Daphnetin ameliorates diabetic cardiomyopathy by regulating inflammation and endoplasmic reticulum stress-induced apoptosis

Abstract

Daphnetin has been demonstrated to exert beneficial effects on diabetes mellitus and renal complications. However, the role and molecular mechanism of daphnetin in diabetic cardiomyopathy (DCM) remain unclear. In this study, rats were injected with streptozotocin (STZ) to induce diabetes. The diabetic rats were then administered daphnetin (1 and 4 mg/kg) or dimethyl sulfoxide (DMSO) daily for 12 weeks. The results demonstrated that the diabetic rats exhibited elevated blood glucose levels, which were dose-dependently ameliorated by daphnetin. At 13 weeks following STZ injection, the rats exhibited typical diabetic signs, cardiac dysfunction, and evident pathological alterations in myocardial tissues. The administration of daphnetin to diabetic rats resulted in improvement in cardiac function, reductions in myocardial injury biomarkers, and the inhibition of myocardial fibrosis. Furthermore, daphnetin treatment suppressed inflammation and endoplasmic reticulum stress-induced apoptosis in a dose-dependent manner. Additionally, daphnetin exhibited partial blockade of the activation of mitogen-activated protein kinase pathways induced by diabetes. These findings indicate that daphnetin may be a promising therapeutic agent for the treatment of DCM.

Introduction

Diabetes mellitus is a chronic endocrine metabolic disorder that is a leading cause of death [1]. It affects 463 million individuals of all ages, with the projected number reaching 700 million by 2045 [2]. The condition is defined by insulin resistance, destruction of pancreatic β-cells, or both [3]. Diabetic patients exhibit a higher prevalence of cardiomyopathy than those without diabetes [4]. Diabetic cardiomyopathy (DCM) represents a serious cardiovascular complication of diabetes mellitus, with the potential to result in arrhythmia, heart failure, and even death [5, 6]. It is defined as an abnormal cardiac function and structure in the absence of other cardiac risk factors, such as valvular disease, hypertension, and coronary artery disease [7]. Although the clinical features and pathogenesis of DCM have been well-studied in recent decades, effective therapeutic agents and strategies remain limited.

Daphnetin is a coumarin derivative extracted from the plants of the Daphne genus [8, 9]. It displays a spectrum of biological activities, including anti-cancer, anti-bacterial, antioxidant, and anti-inflammatory effects [10]. In China, daphnetin has been clinically utilized to treat coronary heart disease and occlusive thrombus [11, 12]. A recent study reported that daphnetin ameliorates apoptosis of pancreatic β-cells induced by streptozotocin [13]. Daphnetin has also been demonstrated to protect against extracellular matrix accumulation, inflammation, and oxidative stress in glomerular mesangial cells induced by high glucose [14]. Furthermore, daphnetin exerts a beneficial effect against cardiac fibrosis and hypertrophy by regulating several signaling pathways [15]. However, the role and molecular mechanism of daphnetin in DCM remain to be elucidated.

The objective of this study was to investigate the effect of daphnetin on DCM in a rat model. Moreover, it remains unclear whether the cardioprotective effect against DCM is mediated by the JNK/p38 MAPK pathways and endoplasmic reticulum stress.

Materials and Methods

Animal model

Male 8-week-old Sprague-Dawley (SD) rats (Charles River, Beijing, China; 6 rats per group) were acclimated for one week prior to receiving a single intraperitoneal injection of 65 mg/kg streptozotocin (STZ; MedChemExpress, Monmouth Junction, NJ, USA). One week later, fasting blood glucose (FBG) was measured. Rats with FBG levels ≥16.7 mmol/l were considered diabetic and used for subsequent animal experiments. Rats injected with citrate buffer (Aladdin, Shanghai, China) served as the controls. The study randomly assigned diabetic rats to three groups. The rats were administered intraperitoneally either daphnetin (1 and 4 mg/kg; Aladdin; Powder Purity: ≥99%; CAS No.: 486–35-1; Molecular Formula: C₉H₆O₄; Molecular Weight: 178.14) or dimethyl sulfoxide (DMSO) daily for 12 weeks. Blood glucose levels were monitored at two-week intervals throughout the course of the experiment. Cardiac function was evaluated 13 weeks after STZ injection, and blood and hearts were collected after the rats were euthanized. The animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committee of Dalian Medical University.

