Abstract
Daphnetin has been demonstrated to exert beneficial effects on diabetes mellitus and renal complications. However, the role and molecular mechanism of daphnetin in diabetic cardiomyopathy (DCM) remain unclear. In this study, rats were injected with streptozotocin (STZ) to induce diabetes. The diabetic rats were then administered daphnetin (1 and 4 mg/kg) or dimethyl sulfoxide (DMSO) daily for 12 weeks. The results demonstrated that the diabetic rats exhibited elevated blood glucose levels, which were dose-dependently ameliorated by daphnetin. At 13 weeks following STZ injection, the rats exhibited typical diabetic signs, cardiac dysfunction, and evident pathological alterations in myocardial tissues. The administration of daphnetin to diabetic rats resulted in improvement in cardiac function, reductions in myocardial injury biomarkers, and the inhibition of myocardial fibrosis. Furthermore, daphnetin treatment suppressed inflammation and endoplasmic reticulum stress-induced apoptosis in a dose-dependent manner. Additionally, daphnetin exhibited partial blockade of the activation of mitogen-activated protein kinase pathways induced by diabetes. These findings indicate that daphnetin may be a promising therapeutic agent for the treatment of DCM.
Keywords: daphnetin, diabetic cardiomyopathy, endoplasmic reticulum stress, fibrosis, mitogen-activated protein kinase pathways
Introduction
Diabetes mellitus is a chronic endocrine metabolic disorder that is a leading cause of death [1]. It affects 463 million individuals of all ages, with the projected number reaching 700 million by 2045 [2]. The condition is defined by insulin resistance, destruction of pancreatic β-cells, or both [3]. Diabetic patients exhibit a higher prevalence of cardiomyopathy than those without diabetes [4]. Diabetic cardiomyopathy (DCM) represents a serious cardiovascular complication of diabetes mellitus, with the potential to result in arrhythmia, heart failure, and even death [5, 6]. It is defined as an abnormal cardiac function and structure in the absence of other cardiac risk factors, such as valvular disease, hypertension, and coronary artery disease [7]. Although the clinical features and pathogenesis of DCM have been well-studied in recent decades, effective therapeutic agents and strategies remain limited.
Daphnetin is a coumarin derivative extracted from the plants of the Daphne genus [8, 9]. It displays a spectrum of biological activities, including anti-cancer, anti-bacterial, antioxidant, and anti-inflammatory effects [10]. In China, daphnetin has been clinically utilized to treat coronary heart disease and occlusive thrombus [11, 12]. A recent study reported that daphnetin ameliorates apoptosis of pancreatic β-cells induced by streptozotocin [13]. Daphnetin has also been demonstrated to protect against extracellular matrix accumulation, inflammation, and oxidative stress in glomerular mesangial cells induced by high glucose [14]. Furthermore, daphnetin exerts a beneficial effect against cardiac fibrosis and hypertrophy by regulating several signaling pathways [15]. However, the role and molecular mechanism of daphnetin in DCM remain to be elucidated.
The objective of this study was to investigate the effect of daphnetin on DCM in a rat model. Moreover, it remains unclear whether the cardioprotective effect against DCM is mediated by the JNK/p38 MAPK pathways and endoplasmic reticulum stress.
Materials and Methods
Animal model
Male 8-week-old Sprague-Dawley (SD) rats (Charles River, Beijing, China; 6 rats per group) were acclimated for one week prior to receiving a single intraperitoneal injection of 65 mg/kg streptozotocin (STZ; MedChemExpress, Monmouth Junction, NJ, USA). One week later, fasting blood glucose (FBG) was measured. Rats with FBG levels ≥16.7 mmol/l were considered diabetic and used for subsequent animal experiments. Rats injected with citrate buffer (Aladdin, Shanghai, China) served as the controls. The study randomly assigned diabetic rats to three groups. The rats were administered intraperitoneally either daphnetin (1 and 4 mg/kg; Aladdin; Powder Purity: ≥99%; CAS No.: 486–35-1; Molecular Formula: C9H6O4; Molecular Weight: 178.14) or dimethyl sulfoxide (DMSO) daily for 12 weeks. Blood glucose levels were monitored at two-week intervals throughout the course of the experiment. Cardiac function was evaluated 13 weeks after STZ injection, and blood and hearts were collected after the rats were euthanized. The animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committee of Dalian Medical University.
Echocardiographic analysis
The rats were anaesthetized with 2% isoflurane and then echocardiographic analysis was employed to evaluate cardiac function. Fractional shortening (FS), ejection fraction (EF), and left ventricular internal systolic and diastolic diameters (LVIDs and LVIDd) were measured using the Philips Epiq CVx ultrasound system (Bothell, WA, USA).
