| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| CDX2 (1:200) | BioGenex | Cat#MU392A-5U; RRID: AB_2650531 |
| FOXF1 (1:200) | R&D | Cat#AF4798; RRID: AB_2105588 |
| E-cadherin (1:100) | R&D | Cat#AF648; RRID: AB_355504 |
| MUC2 (1:100) | Santa Cruz | Cat#Sc15334; RRID: AB_2146667 |
| Chromogranin A (1:1000) | DiaSorin | Cat#SP-1 |
| Villin (1:100) | Novus Biologicals | Cat#NBP1-85335; RRID: AB_11020888 |
| Ki67 (1:50) | Novus Biologicals | Cat#NB600-1252; RRID: AB_2142376 |
| alpha-Smooth Muscle Actin (1:150) | Novus Biologicals | Cat#NB600-531; RRID: AB_10000930 |
| Vimentin (1:200) | Novus Biologicals | Cat#NB300-223; RRID: AB_10003206 |
| Lysozyme (1:1000) | Sigma | Cat#HPA048284; RRID: AB_2680339 |
| Sucrase Isomaltase (1:100) | Santa Cruz | Cat#Sc393424; RRID:AB_2891093 |
| Wnt2b (1:500) | Invitrogen | Cat#710888 |
| tdTomato (1:300) | SICGEN | Cat# AB8181 RRID: AB_2722750 |
| GFP (1:100) | Santa Cruz | Cat# sc-9996 RRID: AB_627695 |
| Alexa 488 donkey anti-rabbit IgG (1:200) | Invitrogen | Cat#A21206; RRID: AB_2535792 |
| Alexa 488 goat anti-rabbit IgG (1:200) | Invitrogen | Cat#A11034; RRID: AB_2576217 |
| Alexa 488 donkey anti-mouse IgG (1:200) | Invitrogen | Cat#A21202; RRID: AB_141607 |
| Alexa 488 rabbit anti-goat IgG (1:200) | Invitrogen | Cat#A11078; RRID: AB_141838 |
| Alexa 488 chicken anti-goat IgG (1:200) | Invitrogen | Cat#A21467; RRID: AB_2535870 |
| Alexa 594 donkey anti-rabbit IgG (1:200) | Invitrogen | Cat#A21207; RRID: AB_141637 |
| Alexa 594 chicken anti-goat IgG (1:200) | Invitrogen | Cat#A21468; RRID: AB_141859 |
| Alexa 594 donkey anti-goat IgG (1:200) | Invitrogen | Cat#A11058; RRID: AB_2534105 |
| Alexa 594 donkey anti-chicken IgG (1:200) | Jackson Immuno | Cat#703-585-155; RRID: AB_2340377 |
| Alexa 594 donkey anti-chicken IgG (1:200) | Invitrogen | Cat#A78951; RRID: AB_2921073 |
| Alexa 594 donkey anti-mouse IgG (1:200) | Invitrogen | Cat#A21203; RRID: AB_141633 |
| Chemicals, peptides, and recombinant proteins | ||
| Recombinant murine EGF | Peprotech | Cat#31509 |
| Recombinant mouse Noggin | R&D | Cat#1967 |
| Recombinant mouse R-spondin1 | R&D | Cat#3474-RS |
| A83-01 | Tocris | Cat#2939 |
| Recombinant Human IGF-1 | BioLegend | Cat#590906 |
| Nicotinamide | Sigma | Cat#N0636 |
| Afamin/Wnt3a conditioned medium | MBL lifescience | Cat#J2-001 |
| Activin A | Nacalai Tesque | Cat#18585-81 |
| CHIR99021 | Cayman Chemicals | Cat#13122 |
| Recombinant human FGF4 | Peprotech | Cat#100-31 |
| Recombinant human BMP-4 | R&D | Cat# 314-BP |
| Wnt-C59 | Chemscene LLC | Cat#CS-1420 |
| PIK90 | Cayman Chemicals | Cat#10010749 |
| Retinoic acid | Sigma Aldrich | Cat#R2625 |
| Purmorphamine | Tocris Bioscience | Cat#4551 |
| Y-27632 | Fujifilm Wako Pure Chemical | Cat#253-00513 |
| FGF-basic(154a.a.), Human, Recombinant | Peprotech | Cat#100-18B |
| Recombinant Human IGF-I | BioLegend | Cat#590906 |
| Cellartis DEF-CS™ 500 culture system | Takara Bio | Cat#Y50101 |
| Advanced DMEM/F12 | Thermo Fisher | Cat#12634010 |
| DMEM, high glucose | Thermo Fisher | Cat#11965-092 |
| RPMI 1640 with L-Gln, liquid | Nacalai Tesque | Cat#30264-85 |
| Embryonic stem cell Fetal Bovine Serum | Thermo Fisher | Cat#16141079 |
| GlutaMAX™ Supplement | Thermo Fisher | Cat#35050-061 |
| HEPES buffer | Nacalai Tesque | Cat#17557-94 |
| Penicillin-Streptomycin Mixed Solution | Nacalai Tesque | Cat#26253-84 |