Echocardiographic analysis

The rats were anaesthetized with 2% isoflurane and then echocardiographic analysis was employed to evaluate cardiac function. Fractional shortening (FS), ejection fraction (EF), and left ventricular internal systolic and diastolic diameters (LVIDs and LVIDd) were measured using the Philips Epiq CVx ultrasound system (Bothell, WA, USA).

Detection of biomarkers of myocardial injury

Lactate dehydrogenase (LDH) activity in serum was quantified using the LDH Assay Kit (Nanjing Jiancheng, Nanjing, China). The serum levels of cardiac troponin T (cTnT) were examined using an ELISA Kit for cTnT (Cloud-Clone Corp., Wuhan, China). The activity of creatine kinase-MB isoenzyme (CK-MB) in serum was quantified using the CK-MB Assay Kit (Nanjing Jiancheng) in accordance with the manufacturer’s instructions.

Hematoxylin and eosin staining

The paraffin-embedded myocardial tissues were cut into 4 µm-thick sections, deparaffinized in xylene, and rehydrated in ethanol. The sections were then stained with hematoxylin for 5 min. Following phosphate buffered saline (PBS) washes, the sections were incubated with eosin for 3 min, dehydrated, and cleared. The microscopic examination (Olympus, Tokyo, Japan) was employed to visualize the pathological alterations.

Masson’s trichrome staining

The sections (4 µm-thick) were deparaffinized, rehydrated, and treated with Regaud’s hematoxylin stains for 6 min. They were then differentiated in a 1% hydrochloric acid-ethanol solution for 3 s, and then incubated with ponceau-acid fuchsin solution for 1 min. The sections were then incubated for 5 min with phosphomolybdic acid, after which they were stained for 5 min with aniline blue solution. Subsequently, the sections were washed with acetic acid, dehydrated, and cleared. Myocardial fibrosis was identified by microscopic examination (Olympus).

Immunofluorescence staining

The paraffin-embedded myocardial tissues were sectioned at a thickness of 4 µm, deparaffinized in xylene, and rehydrated in ethanol. The tissue sections were then soaked in citrate-EDTA antigen retrieval solution (Beyotime, Shanghai, China) and heated at 95 to 100°C for 10 min in a microwave oven, followed by three washes with PBS. Subsequently, the sections were blocked with goat serum and then incubated with antibodies against glucose-regulating protein 78 (GRP78; #11587-1-AP; 1:200; Proteintech, Wuhan, China) and C/EBP homologous protein (CHOP; #15204-1-AP; 1:200; Proteintech) at 4°C overnight. After washing with PBS, the sections were incubated with Alexa Flour 555-conjugated immunoglobulin G (#A27039; 1:200; Invitrogen, San Diego, CA, USA) for 1 h at 25°C. The sections were then washed again and the nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 min. Finally, the stained sections were examined using a fluorescence microscope (Olympus).

Terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL)

The TUNEL assay was performed following the manufacturer’s procedures (Solarbio, Beijing, China). Paraffin-embedded tissues were sliced into 4 µm sections, deparaffinized in xylene, rehydrated, and permeabilized for 8 min with 0.1% Triton X-100. Subsequently, the sections were then incubated with 50 µl of TUNEL Reaction Solution for 60 min at 37°C. The nuclei were then stained with DAPI for 10 min. The apoptotic signal was visualized using fluorescence microscopy (Olympus).