Detection of biomarkers of myocardial injury
Lactate dehydrogenase (LDH) activity in serum was quantified using the LDH Assay Kit (Nanjing Jiancheng, Nanjing, China). The serum levels of cardiac troponin T (cTnT) were examined using an ELISA Kit for cTnT (Cloud-Clone Corp., Wuhan, China). The activity of creatine kinase-MB isoenzyme (CK-MB) in serum was quantified using the CK-MB Assay Kit (Nanjing Jiancheng) in accordance with the manufacturer’s instructions.
Hematoxylin and eosin staining
The paraffin-embedded myocardial tissues were cut into 4 µm-thick sections, deparaffinized in xylene, and rehydrated in ethanol. The sections were then stained with hematoxylin for 5 min. Following phosphate buffered saline (PBS) washes, the sections were incubated with eosin for 3 min, dehydrated, and cleared. The microscopic examination (Olympus, Tokyo, Japan) was employed to visualize the pathological alterations.
Masson’s trichrome staining
The sections (4 µm-thick) were deparaffinized, rehydrated, and treated with Regaud’s hematoxylin stains for 6 min. They were then differentiated in a 1% hydrochloric acid-ethanol solution for 3 s, and then incubated with ponceau-acid fuchsin solution for 1 min. The sections were then incubated for 5 min with phosphomolybdic acid, after which they were stained for 5 min with aniline blue solution. Subsequently, the sections were washed with acetic acid, dehydrated, and cleared. Myocardial fibrosis was identified by microscopic examination (Olympus).
Immunofluorescence staining
The paraffin-embedded myocardial tissues were sectioned at a thickness of 4 µm, deparaffinized in xylene, and rehydrated in ethanol. The tissue sections were then soaked in citrate-EDTA antigen retrieval solution (Beyotime, Shanghai, China) and heated at 95 to 100°C for 10 min in a microwave oven, followed by three washes with PBS. Subsequently, the sections were blocked with goat serum and then incubated with antibodies against glucose-regulating protein 78 (GRP78; #11587-1-AP; 1:200; Proteintech, Wuhan, China) and C/EBP homologous protein (CHOP; #15204-1-AP; 1:200; Proteintech) at 4°C overnight. After washing with PBS, the sections were incubated with Alexa Flour 555-conjugated immunoglobulin G (#A27039; 1:200; Invitrogen, San Diego, CA, USA) for 1 h at 25°C. The sections were then washed again and the nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 min. Finally, the stained sections were examined using a fluorescence microscope (Olympus).
Terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL)
The TUNEL assay was performed following the manufacturer’s procedures (Solarbio, Beijing, China). Paraffin-embedded tissues were sliced into 4 µm sections, deparaffinized in xylene, rehydrated, and permeabilized for 8 min with 0.1% Triton X-100. Subsequently, the sections were then incubated with 50 µl of TUNEL Reaction Solution for 60 min at 37°C. The nuclei were then stained with DAPI for 10 min. The apoptotic signal was visualized using fluorescence microscopy (Olympus).
Real-time PCR
Myocardial tissue RNAs were isolated using RNAiso Plus lysis buffer (TaKaRa, Tokyo, Japan) and the chloroform-isopropanol method. The obtained RNAs were reverse-transcribed into cDNAs using the First Strand cDNA Synthesis Kit with gDNA Eraser (cat. No. D7170L; Beyotime). Real-time PCR was performed using SYBR Green qPCR Mix (Beyotime) on the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences are listed in Table 1 and were synthesized by Sangon Biotech (Shanghai, China).
Table 1. Primers for real-time PCR.
| Genes | forward primer (5′–3′) | reverse primer (5′–3′) |
|---|---|---|
| IL-6 | TCCTACCCCAACTTCCAATGCTC | TTGGATGGTCTTGGTCCTTAGCC |
| IL-1β | CACCTCTCAAGCAGAGCACAG | GGGTTCCATGGTGAAGTCAAC |
| TNF-α | AAATGGGCTCCCTCTCATCAGTTC | TCTGCTTGGTGGTTTGCTACGAC |
| GAPDH | ATGATTCTACCCACGGCAAG | CTGGAAGATGGTGATGGGTT |
Western blotting
Homogenized myocardial tissues were lysed in radioimmunoprecipitation assay buffer (Abcam) to extract proteins. The protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretically transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking, the membranes were probed with antibodies against collagen I (#ab270993; 1:1,000; Abcam, Cambridge, MA, USA), collagen III (#ab184993; 1:1,000; Abcam), B cell lymphoma-2 (Bcl-2; #26593-1-AP; 1:3,000; Proteintech), Bcl-2-associated X protein (Bax; #2772; 1:1,000; CST, USA), cleaved caspase-3 (#9661; 1:1,000; CST, Shanghai, China), GRP78 (#11587-1-AP; 1:2,000; Proteintech), CHOP (#15204-1-AP; 1:1,500; Proteintech), protein kinase R-like ER kinase (PERK; #3192; 1:1,000; CST), phosphorylated (p)-PERK (#3179; 1:1,000; CST), c-Jun N-terminal kinase (JNK; #17572-1-AP; 1:3,000; Proteintech), p-JNK (#4668; 1:1,000; CST), p38 mitogen-activated protein kinase (p38 MAPK; #9212; 1:1,000; CST), p-p38 MAPK (#28796-1-AP; 1:1,000; Proteintech). Signals were monitored using horseradish peroxidase (HRP)-conjugated secondary antibody and electrochemiluminescence detection system.
