| Genes | Targets | sgRNA Sequences (PAMs) | Selected clones |
|---|---|---|---|
| Per1 | Exon 17 (S714) | GGCCAATAAGGCGGAGAGTG(TGG) | Per1Luc 1, 17, 38 |
| Per2 | Exon 17 (S662) | GCCGGGCAAGGCAGAGAGTG(TGG) | Per2Luc 17–1, 17–3, 48, 50 |
| Per2 | Exon 17 (H678) | AGCAGCACCATCGTCCATGT(GGG) | Per2Luc 10, 25, 36 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.