Real-time PCR

Myocardial tissue RNAs were isolated using RNAiso Plus lysis buffer (TaKaRa, Tokyo, Japan) and the chloroform-isopropanol method. The obtained RNAs were reverse-transcribed into cDNAs using the First Strand cDNA Synthesis Kit with gDNA Eraser (cat. No. D7170L; Beyotime). Real-time PCR was performed using SYBR Green qPCR Mix (Beyotime) on the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences are listed in Table 1 and were synthesized by Sangon Biotech (Shanghai, China).

Table 1. Primers for real-time PCR.

Genes	forward primer (5′–3′)	reverse primer (5′–3′)
IL-6	TCCTACCCCAACTTCCAATGCTC	TTGGATGGTCTTGGTCCTTAGCC
IL-1β	CACCTCTCAAGCAGAGCACAG	GGGTTCCATGGTGAAGTCAAC
TNF-α	AAATGGGCTCCCTCTCATCAGTTC	TCTGCTTGGTGGTTTGCTACGAC
GAPDH	ATGATTCTACCCACGGCAAG	CTGGAAGATGGTGATGGGTT

Western blotting

Homogenized myocardial tissues were lysed in radioimmunoprecipitation assay buffer (Abcam) to extract proteins. The protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretically transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking, the membranes were probed with antibodies against collagen I (#ab270993; 1:1,000; Abcam, Cambridge, MA, USA), collagen III (#ab184993; 1:1,000; Abcam), B cell lymphoma-2 (Bcl-2; #26593-1-AP; 1:3,000; Proteintech), Bcl-2-associated X protein (Bax; #2772; 1:1,000; CST, USA), cleaved caspase-3 (#9661; 1:1,000; CST, Shanghai, China), GRP78 (#11587-1-AP; 1:2,000; Proteintech), CHOP (#15204-1-AP; 1:1,500; Proteintech), protein kinase R-like ER kinase (PERK; #3192; 1:1,000; CST), phosphorylated (p)-PERK (#3179; 1:1,000; CST), c-Jun N-terminal kinase (JNK; #17572-1-AP; 1:3,000; Proteintech), p-JNK (#4668; 1:1,000; CST), p38 mitogen-activated protein kinase (p38 MAPK; #9212; 1:1,000; CST), p-p38 MAPK (#28796-1-AP; 1:1,000; Proteintech). Signals were monitored using horseradish peroxidase (HRP)-conjugated secondary antibody and electrochemiluminescence detection system.

ELISA assays

Myocardial tissues and serum were collected from rats. Levels of IL-6, IL-1β, and tumor necrosis factor (TNF)-α in myocardial tissues and serum were measured using ELISA Kits for IL-6/IL-1β/TNF-α (Beyotime) in accordance with the manufacturer’s instructions.

Statistical analysis

The data are presented as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Tukey’s test or Student’s t-test when the data followed a normal distribution. The nonparametric Mann-Whitney U test was applied when the data did not follow a normal distribution. A significance level of P<0.05 was used to determine statistical significance. All statistical analyses were performed using GraphPad Prism 8 (GraphPad Software Inc., San Diego, CA, USA).

Results

Daphnetin lowered blood glucose, improves cardiac dysfunction, and alleviates myocardial injury/fibrosis in diabetic rats

