TABLE 3.
Oligonucleotides used for real-time amplification of L. pneumophila and the internal positive control
| Name | Positions on genea | Sequence (5′ → 3′) | Accession no. |
|---|---|---|---|
| dotAF | 986-1004 | ATTGTCTCGCGCGATTGC | AY720956 |
| dotAR | 1066-1043 | CCGGATCATTATTAACCATCACC | AY720956 |
| dotA probe | 1006-1027 | ATACAGCAAATGTATGTGACTT | AY720956 |
| gyrB probe | 590-614 | AACAAGACCCCGATCCACCCGAAG | AY101778 |
a
Primer and probe nucleotide positions are given according to the complete sequence of the dotA gene of L. pneumophila ATCC 33152 (AF095231). In the case of the internal control (gyrB gene of A. hydrophila CECT 839), the probe positions are given using the Escherichia coli numbering.