ELISA assays
Myocardial tissues and serum were collected from rats. Levels of IL-6, IL-1β, and tumor necrosis factor (TNF)-α in myocardial tissues and serum were measured using ELISA Kits for IL-6/IL-1β/TNF-α (Beyotime) in accordance with the manufacturer’s instructions.
Statistical analysis
The data are presented as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Tukey’s test or Student’s t-test when the data followed a normal distribution. The nonparametric Mann-Whitney U test was applied when the data did not follow a normal distribution. A significance level of P<0.05 was used to determine statistical significance. All statistical analyses were performed using GraphPad Prism 8 (GraphPad Software Inc., San Diego, CA, USA).
Results
Daphnetin lowered blood glucose, improves cardiac dysfunction, and alleviates myocardial injury/fibrosis in diabetic rats
The study revealed that blood glucose levels were markedly elevated in diabetic rats. Daphnetin was found to reduce fasting blood glucose levels in diabetic rats in a dose-dependent manner (Fig. 1). Furthermore, echocardiographic analysis demonstrated that cardiac function was significantly impaired in diabetic rats 13 weeks after STZ injection. This was evidenced by increases in LVIDd and LVIDs as well as decreases in EF and FS. However, treatment with daphnetin demonstrated a dose-dependent improvement in cardiac function, as evidenced by a decrease in LVIDs and an increase in EF and FS in diabetic rats. A high dose of daphnetin resulted in a slight decrease in LVIDd without a significant difference (Fig. 2A). This suggests that daphnetin may improve cardiac function in DCM. To further investigate the effect of daphnetin on myocardial injury, several markers of myocardial injury were measured. Diabetes mellitus significantly increased serum levels of cTnT and the activities of CK-MB and LDH in rats. After daphnetin treatment, CK-MB, LDH, and cTnT were reduced in diabetic rats (Fig. 2B). In diabetic rats, cardiomyocytes exhibited hypertrophy and disorganization. Daphnetin was found to ameliorate the pathological changes induced by diabetes in the rats (Fig. 2C). Masson’s trichrome staining revealed that diabetes induced myocardial fibrosis in diabetic rats, while daphnetin dose-dependently ameliorated myocardial fibrosis in diabetic rats (Fig. 2D). Figure 2E showed that collagen Ⅰ and collagen Ⅲ expression levels were significantly upregulated in diabetic rats. Daphnetin treatment dose-dependently reduced both collagens in diabetic rats.
Fig. 1.
Daphnetin reduces blood glucose levels in diabetic rats. (A) Diabetic cardiomyopathy (DCM) was induced in SD rats via a single intraperitoneal injection of streptozotocin (STZ). Blood glucose levels were monitored at two-week intervals. ## indicates P<0.01 compared to the control group. * indicates P<0.05 and ** indicates P<0.01 compared to the STZ group.
Fig. 2.
Daphnetin improves cardiac dysfunction and alleviates myocardial injury/fibrosis in diabetic rats. (A) Cardiac function was evaluated by echocardiographic analysis, which included the measurement of left ventricular internal systolic and diastolic diameters (LVIDs and LVIDd), ejection fraction (EF), and fractional shortening (FS). (B) Several markers of myocardial injury (LDH, CK-MB, and cTnT) in serum were measured. (C) The pathological changes in myocardial tissues were evaluated by HE staining. (D) Myocardial fibrosis in rat hearts was analyzed by Masson’s trichrome staining. (E) The expression levels of collagen I and collagen III were determined by western blotting. GAPDH was utilized as the internal control. # indicates P<0.05 and ## indicates P<0.01 compared to the control group. ** indicates P<0.01 and ns indicates not significant compared to the STZ group.
Daphnetin inhibits inflammation in diabetic rats
Subsequently, the transcription levels of several pro-inflammatory cytokines in myocardial tissue were quantified by real-time PCR. The mRNA levels of IL-6, IL-1β, and tumor necrosis factor-α (TNF-α) were found to be elevated in diabetic rats compared to control rats. The administration of daphnetin reduced their mRNA levels in diabetic rats in a dose-dependent manner (Fig. 3A). The levels of pro-inflammatory cytokines were then quantified by ELISA. The serum and myocardial tissue of diabetic rats exhibited higher levels of IL-6, IL-1β, and TNF-α than control rats. Following treatment with daphnetin, the levels of IL-6, IL-1β, and TNF-α in both serum (Fig. 3B) and myocardial tissues (Fig. 3C) of diabetic rats were reduced in a dose-dependent manner.