The study revealed that blood glucose levels were markedly elevated in diabetic rats. Daphnetin was found to reduce fasting blood glucose levels in diabetic rats in a dose-dependent manner (Fig. 1). Furthermore, echocardiographic analysis demonstrated that cardiac function was significantly impaired in diabetic rats 13 weeks after STZ injection. This was evidenced by increases in LVIDd and LVIDs as well as decreases in EF and FS. However, treatment with daphnetin demonstrated a dose-dependent improvement in cardiac function, as evidenced by a decrease in LVIDs and an increase in EF and FS in diabetic rats. A high dose of daphnetin resulted in a slight decrease in LVIDd without a significant difference (Fig. 2A). This suggests that daphnetin may improve cardiac function in DCM. To further investigate the effect of daphnetin on myocardial injury, several markers of myocardial injury were measured. Diabetes mellitus significantly increased serum levels of cTnT and the activities of CK-MB and LDH in rats. After daphnetin treatment, CK-MB, LDH, and cTnT were reduced in diabetic rats (Fig. 2B). In diabetic rats, cardiomyocytes exhibited hypertrophy and disorganization. Daphnetin was found to ameliorate the pathological changes induced by diabetes in the rats (Fig. 2C). Masson’s trichrome staining revealed that diabetes induced myocardial fibrosis in diabetic rats, while daphnetin dose-dependently ameliorated myocardial fibrosis in diabetic rats (Fig. 2D). Figure 2E showed that collagen Ⅰ and collagen Ⅲ expression levels were significantly upregulated in diabetic rats. Daphnetin treatment dose-dependently reduced both collagens in diabetic rats.

Fig. 1.

Daphnetin reduces blood glucose levels in diabetic rats. (A) Diabetic cardiomyopathy (DCM) was induced in SD rats via a single intraperitoneal injection of streptozotocin (STZ). Blood glucose levels were monitored at two-week intervals. ^## indicates P<0.01 compared to the control group. * indicates P<0.05 and ** indicates P<0.01 compared to the STZ group.

Fig. 2.

Daphnetin improves cardiac dysfunction and alleviates myocardial injury/fibrosis in diabetic rats. (A) Cardiac function was evaluated by echocardiographic analysis, which included the measurement of left ventricular internal systolic and diastolic diameters (LVIDs and LVIDd), ejection fraction (EF), and fractional shortening (FS). (B) Several markers of myocardial injury (LDH, CK-MB, and cTnT) in serum were measured. (C) The pathological changes in myocardial tissues were evaluated by HE staining. (D) Myocardial fibrosis in rat hearts was analyzed by Masson’s trichrome staining. (E) The expression levels of collagen I and collagen III were determined by western blotting. GAPDH was utilized as the internal control. ^# indicates P<0.05 and ^## indicates P<0.01 compared to the control group. ** indicates P<0.01 and ns indicates not significant compared to the STZ group.

Daphnetin inhibits inflammation in diabetic rats

Subsequently, the transcription levels of several pro-inflammatory cytokines in myocardial tissue were quantified by real-time PCR. The mRNA levels of IL-6, IL-1β, and tumor necrosis factor-α (TNF-α) were found to be elevated in diabetic rats compared to control rats. The administration of daphnetin reduced their mRNA levels in diabetic rats in a dose-dependent manner (Fig. 3A). The levels of pro-inflammatory cytokines were then quantified by ELISA. The serum and myocardial tissue of diabetic rats exhibited higher levels of IL-6, IL-1β, and TNF-α than control rats. Following treatment with daphnetin, the levels of IL-6, IL-1β, and TNF-α in both serum (Fig. 3B) and myocardial tissues (Fig. 3C) of diabetic rats were reduced in a dose-dependent manner.

Fig. 3.

Daphnetin inhibits inflammation in diabetic rats. (A) The mRNA levels of several pro-inflammatory cytokines in myocardial tissues were quantified by real-time PCR. GAPDH was utilized as the internal control. (B) The serum levels of TNF-α, IL-6, and IL-1β were quantified by ELISA. (C) The levels of TNF-α, IL-6, and IL-1β in myocardial tissues were determined by ELISA. ^## indicates P<0.01 compared to the control group. * indicates P<0.05 and ** indicates P<0.01 compared to the STZ group.

