Table 4.
Micro-exons from each of the five chromosomes, listed in order of increasing length
| Locus | Gene name | cDNA accession | Exon number | Exon length (nucleotides) | Micro-exon sequence |
| At5g51700 | RAR1 | Ceres:99615 | 2 of 6 | 3 | AG<GGA>GT |
| At1g63290 | D-ribulose-5-phosphate-3-epimerase | Ceres:37843 | 2 of 8 | 5 | AG<GACGG>GT |
| At3g01850 | D-ribulose-5-phosphate-3-epimerase | Ceres:2398 | 2 of 9 | 5 | AG<GACGG>GT |
| At4g01610 | Cysteine protease | Ceres:20761 | 5 of 11 | 5 | AG<ATCAG>GT |
| At5g14030 | Expressed protein | Ceres:16313. | 5 of 6 | 6 | AG<GCCAAG>GT |
| At2g38880 | Putative CCAAT-binding transcription factor subunit | Ceres:7805. | 4 of 7 | 6 | AG<TTGGAG>GT |
| At2g07340 | Expressed protein | Ceres:34060. | 4 of 6 | 7 | AG<GAAGAAC>GT |
| At2g41710 | AP2 domain transcription factor | Ceres:41462 | 3 of 9 | 9 | AG<TTTATCTAG>GT |
| At2g36190 | Beta-fructofuranosidase | Ceres:118038 | 2 of 6 | 9 | AG<ATCCAAATG>GT |
| At4g13720 | Auxin-regulated protein | Ceres:8361 | 4 of 8 | 10 | AG<GGCCATACAT>GT |
| At4g29510 | Arginine methyltransferase (pam1) | Ceres:38601 | 2 of 9 | 11 | AG<GAATCCATGAA>GT |
| At3g55260 | Beta-N-acetylhexosaminidase | Ceres:118286 | 7 of 15 | 17 | AG<GTTTGCCAAAATGAGAG>GT |
| At1g80380 | Auxin-regulated protein | Ceres:117698 | 3 of 7 | 18 | AG<GTACCTAGGTACAATAAG>GT |
| At3g55630 | Tetrahydrofolylpolyglutamate synthase | Ceres:230791. | 6 of 15 | 18 | AG<GAGAAAACCAGCAATGAG>GT |
| At5g61530 | Auxin-regulated protein | Ceres:152557 | 5 of 10 | 19 | AG<GGAGTTGCCAGCTCAGATG>GT |
| At5g03880 | Auxin-regulated protein | Ceres:37668 | 4 of 12 | 19 | AG<CTGTCCCTTCTGCCGGAAG>GT |
| *At4g23470 | Expressed protein | Ceres:25694. | 7 of 8 | 19 | AG<GGTTTGCGCATGTATGCAG>GT |
| At1g67320 | Expressed protein | Ceres:116252. | 7 of 18 | 20 | AG<TTGAAAACATTTACTACAAG>GT |
| At3g50210 | Flavonol synthase | Ceres:25787. | 8 of 12 | 20 | AG<TGGAGCTCACACTGACTATG>GT |
| At4g37680 | Expressed protein | Ceres: 262351. | 2 of 5 | 21 | AG<GGTTTGTCTTTCGAAATTCAG>GT |
| At3g60340 | Palmitoyl-protein thioesterase | Ceres:38539. | 5 of 12 | 21 | AG<ACATCAGTTGTTTGTGAGAAG>GT |
| At3g23600 | Expressed protein | Ceres:11339. | 2 of 7 | 22 | AG<GTTTTGAAGCTCCAAACTTAAG>GT |
| At5g46030 | Expressed protein | Ceres:15222. | 4 of 5 | 22 | AG<CTTTGACTGAAGCTATAGACAT>GT |
| At4g33925 | Expressed protein | Ceres:24360. | 2 of 5 | 22 | AG<TAACCGAAGAACAGCTCTCAAT>GT |
