LightCycler® Carousel-Based System apparatus (Roche Applied Science, Mannheim, Germany) with primers for specific mRNAs, ddH2O and ChamQ Universal SYBR qRT‒PCR Master Mix (Vazyme, Nanjing, China) was used for real-time PCR of the resulting cDNA. The mixtures were quantified using a real-time device under standard thermal conditions: 95 °C for 30 s; 40 cycles of 95 °C for 10 s and 60 °C for 30 s; followed by 95 °C for 15 s, 60 °C for 30 s and 95 °C for 15 s. All results were normalized to GAPDH. The 2-ΔΔCq method was used to quantify the relative gene expression levels. As shown in Table 1, the sequences of the primers for GAPDH, IL-1β, IL-6 and TNF-α were designed with the National Center for Biotechnology Information Primer-Blast tool and synthesized by Genewiz, Inc. (Genewiz, Suzhou, China). Three independent experiments were performed for each reaction in triplicate.
Table 1.
Primer sequences for qRT‒PCR
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| TNF-a | TATGGCTCAGGGTCCAACTC | GGAAAGCCCATTTGAGTCCT |
| IL-1β | AGTTGACGGACCCCAAAA | AGCTGGATGCTCTCATCAGG |
| IL-6 | CACGGCCTTCCCTACTTCAC | TGCAAGTGCATCATCGTTGT |
| GAPDH | CAGGTTGTCTCCTGCGACTT | TATGGGGGTCTGGGATGGAA |
GAPDH, glyceraldehyde-3-phosphate dehydrogenase
With U6 small nuclear RNA as an internal reference, miR-494-3p levels were quantified by qRT‒PCR. Bulge-Loop™ miRNA primer sets (one RT primer and a pair of qRT‒PCR primers for each set) specific for miR-494-3p were designed by RiboBio (Guangzhou, China). The sequences of the miR-494-3p RT primer (ssD809230229), miR reverse primer (ssD089261711), and 494-3p forward primer (ssD809230921) are proprietary.
Statistical analysis
All experiments were repeated at least three times. Statistical calculations were performed using IBM SPSS Statistics 20 and GraphPad Prism 8, and the data are presented as the mean ± standard deviation (SD). Differences between groups were tested using Student’s t test for two groups and one-way ANOVA or two-way ANOVA for three or more groups. Differences between groups were considered significant at p < 0.05.
Results
Expression of Lp-PLA2 in the inflammatory response of LPS-stimulated RAW264.7 cells
As part of our preliminary study, we conducted a statistical analysis of the serum levels of Lp-PLA2, C-reactive protein, procalcitonin, and interleukin 6, sequential organ failure (SOFA) scores and acute physiology and chronic health evaluation II (APACHE II) scores between 151 patients with sepsis (39 with sepsis, 55 with severe sepsis and 57 with septic shock) and 30 healthy controls. According to our findings, Lp-PLA2 levels were significantly greater in sepsis patients than healthy control subjects. Furthermore, we observed a positive correlation between Lp-PLA2 levels and APACHE II scores as well as mortality rates. In addition, Lp-PLA2 was positively associated with commonly used clinical inflammatory markers such as CRP, PCT, and IL-6. Therefore, we believe that Lp-PLA2 can be used as an indicator for assessing the severity and prognosis of sepsis in a clinical setting [18]. To further understand the role of Lp-PLA2 in sepsis pathogenesis, we conducted in vitro experiments. In the initial studies, we measured the secretion of inflammatory cytokines from LPS-stimulated RAW264.7 cells using qRT‒PCR and found that the levels of IL-1β, IL-6, and TNF-α were significantly higher in LPS-stimulated cells than in control cells (Fig. 1A-C). Subsequently, ELISAs were employed to quantify the concentration of Lp-PLA2 in cell culture supernatants, revealing significantly elevated levels in the LPS group compared to those in the control group (Fig. 1D). Consequently, we conclude that inflammation induced by LPS increases the secretion of Lp-PLA2.
Fig. 1.