Daphnetin suppresses ER stress-induced apoptosis in diabetic rats

To investigate the effect of daphnetin on ER stress in diabetic rats, western blotting was employed to determine the expression of key regulators. The results demonstrated that diabetic rats exhibited significantly elevated levels of CHOP and GRP78 expression, in addition to a higher p-PERK/PERK ratio, compared to control rats. However, daphnetin demonstrated a dose-dependent reduction in these levels (Fig. 4A). Immunofluorescence staining was also employed to examine the expression of CHOP and GRP78, which were found to be elevated in diabetic rats. Figure 4B illustrated that the expression levels of CHOP and GRP78 were reduced in diabetic rats treated with daphnetin in a dose-dependent manner. Furthermore, the impact of daphnetin on myocardial cell apoptosis in diabetic rats was assessed. The TUNEL assay demonstrated a higher number of apoptotic cells in diabetic rats compared to control rats. However, the administration of daphnetin dose-dependently reduced the number of apoptotic cells in diabetic rats (Fig. 4C). Moreover, in the myocardial tissues of rats, diabetes mellitus significantly reduced the expression of Bcl-2 while increasing the levels of cleaved caspase-3 and Bax. Treatment with daphnetin resulted in a dose-dependent decrease in cleaved caspase-3 and Bax levels, while increasing the level of Bcl-2 in diabetic rats (Fig. 4D).

Fig. 4.

Daphnetin suppresses endoplasmic reticulum (ER) stress-induced apoptosis in diabetic rats. (A) The expression levels of GRP78, CHOP, p-PERK, and PERK were examined by western blotting. The ratio of p-PERK/PERK was calculated. GAPDH was utilized as the internal control. (B) GRP78 and CHOP expression levels were quantified by immunofluorescence staining. (C) The number of apoptotic cells in myocardial tissues was determined by TUNEL assay. (D) The levels of Bax, Bcl-2, and cleaved caspase-3 in myocardial tissues were examined by western blotting. GAPDH was utilized as the internal control. ^## indicates P<0.01 compared to the control group. * indicates P<0.05 and ** indicates P<0.01 compared to the STZ group.

Daphnetin inhibits p38 MAPK and JNK pathways in diabetic rats

We then evaluated the activation states of p38 MAPK and JNK in the myocardial tissues of diabetic rats. The results demonstrated a significant increase in the ratios of p-JNK/JNK and p-p38 MAPK/p38 MAPK were significantly increased in diabetic rats compared to control rats, indicating the activation of the p38 MAPK and JNK pathways in diabetic rats. The administration of daphnetin was observed to result in a dose-dependent decline in the ratios of p-JNK/JNK and p-p38 MAPK/p38 MAPK in diabetic rats (Fig. 5).

Fig. 5.

Daphnetin inhibits p38 MAPK and JNK signaling pathways in diabetic rats. Total proteins were extracted from myocardial tissues for subsequent analysis. The protein levels of p-p38 MAPK, p38 MAPK, p-JNK, and JNK were quantified by western blotting. The ratios of p-p38 MAPK/p38 MAPK and p-JNK/JNK ratios were calculated. GAPDH was utilized as the internal control. ^## indicates P<0.01 compared to the control group. ** indicates P<0.01 compared to the STZ group.

Discussion

The STZ-induced type 1 diabetes animal model is a commonly utilized model for the study of DCM [16,17,18]. In this study, we employed the type 1 diabetes animal model to investigate the effect of daphnetin on DCM. The diabetic rats exhibited an increase in LVIDd and LVIDs, and a decrease in EF and FS, indicating the progression of cardiac dysfunction. The study revealed that diabetic rats exhibited symptoms of DCM, including disorderly arranged myocardial fibers, myocardial cell hypertrophy, infiltration of inflammatory cells, and myocardial fibrosis, as evidenced by HE and Masson staining. Daphnetin has been shown to possess protective effects against diabetes and its renal complications [13, 14]. Furthermore, recent evidence has indicated that daphnetin exerts a cardioprotective effect of daphnetin in mice [15]. However, the role and molecular mechanism of daphnetin in DCM remains unknown. The results of our study demonstrated that daphnetin reduced blood glucose levels in diabetic rats. Furthermore, it improved cardiac function, reduced biomarkers of myocardial injury, and mitigated pathological alterations in diabetic rats. These findings indicate that daphnetin exerts beneficial effects on DCM in rats. However, further research is necessary to elucidate the molecular mechanism of daphnetin in DCM.