Fig. 3.
Daphnetin inhibits inflammation in diabetic rats. (A) The mRNA levels of several pro-inflammatory cytokines in myocardial tissues were quantified by real-time PCR. GAPDH was utilized as the internal control. (B) The serum levels of TNF-α, IL-6, and IL-1β were quantified by ELISA. (C) The levels of TNF-α, IL-6, and IL-1β in myocardial tissues were determined by ELISA. ## indicates P<0.01 compared to the control group. * indicates P<0.05 and ** indicates P<0.01 compared to the STZ group.
Daphnetin suppresses ER stress-induced apoptosis in diabetic rats
To investigate the effect of daphnetin on ER stress in diabetic rats, western blotting was employed to determine the expression of key regulators. The results demonstrated that diabetic rats exhibited significantly elevated levels of CHOP and GRP78 expression, in addition to a higher p-PERK/PERK ratio, compared to control rats. However, daphnetin demonstrated a dose-dependent reduction in these levels (Fig. 4A). Immunofluorescence staining was also employed to examine the expression of CHOP and GRP78, which were found to be elevated in diabetic rats. Figure 4B illustrated that the expression levels of CHOP and GRP78 were reduced in diabetic rats treated with daphnetin in a dose-dependent manner. Furthermore, the impact of daphnetin on myocardial cell apoptosis in diabetic rats was assessed. The TUNEL assay demonstrated a higher number of apoptotic cells in diabetic rats compared to control rats. However, the administration of daphnetin dose-dependently reduced the number of apoptotic cells in diabetic rats (Fig. 4C). Moreover, in the myocardial tissues of rats, diabetes mellitus significantly reduced the expression of Bcl-2 while increasing the levels of cleaved caspase-3 and Bax. Treatment with daphnetin resulted in a dose-dependent decrease in cleaved caspase-3 and Bax levels, while increasing the level of Bcl-2 in diabetic rats (Fig. 4D).
Fig. 4.
Daphnetin suppresses endoplasmic reticulum (ER) stress-induced apoptosis in diabetic rats. (A) The expression levels of GRP78, CHOP, p-PERK, and PERK were examined by western blotting. The ratio of p-PERK/PERK was calculated. GAPDH was utilized as the internal control. (B) GRP78 and CHOP expression levels were quantified by immunofluorescence staining. (C) The number of apoptotic cells in myocardial tissues was determined by TUNEL assay. (D) The levels of Bax, Bcl-2, and cleaved caspase-3 in myocardial tissues were examined by western blotting. GAPDH was utilized as the internal control. ## indicates P<0.01 compared to the control group. * indicates P<0.05 and ** indicates P<0.01 compared to the STZ group.
Daphnetin inhibits p38 MAPK and JNK pathways in diabetic rats
We then evaluated the activation states of p38 MAPK and JNK in the myocardial tissues of diabetic rats. The results demonstrated a significant increase in the ratios of p-JNK/JNK and p-p38 MAPK/p38 MAPK were significantly increased in diabetic rats compared to control rats, indicating the activation of the p38 MAPK and JNK pathways in diabetic rats. The administration of daphnetin was observed to result in a dose-dependent decline in the ratios of p-JNK/JNK and p-p38 MAPK/p38 MAPK in diabetic rats (Fig. 5).
Fig. 5.
Daphnetin inhibits p38 MAPK and JNK signaling pathways in diabetic rats. Total proteins were extracted from myocardial tissues for subsequent analysis. The protein levels of p-p38 MAPK, p38 MAPK, p-JNK, and JNK were quantified by western blotting. The ratios of p-p38 MAPK/p38 MAPK and p-JNK/JNK ratios were calculated. GAPDH was utilized as the internal control. ## indicates P<0.01 compared to the control group. ** indicates P<0.01 compared to the STZ group.
Discussion
The STZ-induced type 1 diabetes animal model is a commonly utilized model for the study of DCM [16,17,18]. In this study, we employed the type 1 diabetes animal model to investigate the effect of daphnetin on DCM. The diabetic rats exhibited an increase in LVIDd and LVIDs, and a decrease in EF and FS, indicating the progression of cardiac dysfunction. The study revealed that diabetic rats exhibited symptoms of DCM, including disorderly arranged myocardial fibers, myocardial cell hypertrophy, infiltration of inflammatory cells, and myocardial fibrosis, as evidenced by HE and Masson staining. Daphnetin has been shown to possess protective effects against diabetes and its renal complications [13, 14]. Furthermore, recent evidence has indicated that daphnetin exerts a cardioprotective effect of daphnetin in mice [15]. However, the role and molecular mechanism of daphnetin in DCM remains unknown. The results of our study demonstrated that daphnetin reduced blood glucose levels in diabetic rats. Furthermore, it improved cardiac function, reduced biomarkers of myocardial injury, and mitigated pathological alterations in diabetic rats. These findings indicate that daphnetin exerts beneficial effects on DCM in rats. However, further research is necessary to elucidate the molecular mechanism of daphnetin in DCM.