Relative expressions and concentrations of IL-1β, IL-6, TNF-α, and Lp-PLA2. (A, B, and C) The mRNA expression levels of IL-1β, IL-6, and TNF-α in RAW264.7 cells 24 h after LPS (1 µg/mL) stimulation as measured by qRT‒PCR. (D) The concentrations of Lp-PLA2 as measured by ELISA. Parametric data were analysed by paired t tests and are displayed as the mean ± SD. N = 3, ** p < 0.01, **** p < 0.0001
Lp-PLA2 is targeted by miR-494-3p
Using bioinformatics databases such as TargetScan, miRanda, and PicTar, we screened for miRNAs that may modulate the expression of Lp-PLA2 to identify potential regulatory molecules. Through a comprehensive analysis of the literature, we were able to establish a strong correlation between miR-494-3p and Lp-PLA2. To investigate the cellular secretion of Lp-PLA2, we transfected a miR-494-3p mimic and inhibitor into RAW264.7 cells. Based on the results, the miR-494-3p mimic significantly suppressed Lp-PLA2 release in RAW264.7 cells, whereas the miR-494-3p inhibitor enhanced Lp-PLA2 release, suggesting that miR-494-3p has an inhibitory effect on Lp-PLA2 (Fig. 2A). Furthermore, we performed dual-luciferase reporter assays to further validate the correlation. Using the pmiR-RB-Report™ vector, we cloned the predicted target sequences of miR-494-3p from the 3’-UTR of Lp-PLA2 and mutants. Then, we cotransfected the miR-494-3p mimic and the pmiR-RB-Report™ vector into RAW264.7 cells. Inhibition of luciferase activity was observed following transfection with the miR-494-3p mimic and pmiR-RB-ReportTM–Lp-PLA2-wild-type plasmid but not with the pmiR-RB-ReportTM–Lp-PLA2-mutant plasmid, indicating that miR-494-3p binds specifically to the 3′-UTR of Lp-PLA2.
Fig. 2.

Cell proliferation and luciferase assay results. (A) The concentrations of Lp-PLA2 as determined by ELISA. (B) The results of the luciferase assay showed the relative activity of Lp-PLA2, indicating that miR-494-3p mimic transfection significantly inhibited wild-type luciferase activity in the 3′-UTR of Lp-PLA2 but had no effect on the mutated 3′-UTR of Lp-PLA2 (p < 0.05). Parametric data were analysed by paired t tests and are displayed as the mean ± SD. N = 3, * p < 0.05, ** p < 0.01, *** p < 0.001
Role of mir-494-3p in the inflammatory response of LPS-stimulated in RAW264.7 cells
To investigate possible alterations in miR-494-3p expression in LPS-stimulated RAW264.7 cells, we conducted qRT‒PCR analysis. The results demonstrated the upregulation of miR-494-3p expression following LPS stimulation (Fig. 3A). We transfected the miR-494-3p mimic and inhibitor into LPS-stimulated RAW264.7 cells and compared those cells with control cells to determine whether miR-494-3p regulates the inflammatory response. A subsequent analysis was conducted using qRT‒PCR to evaluate the efficiency of the transfection process and determine the relative expression of IL-1β, IL-6, and TNF-α (Fig. 3B). The overexpression of miR-494-3p in RAW264.7 cells treated with LPS significantly decreased the expression levels of IL-1β, IL-6, and TNF-α. To validate this discovery, we used a miR-494-3p inhibitor to suppress its expression, resulting in an increase in inflammatory factors in RAW264.7 cells (Fig. 3C-E); The ELISA results supported the abovementioned findings (Fig. 3F-H). Based on the results of these experiments, miR-494-3p mitigates the inflammatory response in LPS-stimulated RAW264.7 cells.
Fig. 3.
Expression of inflammatory factors in RAW264.7 cell culture supernatants was affected by transfection with miR-494-3p. (A) qRT‒PCR was used to determine the relative expression of miR-494-3p in RAW264.7 cells 24 h after LPS stimulation (1 µg/mL). (B) RAW264.7 cells were transfected with 50 nM miR-494-3p mimic, inhibitor or NC. Transfection efficiency was confirmed 24 h later by qRT‒PCR later. (C, D and E) Expression levels of IL-1β, IL-6 and TNF-α mRNA were measured by qRT‒PCR. (F-K) Lp-PLA2, IL-6, IL-1β, and TNF-α concentrations were determined by ELISAs. Parametric data were analysed by paired t tests and are displayed as the mean ± SD. N = 3, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001
Impact of mir-494-3p on LPS-stimulated RAW264.7 cell viability and proliferation
To examine the impact of miR-494-3p on the viability of LPS-stimulated RAW264.7 cells, a CCK-8 assay was performed. Based on the findings, LPS stimulation enhanced cellular metabolism, whereas the overexpression of miR-494-3p inhibited this enhancement; conversely, the downregulation of miR-494-3p expression further enhanced cellular metabolism (Fig. 4A-C). EdU cell proliferation experiments were conducted to investigate the effect of miR-494-3p on cell proliferation. LPS stimulation inhibited cellular proliferation, which was mitigated by the upregulation of miR-494-3p expression and exacerbated by the downregulation of miR-494-3p expression (Fig. 4D-E). The data presented herein demonstrate that miR-494-3p inhibits the LPS-induced activation of RAW264.7 cells while simultaneously mitigating the LPS-induced inhibition of proliferation.