The ER is a dynamic organelle that regulates a multitude of cellular processes, including lipid synthesis, protein quality control, and protein synthesis [19]. The accumulation of misfolded and unfolded proteins in the ER is a significant contributor to ER stress [20]. The involvement of ER stress in the pathogenesis of DCM is supported by an accumulating body of evidence [21, 22]. GRP78, a member of the heat shock protein 70 family, is a pivotal regulator of ER stress [23]. The study revealed that GRP78 expression was elevated in diabetic rats. During ER stress, activated GRP78 further induces the phosphorylation of PERK and nuclear translocation of ATF4, resulting in the transcription of CHOP [24]. Furthermore, an increase in the p-PERK/PERK ratio and CHOP expression was observed, indicating the activation of ER stress in diabetic rats. Inhibition of ER stress has been demonstrated to contribute to the amelioration of DCM in animal models [25, 26]. In this study, daphnetin dose-dependently reduced GRP78 and CHOP expression levels, as well as a dose-dependent reduction in the p-PERK/PERK ratio in diabetic rats. Previous studies have reported an increased degree of cardiomyocyte apoptosis has been reported in diabetic mice and patients [27, 28]. ER stress is one of the molecular mechanisms of cardiomyocyte apoptosis in DCM [29], and the activation of CHOP has been identified as a pro-apoptotic effect on cardiomyocytes [30]. The inhibition of ER stress-induced cardiomyocyte apoptosis contributes to the amelioration of DCM [31, 32]. In accordance with previous studies, diabetes induced cell apoptosis in the myocardial tissues of rats, which was accompanied by the regulation of anti- and pro-apoptotic proteins. Treatment with daphnetin inhibited myocardial cell apoptosis in diabetic rats. These finding indicate that daphnetin may mitigate DCM in rats by suppressing ER stress-mediated apoptosis.

Previous studies have suggested that ER stress is a primary contributor to the development of inflammation [33, 34]. Interestingly, the presence of inflammation can also give rise to ER stress in the context of diabetes [35]. A number of studies have identified a crosstalk between ER stress and inflammation [36, 37]. Therefore, we investigated whether daphnetin can protect against DCM in rats by regulating the inflammatory response. Inflammation plays a role in the progression of DCM [38]. IL-6, TNF-α, and IL-1β are commonly used to reflect the inflammatory state in DCM [39]. The serum and myocardial tissue levels of pro-inflammatory cytokines were elevated in diabetic rats. However, daphnetin treatment dose-dependently decreased these levels in diabetic rats. These findings indicate that daphnetin may mitigate DCM in rats by suppressing inflammation.

The MAPK family encompasses JNK, ERK, and p38 MAPK [40]. The activation of the JNK and p38 MAPK pathways has been associated with the development of inflammation and ER stress [41, 42]. Therefore, we investigated whether the JNK and p38 MAPK pathways are correlated with the protective effects of daphnetin against DCM. The results demonstrated that daphnetin treatment inhibited the p38 MAPK and JNK pathways in diabetic rats in a dose-dependent manner. The inactivation of these two MAPK pathways has been demonstrated to contribute to the amelioration of DCM in animal models [43, 44]. Daphnetin may alleviate DCM in rats by inhibiting the JNK and p38 MAPK pathways.

Conclusion

In conclusion, the administration of daphnetin resulted in a reduction in blood glucose levels in diabetic rats. Furthermore, daphnetin demonstrated a dose-dependent improvement in cardiac function, attenuation of myocardial injury, and a reduction in the inflammatory response, as well as suppression of ER stress-induced apoptosis, through the inactivation of JNK and MAPK in diabetic rats. These findings indicate that daphnetin may be a promising therapeutic agent for the treatment of DCM.

Data Availability Statement

Data available on request from the authors.