| Matrigel Growth Factor Reduced | Corning | Cat#356231 |
| N-2 supplement (100X) | Thermo Fisher | Cat#17502-048 |
| B-27 Supplement (50X), serum free | Thermo Fisher | Cat#17504-044 |
| B-27 Supplement (50X), minus vitamin A | Thermo Fisher | Cat#12587010 |
| TrypLE Express Enzyme | Thermo Fisher | Cat#12604013 |
| Accumax | Nacalai Tesque | Cat#17087-54 |
| Hoechst 33342 | Thermo Fisher | Cat#H3570 |
| VECTASHIELD mounting medium with DAPI | VECTOR Laboratories | Cat#H1200 |
| DAPI solution (1 mg/mL) | Nacalai Tesque | Cat#19178-91 |
| The P3 Primary Cell 4D-Nucleofector X Kit S | Lonza | Cat#V4XP-3032 |
| Critical commercial assays | ||
| RNAscope 2.5HD Assay-Red | Advanced Cell Diagnostics | Cat#322350 |
| RNeasy Mini kit | QIAGEN | Cat#74106 |
| QuantiTect Reverse Transcription Kit | QIAGEN | Cat#205313 |
| Experimental models: Cell lines | ||
| Human induced pluripotent stem cell line: HiPS-RIKEN-2F | RIKEN BRC Cell Bank (Japan) | HPS0014 |
| Human induced pluripotent stem cell line: PB001 | Kindly gifted by Dr Hideki Masaki (Institute of Medical Science, the University of Tokyo) | N/A |
| Human induced pluripotent stem cell line: TkdA3-4 | Institute of Medical Science, the University of Tokyo | N/A |
| Experimental models: Organisms/strains | ||
| NOD.Cg-Prkdcscid/Il2rgtm1wji/SzJ (NSG) mice | The Jackson Laboratory Japan | N/A |
| Oligonucleotides | ||
| RNAscope Probe-Hs-LGR5 | Advanced Cell Diagnostics | Cat#311021 |
| RNAscope Probe-Hs-RSPO3-01 | Advanced Cell Diagnostics | Cat#429851 |
| Primer: CDX2 Fwd: CTCGGCAGCCAAGTGAAAAC | This paper | N/A |
| Primer: CDX2 Rev: CTCCTTTGCTCTGCGGTTCT | This paper | N/A |
| Primer: FOXF1 Fwd: AGCAGCCGTATCTGCACCAGAA | This paper | N/A |
| Primer: FOXF1 Rev: CTCCTTTCGGTCACACATGCTG | This paper | N/A |
| Primer: β-actin Fwd: GGATGCAGAAGGAGATCACTG | This paper | N/A |
| Primer: β-actin Rev: CGATCCACACGGAGTACTTG | This paper | N/A |
| Recombinant DNA | ||
| PB-CMV-MCS-EF1-GreenPuro cDNA Cloning and Expression Vector | System Biosciences | Cat# PB513B-1 |
| Super piggyBac Transposase expression vector | System Biosciences | Cat# PB200A-1 |
| Software and algorithms | ||
| Prism 9 | GraphPad Software; Dotmatics | N/A |
| CellSens | Olympus | N/A |
| R v4.3.3 | R Foundation | N/A |
| ImageJ v1.54k | National Institute of Health | N/A |
| Other | ||
| EZSPHERE® 6-well plate | AGC Techno Glass Co. Ltd. | Cat#4810-900SP |
| EZ-BindShut® 96-well plate | AGC Techno Glass Co. Ltd. | Cat#4870-800SP |
| Org-SP plate | AGC Techno Glass Co. Ltd. | N/A |
| Ultra-low attachment 6-well plate | Corning | Cat#3471 |
| CellPet 3D-iPS rotary suspension culture system | JTEC Corp. | CELLPET iPS/3S/MA-2.1 |
| Culture vessel syringe (10 mL) | JTEC Corp. | CELLPET VES/S10/6 |
| Culture vessel syringe (30 mL) | JTEC Corp. | CELLPET VES/S30/6 |
| Culture vessel syringe (50 mL) | JTEC Corp. | CELLPET VES/S50/6 |
| SUMILON STEMFULL 15mL Centrifuge tube | Sumitomo Bakelite Co., Ltd | Cat#MS-90150 |
| SUMILON ProteoSave SS 50mL Centrifuge tube | Sumitomo Bakelite Co., Ltd | Cat#MS-52550 |
| Beriplast P Combi-Set Tissue adhesion 0.5 mL | CSL Behring | N/A |
| VICRYL | ETHICON | J107G |
| All-in-one Fluorescence Microscope | KEYENCE | BZ-X810 |
| Laser-scanning confocal microscope | Olympus | FLUOVIEW FV3000 |
| Stereomicroscope system | OLYMPUS | SZX7 |
| 4D-NucleofectorR System | Lonza | N/A |
| StepOnePlus Real-Time PCR | Applied Biosystems | N/A |