Fig. 4.
CCK8 assay and EdU staining results. (A) CCK-8 assays comparing the control group and LPS-treated group. (B) CCK-8 assays after overexpressing miR-494-3p. (C) CCK-8 assays after downregulating miR-494-3p expression. (D and E) EdU staining results for each group. Green, EdU-positive cells; blue, Hoechst 33,342 (nucleus). Scale bar, 50 μm. Parametric data were analysed by paired t tests and are displayed as the mean ± SD. N = 3, * p < 0.05, ** p < 0.01, *** p < 0.001
Protective effect of mir-494-3p in LPS-stimulated RAW264.7 cells
We found that LPS stimulation resulted in a decrease in intracellular ACP activity (Fig. 5A). The overexpression of miR-494-3p alleviated the LPS-induced decrease in ACP activity in RAW264.7 cells; the knockdown of miR-494-3p made this LPS-induced decrease more pronounced (Fig. 5B). In addition, LPS stimulation significantly increased NO release from RAW264.7 cells (Fig. 5C), while the overexpression of miR-494-3p reduced NO release, and the knockdown of miR-494-3p increased this release (Fig. 5D). In conclusion, these findings suggest that miR-494-3p protects against LPS-induced damage in RAW264.7 cells.
Fig. 5.
Effects of miR-494-3p on intracellular ACP activity and the concentration of NO in LPS-stimulated RAW264.7 cells. (A and B) Effects of LPS on the activity of ACP in RAW264.7 cells. (C and D) NO secretion by RAW264.7 cells. Parametric data were analysed by paired t tests and are displayed as the mean ± SD. N = 3, * p < 0.05, ** p < 0.01, *** p < 0.001. **** p < 0.0001
Discussion
Our team investigated the potential roles of Lp-PLA2-targeting microRNAs (miRNAs) in LPS-induced inflammation in RAW264.7 cells. Previous studies have demonstrated that RAW264.7 cells can be stimulated with LPS to create a cellular model of sepsis [19]. LPS can induce M1-like macrophages, and the upregulation of TNF-α [20] and iNOS [21] are biomarkers of M1 activation [22, 23]. As demonstrated by our results, RAW264.7 cells stimulated with LPS released more TNF-α and NO, indicating the successful establishment of an inflammation model.
Lp-PLA2 has attracted much attention in recent years [24, 25]; when released, it is oxidized and cleaved into biologically active compounds that are thought to have inflammatory properties [26, 27]. In addition, there has been an increase in research focusing on miRNAs as key components of innate immunity [11, 28–30]. Exosomal miR-30d-5p from polymorphonuclear neutrophils (PMNs) promotes sepsis-related acute lung injury (ALI) by activating M1 macrophage polarization and inducing macrophage pyroptosis through NF-B signalling [31]. In our study, Lp-PLA2 was confirmed to be a target of microRNA-494-3p via dual-luciferase reporter assays, and miR-494-3p inhibited the release of Lp-PLA2.
Sepsis is a life-threatening inflammatory response that damages organs. Inhibiting the inflammatory response is an effective way to treat sepsis. To investigate the inhibition of inflammatory responses, it is crucial to understand what specific cytokines are released and which signalling pathways are activated when the immune system is stimulated with LPS [32–34]. The results of this study showed that miR-494-3p overexpression reduced the release of LPS-induced inflammatory factors in RAW264.7 cells, weakened the effect of LPS on RAW264.7 cell function and played an anti-inflammatory role. Therefore, targeting miR-494-3p may be a promising therapeutic strategy for the management of sepsis.