The ER is a dynamic organelle that regulates a multitude of cellular processes, including lipid synthesis, protein quality control, and protein synthesis [19]. The accumulation of misfolded and unfolded proteins in the ER is a significant contributor to ER stress [20]. The involvement of ER stress in the pathogenesis of DCM is supported by an accumulating body of evidence [21, 22]. GRP78, a member of the heat shock protein 70 family, is a pivotal regulator of ER stress [23]. The study revealed that GRP78 expression was elevated in diabetic rats. During ER stress, activated GRP78 further induces the phosphorylation of PERK and nuclear translocation of ATF4, resulting in the transcription of CHOP [24]. Furthermore, an increase in the p-PERK/PERK ratio and CHOP expression was observed, indicating the activation of ER stress in diabetic rats. Inhibition of ER stress has been demonstrated to contribute to the amelioration of DCM in animal models [25, 26]. In this study, daphnetin dose-dependently reduced GRP78 and CHOP expression levels, as well as a dose-dependent reduction in the p-PERK/PERK ratio in diabetic rats. Previous studies have reported an increased degree of cardiomyocyte apoptosis has been reported in diabetic mice and patients [27, 28]. ER stress is one of the molecular mechanisms of cardiomyocyte apoptosis in DCM [29], and the activation of CHOP has been identified as a pro-apoptotic effect on cardiomyocytes [30]. The inhibition of ER stress-induced cardiomyocyte apoptosis contributes to the amelioration of DCM [31, 32]. In accordance with previous studies, diabetes induced cell apoptosis in the myocardial tissues of rats, which was accompanied by the regulation of anti- and pro-apoptotic proteins. Treatment with daphnetin inhibited myocardial cell apoptosis in diabetic rats. These finding indicate that daphnetin may mitigate DCM in rats by suppressing ER stress-mediated apoptosis.
Previous studies have suggested that ER stress is a primary contributor to the development of inflammation [33, 34]. Interestingly, the presence of inflammation can also give rise to ER stress in the context of diabetes [35]. A number of studies have identified a crosstalk between ER stress and inflammation [36, 37]. Therefore, we investigated whether daphnetin can protect against DCM in rats by regulating the inflammatory response. Inflammation plays a role in the progression of DCM [38]. IL-6, TNF-α, and IL-1β are commonly used to reflect the inflammatory state in DCM [39]. The serum and myocardial tissue levels of pro-inflammatory cytokines were elevated in diabetic rats. However, daphnetin treatment dose-dependently decreased these levels in diabetic rats. These findings indicate that daphnetin may mitigate DCM in rats by suppressing inflammation.
The MAPK family encompasses JNK, ERK, and p38 MAPK [40]. The activation of the JNK and p38 MAPK pathways has been associated with the development of inflammation and ER stress [41, 42]. Therefore, we investigated whether the JNK and p38 MAPK pathways are correlated with the protective effects of daphnetin against DCM. The results demonstrated that daphnetin treatment inhibited the p38 MAPK and JNK pathways in diabetic rats in a dose-dependent manner. The inactivation of these two MAPK pathways has been demonstrated to contribute to the amelioration of DCM in animal models [43, 44]. Daphnetin may alleviate DCM in rats by inhibiting the JNK and p38 MAPK pathways.
Conclusion
In conclusion, the administration of daphnetin resulted in a reduction in blood glucose levels in diabetic rats. Furthermore, daphnetin demonstrated a dose-dependent improvement in cardiac function, attenuation of myocardial injury, and a reduction in the inflammatory response, as well as suppression of ER stress-induced apoptosis, through the inactivation of JNK and MAPK in diabetic rats. These findings indicate that daphnetin may be a promising therapeutic agent for the treatment of DCM.
Data Availability Statement
Data available on request from the authors.