| *At4g23470 | Expressed protein | Ceres:25694. | 2 of 8 | 22 | AG<ATTGTTGCTTCGCGTTGTGGTG>GT |
| At3g13860 | Chaperonin, putative | Ceres:38045. | 2 of 17 | 22 | AG<CTCGTCTACTTCCAGGAAACTG>GT |
| At1g73180 | Expressed protein | Ceres:108165. | 13 of 14 | 23 | AG<TTACTTGGAATAAGCACAACAGG>GT |
| At5g09830 | Expressed protein | Ceres:37422. | 2 of 3 | 23 | AG<GAAGTCATTGACATATCTGGAGG>GT |
| At2g23930 | Small nuclear ribonucleoprotein E | Ceres:4850. | 2 of 4 | 23 | AG<GTACATGGATAAGAAGCTCCAAA>GT |
| At1g66940 | Expressed protein | Ceres:110066. | 3 of 5 | 24 | AG<AATCTAATATTAGATGGATAATAG>GT |
| At5g51100 | Expressed protein | Ceres:126592. | 8 of 9 | 24 | AG<CACGCTTACTATCTGGATTTTGAG>GT |
| At1g05070 | Expressed protein | Ceres:13725. | 2 of 3 | 24 | AG<AGCTCAGTAATGCTTCTTTTGCTG>GT |
| At2g32580 | Expressed protein | Ceres:16625. | 2 of 3 | 24 | AG<GACTCAGCAATGGTTCATTCACTG>GT |
| At2g29960 | Cyclophilin | Ceres:19211. | 4 of 6 | 24 | AG<AAAACTTCAGAGCTTTGTGCACAG>GT |
| At1g65220 | Expressed protein | Ceres:21223. | 2 of 8 | 24 | AG<CTCAAAGGAGAAGCCCACTCTCGG>GT |
| At5g23310 | Iron superoxide dismutase 3 | Ceres:26637. | 7 of 8 | 24 | AG<CACTCTTATTATCTGGACTACAAG>GT |
| At4g25100 | Superoxide dismutase | Ceres:32935. | 6 of 7 | 24 | AG<CATGCTTACTACCTTGACTTCCAG>GT |
| At3g55920 | Cyclophilin-like protein | Ceres:94608. | 5 of 8 | 24 | AG<AGAACTTTCGGTCACTTTGCACGG>GT |
| At1g77060 | Carboxyphosphonoenol-pyruvate mutase, putative | Ceres:12293. | 4 of 6 | 25 | AG<GACCAAGCATGGCCAAAGAAGTGTG>GT |
| At4g15900 | PRL1 protein | Ceres:123113. | 2 of 17 | 25 | AG<CAAGCAGATTCGTCTCAGCCATAAG>GT |
| At2g47640 | Putative small nuclear ribonucleoprotein D2 | Ceres:26123. | 3 of 6 | 25 | AG<CAAGCCAATGGAAGAGGATACCAAT>GT |
| At2g41630 | Transcription factor IIB (TFIIB) | Ceres:2657. | 2 of 7 | 25 | AG<GTTGGGACTTGTTGCAACTATCAAG>GT |
| At3g62840 | Small nuclear ribonucleoprotein | Ceres:32457. | 3 of 5 | 25 | AG<TAAACCAATGGAAGAGGATACCAAC>GT |
| At2g21270 | Putative ubiquitin fusion-degradation protein | Ceres:34470. | 4 of 10 | 25 | AG<CCACAACTTGAAAGTGGTGACAAGA>GT |
| At3g10330 | Transcription initiation factor IIB (TFIIB) | Ceres:38950. | 2 of 7 | 25 | AG<GTTGGGACTTGTTGCGACCATCAAG>GT |
| At1g42480 | Expressed protein | Ceres:42677. | 7 of 9 | 25 | AG<ATTGCTGGAGGAAACTGAAGATGAG>GT |
| At2g23985 | Expressed protein | Ceres:252843. | 2 of 4 | 25 | AG<TGTCTTGTTCAGGTGAACAAAAAAG>GT |
*At4g23470 contains two micro-exons.