Although the present study yielded valuable results regarding the role of miR-494-3P in sepsis, there are some notable limitations. The findings were only verified at the cellular level; that is, in vivo animal experiments were not conducted, and clinical data were not analysed. In addition, there is a lack of studies on the role of miR-494-3p in signalling pathways associated with inflammation. In addition to in vivo animal experiments, a focus of future investigations of miR-494-3p will be to elucidate the precise mechanism by which miR-494-3p inhibits inflammation through Lp-PLA2.
Conclusion
There have been many advances in epidemiological research, risk factor identification, pathophysiology understanding, and prognosis assessments for patients with sepsis, all of which have greatly contributed to our understanding of this condition and improved our ability to prevent, detect, and treat it effectively. However, sepsis remains a substantial global health concern requiring further investigation to assist clinicians in early recognition, diagnosis, and treatment. Building upon our previous findings of elevated levels of Lp-PLA2 in the serum of sepsis patients, the results of this study demonstrated that miR-494-3p mitigates LPS-induced inflammation in RAW264.7 cells by suppressing the secretion of Lp-PLA2, thereby conferring a certain degree of cellular protection.
Author contributions
(I) Conception and design: Z Huang, H Miao; (II) Administrative support: Y Yan; (III) Provision of study materials or patients: Y Yan; (IV) Collection and assembly of data: W Xiao; (V) Data analysis and interpretation: W Xiao; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.
Funding
This research received funding from the National Natural Science Foundation of China Youth Found (81801893); the Jiangsu Planned Projects for Postdoctoral Research Fund (No. 2021K031A); the Deputy General Manager Project of Science and Technology of Jiangsu Province (No. FZ20210652); and the Science and Technology Research Plan Project of Rugao (No. RG2021SZL001, SRG(22)1047).
Declarations
Ethical approval
The animal study protocol was approved by the Institutional Review Board (or Ethics Committee) of Nantong University (S20230321-005).
Competing interests
All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or nonfinancial interest in the subject matter or materials discussed in this manuscript.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Wenxiao Yan, Yan Yan and Xinye Luo contributed equally to this work.
Contributor Information
Hua Miao, Email: 13511590292@163.com.
Zhongwei Huang, Email: tdfyhuangzw@163.com.
Haiyan Jiang, Email: jhy@ntu.edu.cn.
References
- 1.Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL. D.C. Angus, the Third International Consensus definitions for Sepsis and septic shock (Sepsis-3). JAMA 2016;315(8):801– 10. [DOI] [PMC free article] [PubMed]
- 2.Rudd KE, Johnson SC, Agesa KM, Shackelford KA, Tsoi D, Kievlan DR, Colombara DV, Ikuta KS, Kissoon N, Finfer S, Fleischmann-Struzek C, Machado FR, Reinhart KK, Rowan K, Seymour CW, Watson RS, West TE, Marinho F, Hay SI, Lozano R, Lopez AD, Angus DC, Murray CJL, Naghavi M. Global, regional, and national sepsis incidence and mortality, 1990–2017: analysis for the global burden of Disease Study. Lancet. 2020;395(10219):200–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Sun X, Liu Y, Wang J, Zhang M, Wang M. Cardioprotection of M2 macrophages-derived exosomal microRNA-24-3p/Tnfsf10 axis against myocardial injury after sepsis. Mol Immunol. 2021;141:309–17. [DOI] [PubMed] [Google Scholar]
- 4.Lee SM, Son KN, Shah D, Ali M, Balasubramaniam A, Shukla D, Aakalu VK. Histatin-1 attenuates LPS-Induced Inflammatory Signaling in RAW264.7 macrophages. Int J Mol Sci 2021;22(15):. [DOI] [PMC free article] [PubMed]