References
- 1.Sirdah MM, Reading NS. Genetic predisposition in type 2 diabetes: A promising approach toward a personalized management of diabetes. Clin Genet. 2020; 98: 525–547. doi: 10.1111/cge.13772 [DOI] [PubMed] [Google Scholar]
- 2.Saeedi P, Petersohn I, Salpea P, Malanda B, Karuranga S, Unwin N, et al. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res Clin Pract. 2019; 157: 107843. [DOI] [PubMed] [Google Scholar]
- 3.ElSayed NA, Aleppo G, Aroda VR, Bannuru RR, Brown FM, Bruemmer D, et al. , on behalf of the American Diabetes Association. 2. classification and diagnosis of diabetes: standards of care in diabetes-2023. Diabetes Care. 2023; 46:(Suppl 1): S19–S40. doi: 10.2337/dc23-S002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wang L, Cai Y, Jian L, Cheung CW, Zhang L, Xia Z. Impact of peroxisome proliferator-activated receptor-α on diabetic cardiomyopathy. Cardiovasc Diabetol. 2021; 20: 2. doi: 10.1186/s12933-020-01188-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cheng Y, Wang Y, Yin R, Xu Y, Zhang L, Zhang Y, et al. Central role of cardiac fibroblasts in myocardial fibrosis of diabetic cardiomyopathy. Front Endocrinol (Lausanne). 2023; 14: 1162754. doi: 10.3389/fendo.2023.1162754 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Chen X, Ren L, Liu X, Sun X, Dong C, Jiang Y, et al. Ranolazine protects against diabetic cardiomyopathy by activating the NOTCH1/NRG1 pathway. Life Sci. 2020; 261: 118306. doi: 10.1016/j.lfs.2020.118306 [DOI] [PubMed] [Google Scholar]
- 7.Tan Y, Zhang Z, Zheng C, Wintergerst KA, Keller BB, Cai L. Mechanisms of diabetic cardiomyopathy and potential therapeutic strategies: preclinical and clinical evidence. Nat Rev Cardiol. 2020; 17: 585–607. doi: 10.1038/s41569-020-0339-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Boulebd H, Amine Khodja I. A detailed DFT-based study of the free radical scavenging activity and mechanism of daphnetin in physiological environments. Phytochemistry. 2021; 189: 112831. doi: 10.1016/j.phytochem.2021.112831 [DOI] [PubMed] [Google Scholar]
- 9.Lv H, Liu Q, Zhou J, Tan G, Deng X, Ci X. Daphnetin-mediated Nrf2 antioxidant signaling pathways ameliorate tert-butyl hydroperoxide (t-BHP)-induced mitochondrial dysfunction and cell death. Free Radic Biol Med. 2017; 106: 38–52. doi: 10.1016/j.freeradbiomed.2017.02.016 [DOI] [PubMed] [Google Scholar]
- 10.Javed M, Saleem A, Xaveria A, Akhtar MF. Daphnetin: A bioactive natural coumarin with diverse therapeutic potentials. Front Pharmacol. 2022; 13: 993562. doi: 10.3389/fphar.2022.993562 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Fan X, Xie M, Zhao F, Li J, Fan C, Zheng H, et al. Daphnetin triggers ROS-induced cell death and induces cytoprotective autophagy by modulating the AMPK/Akt/mTOR pathway in ovarian cancer. Phytomedicine. 2021; 82: 153465. doi: 10.1016/j.phymed.2021.153465 [DOI] [PubMed] [Google Scholar]
- 12.Fan X, Gao Y, Hua C, Peng L, Ci X. Daphnetin ameliorates PM2.5-induced airway inflammation by inhibiting NLRP3 inflammasome-mediated pyroptosis in CS-exposed mice. Biomed Pharmacother. 2023; 165: 115047. doi: 10.1016/j.biopha.2023.115047 [DOI] [PubMed] [Google Scholar]
- 13.Vinayagam R, Xu B. 7, 8-Dihydroxycoumarin (daphnetin) protects INS-1 pancreatic β-cells against streptozotocin-induced apoptosis. Phytomedicine. 2017; 24: 119–126. doi: 10.1016/j.phymed.2016.11.023 [DOI] [PubMed] [Google Scholar]
- 14.Xu K, Guo L, Bu H, Wang H. Daphnetin inhibits high glucose-induced extracellular matrix accumulation, oxidative stress and inflammation in human glomerular mesangial cells. J Pharmacol Sci. 2019; 139: 91–97. doi: 10.1016/j.jphs.2018.11.013 [DOI] [PubMed] [Google Scholar]
- 15.Syed AM, Kundu S, Ram C, Kulhari U, Kumar A, Mugale MN, et al. Up-regulation of Nrf2/HO-1 and inhibition of TGF-β1/Smad2/3 signaling axis by daphnetin alleviates transverse aortic constriction-induced cardiac remodeling in mice. Free Radic Biol Med. 2022; 186: 17–30. doi: 10.1016/j.freeradbiomed.2022.04.019 [DOI] [PubMed] [Google Scholar]