- 5.Sakamaki I, Fukushi M, Ohashi W, Tanaka Y, Itoh K, Tomihara K, Yamamoto Y, Iwasaki H. Sitafloxacin reduces tumor necrosis factor alpha (TNFalpha) converting enzyme (TACE) phosphorylation and activity to inhibit TNFalpha release from lipopolysaccharide-stimulated THP-1 cells. Sci Rep. 2021;11(1):24154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Lopez-Bojorquez LN, Dehesa AZ, Reyes-Teran G. Molecular mechanisms involved in the pathogenesis of septic shock. Arch Med Res. 2004;35(6):465–79. [DOI] [PubMed] [Google Scholar]
- 7.Biswas SK, Lopez-Collazo E. Endotoxin tolerance: new mechanisms, molecules and clinical significance. Trends Immunol. 2009;30(10):475–87. [DOI] [PubMed] [Google Scholar]
- 8.Ha M, Kim VN. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol. 2014;15(8):509–24. [DOI] [PubMed] [Google Scholar]
- 9.Stavast CJ, Erkeland SJ. The non-canonical aspects of MicroRNAs: many roads to Gene Regulation. Cells 2019;8(11). [DOI] [PMC free article] [PubMed]
- 10.Wang J, Song J, Li Y, Shao J, Xie Z, Sun K. Down-regulation of LncRNA CRNDE aggravates kidney injury via increasing MiR-181a-5p in sepsis. Int Immunopharmacol. 2020;79:105933. [DOI] [PubMed] [Google Scholar]
- 11.Wang S, Yang Y, Suen A, Zhu J, Williams B, Hu J, Chen F, Kozar R, Shen S, Li Z, Jeyaram A, Jay SM, Zou L, Chao W. Role of extracellular microRNA-146a-5p in host innate immunity and bacterial sepsis. iScience. 2021;24(12):103441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chen W, Gao G, Yan M, Yu M, Shi K, Yang P. Long noncoding RNA MAPKAPK5-AS1 promoted lipopolysaccharide-induced inflammatory damage in the myocardium by sponging microRNA-124-3p/E2F3. Mol Med. 2021;27(1):131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Yao Y, Xu K, Sun Y, Tian T, Shen W, Sun F, Yuan W, Wu H, Chen G, Yuan L, Zhang W, Lu M, Lei M. MiR-215-5p inhibits the inflammation injury in septic H9c2 by regulating ILF3 and LRRFIP1. Int Immunopharmacol. 2020;78:106000. [DOI] [PubMed] [Google Scholar]
- 14.Dennis EA, Cao J, Hsu YH, Magrioti V, Kokotos G. Phospholipase A2 enzymes: physical structure, biological function, disease implication, chemical inhibition, and therapeutic intervention. Chem Rev. 2011;111(10):6130–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Huang F, Wang K, Shen J. Lipoprotein-associated phospholipase A2: the story continues. Med Res Rev. 2020;40(1):79–134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Zalewski A, Macphee C. Role of lipoprotein-associated phospholipase A2 in atherosclerosis: biology, epidemiology, and possible therapeutic target. Arterioscler Thromb Vasc Biol. 2005;25(5):923–31. [DOI] [PubMed] [Google Scholar]
- 17.Staurenghi G, Ye L, Magee MH, Danis RP, Wurzelmann J, Adamson P, McLaughlin MM, Darapladib DMESG. Darapladib, a lipoprotein-associated phospholipase A2 inhibitor, in diabetic macular edema: a 3-month placebo-controlled study. Ophthalmology. 2015;122(5):990–6. [DOI] [PubMed] [Google Scholar]
- 18.Huang Z, Jiang H, Cui X, Liang G, Chen Y, Wang T, Sun Z, Qi L. Elevated serum levels of lipoprotein–associated phospholipase A2 predict mortality rates in patients with sepsis. Mol Med Rep. 2018;17(1):1791–8. [DOI] [PubMed] [Google Scholar]
- 19.Tucureanu MM, Rebleanu D, Constantinescu CA, Deleanu M, Voicu G, Butoi E, Calin M, Manduteanu I. Lipopolysaccharide-induced inflammation in monocytes/macrophages is blocked by liposomal delivery of Gi-protein inhibitor. Int J Nanomed. 2018;13:63–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.He W, Qu T, Yu Q, Wang Z, Lv H, Zhang J, Zhao X, Wang P. LPS induces IL-8 expression through TLR4, MyD88, NF-kappaB and MAPK pathways in human dental pulp stem cells. Int Endod J. 2013;46(2):128–36. [DOI] [PubMed] [Google Scholar]
- 21.Lee HN, Shin SA, Choo GS, Kim HJ, Park YS, Kim BS, Kim SK, Cho SD, Nam JS, Choi CS, Che JH, Park BK, Jung JY. Antiinflammatory effect of quercetin and galangin in LPSstimulated RAW264.7 macrophages and DNCBinduced atopic dermatitis animal models. Int J Mol Med. 2018;41(2):888–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Boda SK, Aparicio C. Dual keratinocyte-attachment and anti-inflammatory coatings for soft tissue sealing around transmucosal oral implants. Biomaterials Sci. 2022. [DOI] [PubMed]