- 16.Abukhalil MH, Althunibat OY, Aladaileh SH, Al-Amarat W, Obeidat HM, Al-Khawalde AAA, et al. Galangin attenuates diabetic cardiomyopathy through modulating oxidative stress, inflammation and apoptosis in rats. Biomed Pharmacother. 2021; 138: 111410. doi: 10.1016/j.biopha.2021.111410 [DOI] [PubMed] [Google Scholar]
- 17.Soetikno V, Sari FR, Sukumaran V, Lakshmanan AP, Mito S, Harima M, et al. Curcumin prevents diabetic cardiomyopathy in streptozotocin-induced diabetic rats: possible involvement of PKC-MAPK signaling pathway. Eur J Pharm Sci. 2012; 47: 604–614. doi: 10.1016/j.ejps.2012.04.018 [DOI] [PubMed] [Google Scholar]
- 18.Wang Y, Chen J, Li S, Zhang X, Guo Z, Hu J, et al. Exogenous spermine attenuates rat diabetic cardiomyopathy via suppressing ROS-p53 mediated downregulation of calcium-sensitive receptor. Redox Biol. 2020; 32: 101514. doi: 10.1016/j.redox.2020.101514 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Celik C, Lee SYT, Yap WS, Thibault G. Endoplasmic reticulum stress and lipids in health and diseases. Prog Lipid Res. 2023; 89: 101198. doi: 10.1016/j.plipres.2022.101198 [DOI] [PubMed] [Google Scholar]
- 20.Hu T, Wang J, Li W, Liu M, Han N, Yuan M, et al. Endoplasmic reticulum stress in hepatitis B virus and hepatitis C virus infection. Viruses. 2022; 14: 2630. doi: 10.3390/v14122630 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ao L, Chen Z, Yin J, Leng Y, Luo Y, Fu X, et al. Chinese herbal medicine and active ingredients for diabetic cardiomyopathy: molecular mechanisms regulating endoplasmic reticulum stress. Front Pharmacol. 2023; 14: 1290023. doi: 10.3389/fphar.2023.1290023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Sun S, Yang S, An N, Wang G, Xu Q, Liu J, et al. Astragalus polysaccharides inhibits cardiomyocyte apoptosis during diabetic cardiomyopathy via the endoplasmic reticulum stress pathway. J Ethnopharmacol. 2019; 238: 111857. doi: 10.1016/j.jep.2019.111857 [DOI] [PubMed] [Google Scholar]
- 23.Ibrahim IM, Abdelmalek DH, Elfiky AA. GRP78: A cell’s response to stress. Life Sci. 2019; 226: 156–163. doi: 10.1016/j.lfs.2019.04.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Kim TW. Fisetin, an anti-inflammatory agent, overcomes radioresistance by activating the PERK-ATF4-CHOP axis in liver cancer. Int J Mol Sci. 2023; 24: 9076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Tian JH, Wu Q, He YX, Shen QY, Rekep M, Zhang GP, et al. Zonisamide, an antiepileptic drug, alleviates diabetic cardiomyopathy by inhibiting endoplasmic reticulum stress. Acta Pharmacol Sin. 2021; 42: 393–403. doi: 10.1038/s41401-020-0461-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yu H, Zhen J, Yang Y, Gu J, Wu S, Liu Q. Ginsenoside Rg1 ameliorates diabetic cardiomyopathy by inhibiting endoplasmic reticulum stress-induced apoptosis in a streptozotocin-induced diabetes rat model. J Cell Mol Med. 2016; 20: 623–631. doi: 10.1111/jcmm.12739 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Li H, Yang Q, Huang Z, Liang C, Zhang DH, Shi HT, et al. Dual-specificity phosphatase 12 attenuates oxidative stress injury and apoptosis in diabetic cardiomyopathy via the ASK1-JNK/p38 signaling pathway. Free Radic Biol Med. 2022; 192: 13–24. doi: 10.1016/j.freeradbiomed.2022.09.004 [DOI] [PubMed] [Google Scholar]
- 28.Ljubkovic M, Gressette M, Bulat C, Cavar M, Bakovic D, Fabijanic D, et al. Disturbed fatty acid oxidation, endoplasmic reticulum stress, and apoptosis in left ventricle of patients with type 2 diabetes. Diabetes. 2019; 68: 1924–1933. doi: 10.2337/db19-0423 [DOI] [PubMed] [Google Scholar]
- 29.Liu Z, Cai H, Zhu H, Toque H, Zhao N, Qiu C, et al. Protein kinase RNA-like endoplasmic reticulum kinase (PERK)/calcineurin signaling is a novel pathway regulating intracellular calcium accumulation which might be involved in ventricular arrhythmias in diabetic cardiomyopathy. Cell Signal. 2014; 26: 2591–2600. doi: 10.1016/j.cellsig.2014.08.015 [DOI] [PubMed] [Google Scholar]
- 30.Li Y, Guo Y, Tang J, Jiang J, Chen Z. New insights into the roles of CHOP-induced apoptosis in ER stress. Acta Biochim Biophys Sin (Shanghai). 2014; 46: 629–640. doi: 10.1093/abbs/gmu048 [DOI] [PubMed] [Google Scholar]
- 31.Wang S, Duan J, Liao J, Wang Y, Xiao X, Li L, et al. LncRNA H19 inhibits ER stress induced apoptosis and improves diabetic cardiomyopathy by regulating PI3K/AKT/mTOR axis. Aging (Albany NY). 2022; 14: 6809–6828. doi: 10.18632/aging.204256 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Preetha Rani MR, Salin Raj P, Nair A, Ranjith S, Rajankutty K, Raghu KG. In vitro and in vivo studies reveal the beneficial effects of chlorogenic acid against ER stress mediated ER-phagy and associated apoptosis in the heart of diabetic rat. Chem Biol Interact. 2022; 351: 109755. doi: 10.1016/j.cbi.2021.109755 [DOI] [PubMed] [Google Scholar]
- 33.Eugene SP, Reddy VS, Trinath J. Endoplasmic reticulum stress and intestinal inflammation: a perilous union. Front Immunol. 2020; 11: 543022. doi: 10.3389/fimmu.2020.543022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Yang B, Yang L, Wang Y, Maddison LA, Tang Z, Haigh S, et al. Macrophages and neutrophils are necessary for ER stress-induced β cell loss. Cell Rep. 2022; 40: 111255. doi: 10.1016/j.celrep.2022.111255 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Deshwal S, Forkink M, Hu CH, Buonincontri G, Antonucci S, Di Sante M, et al. Monoamine oxidase-dependent endoplasmic reticulum-mitochondria dysfunction and mast cell degranulation lead to adverse cardiac remodeling in diabetes. Cell Death Differ. 2018; 25: 1671–1685. doi: 10.1038/s41418-018-0071-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ajoolabady A, Lebeaupin C, Wu NN, Kaufman RJ, Ren J. ER stress and inflammation crosstalk in obesity. Med Res Rev. 2023; 43: 5–30. doi: 10.1002/med.21921 [DOI] [PubMed] [Google Scholar]
- 37.Li W, Cao T, Luo C, Cai J, Zhou X, Xiao X, et al. Crosstalk between ER stress, NLRP3 inflammasome, and inflammation. Appl Microbiol Biotechnol. 2020; 104: 6129–6140. doi: 10.1007/s00253-020-10614-y [DOI] [PubMed] [Google Scholar]
- 38.Sanganalmath SK, Dubey S, Veeranki S, Narisetty K, Krishnamurthy P. The interplay of inflammation, exosomes and Ca2+ dynamics in diabetic cardiomyopathy. Cardiovasc Diabetol. 2023; 22: 37. doi: 10.1186/s12933-023-01755-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Wu H, Liu G, He Y, Da J, Xie B. Obeticholic acid protects against diabetic cardiomyopathy by activation of FXR/Nrf2 signaling in db/db mice. Eur J Pharmacol. 2019; 858: 172393. doi: 10.1016/j.ejphar.2019.05.022 [DOI] [PubMed] [Google Scholar]
- 40.Wydra VR, Ditzinger RB, Seidler NJ, Hacker FW, Laufer SA. A patent review of MAPK inhibitors (2018–present). Expert Opin Ther Pat. 2023; 33: 421–44. [DOI] [PubMed]
- 41.Kwak AW, Cho SS, Yoon G, Oh HN, Lee MH, Chae JI, et al. Licochalcone H synthesized by modifying structure of licochalcone C extracted from glycyrrhiza inflata induces apoptosis of esophageal squamous cell carcinoma cells. Cell Biochem Biophys. 2020; 78: 65–76. doi: 10.1007/s12013-019-00892-3 [DOI] [PubMed] [Google Scholar]
- 42.Plastira I, Bernhart E, Joshi L, Koyani CN, Strohmaier H, Reicher H, et al. MAPK signaling determines lysophosphatidic acid (LPA)-induced inflammation in microglia. J Neuroinflammation. 2020; 17: 127. doi: 10.1186/s12974-020-01809-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ding W, Feng H, Li WJ, Liao HH, Zhang N, Zhou ZY, et al. Apocynin attenuates diabetic cardiomyopathy by suppressing ASK1-p38/JNK signaling. Eur J Pharmacol. 2021; 909: 174402. doi: 10.1016/j.ejphar.2021.174402 [DOI] [PubMed] [Google Scholar]
- 44.Zuo G, Ren X, Qian X, Ye P, Luo J, Gao X, et al. Inhibition of JNK and p38 MAPK-mediated inflammation and apoptosis by ivabradine improves cardiac function in streptozotocin-induced diabetic cardiomyopathy. J Cell Physiol. 2019; 234: 1925–1936. doi: 10.1002/jcp.27070 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data available on request from the authors.