- 23.Zhang H, Zhang M, Wang X, Zhang M, Wang X, Li Y, Cui Z, Chen X, Han Y, Zhao W. Electrospun multifunctional nanofibrous mats loaded with bioactive anemoside B4 for accelerated wound healing in diabetic mice. Drug Delivery. 2022;29(1):174–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jiang X, Xu J, Hao X, Xue J, Li K, Jin A, Lin J, Meng X, Zheng L, Wang Y. Elevated lipoprotein(a) and lipoprotein-associated phospholipase A2 are associated with unfavorable functional outcomes in patients with ischemic stroke. J Neuroinflamm. 2021;18(1):307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mouchlis VD, Hayashi D, Vasquez AM, Cao J, McCammon JA, Dennis EA. Lipoprotein-associated phospholipase A2: a paradigm for allosteric regulation by membranes. Proc Natl Acad Sci USA 119(2). 2022. [DOI] [PMC free article] [PubMed]
- 26.Lv SL, Zeng ZF, Gan WQ, Wang WQ, Li TG, Hou YF, Yan Z, Zhang RX, Yang M. Lp-PLA2 inhibition prevents Ang II-induced cardiac inflammation and fibrosis by blocking macrophage NLRP3 inflammasome activation. Acta Pharmacol Sin. 2021;42(12):2016–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Deng M, Yin Y, Zhang Q, Zhou X, Hou G. Identification of inflammation-related Biomarker Lp-PLA2 for patients with COPD by Comprehensive Analysis. Front Immunol. 2021;12:670971. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ghafouri-Fard S, Khoshbakht T, Hussen BM, Taheri M, Arefian N. Regulatory Role of non-coding RNAs on Immune responses during Sepsis. Front Immunol. 2021;12:798713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Abdelaleem OO, Mohammed SR, El HS, Sayed SK, Hussein DY, Ali MY, Abdelwahed SN, Gaber NF, Hemeda RGA. El-Hmid, serum miR-34a-5p and miR-199a-3p as new biomarkers of neonatal sepsis. PLoS ONE. 2022;17(1):e0262339. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Juzenas S, Hubenthal M, Lindqvist CM, Kruse R, Steiert TA, Degenhardt F, Schulte D, Nikolaus S, Zeissig S, Bergemalm D, Almer S, Hjortswang H, Bresso F, Struning N, Kupcinskas J, Keller A, Lieb W, Rosenstiel P, Schreiber S, D’Amato M, Halfvarson J, Hemmrich-Stanisak G, Franke A. Detailed transcriptional landscape of peripheral blood points to increased neutrophil activation in treatment-naive inflammatory bowel disease, Journal of Crohn’s & colitis. 2022. [DOI] [PMC free article] [PubMed]
- 31.Jiao Y, Zhang T, Zhang C, Ji H, Tong X, Xia R, Wang W, Ma Z, Shi X. Exosomal miR-30d-5p of neutrophils induces M1 macrophage polarization and primes macrophage pyroptosis in sepsis-related acute lung injury. Crit Care. 2021;25(1):356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wang J, Wang X, Ma X, Xu B, Chen L, Chen C, Liu W, Liu Y, Xiang Z. Therapeutic effect of Patrinia villosa on TNBS-induced ulcerative colitis via metabolism, vitamin D receptor and NF-kappaB signaling pathways. J Ethnopharmacol 2022; 114989. [DOI] [PubMed]
- 33.Abd El-Fattah EE, Saber S, Mourad AAE, El-Ahwany E, Amin NA, Cavalu S, Yahya G, Saad AS, Alsharidah M, Shata A, Sami HM, Kaddah MMY, Ghanim AMH. The dynamic interplay between AMPK/NFkappaB signaling and NLRP3 is a new therapeutic target in inflammation: emerging role of dapagliflozin in overcoming lipopolysaccharide-mediated lung injury. Volume 147. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie; 2022. p. 112628. [DOI] [PubMed]
- 34.Rao Z, Zeng J, Li X, Peng L, Wang B, Luan F, Zeng N. JFNE-A isolated from Jing-Fang n-butanol extract attenuates lipopolysaccharide-induced acute lung injury by inhibiting oxidative stress and the NF-kappaB signaling pathway via promotion of autophagy. Phytomedicine: Int J Phytotherapy Phytopharmacology. 2021;96:153891. [DOI] [PubMed] [Google Scholar]




