Berberine decorated zinc oxide loaded chitosan nanoparticles a potent anti cancer agent against breast cancer

Abstract

Breast cancer ranks as the second leading reason of cancer mortality among females globally, emphasizing the critical need for novel anticancer treatments. In current work, berberine-zinc oxide conjugated chitosan nanoparticles were synthesized and characterized using various characterization techniques. The cytotoxic effects of CS-ZnO-Ber NPs on MCF-7 cells were assessed using the MTT assay. Also, annexin V-FITC/PI double staining, Hoechst 33,342 staining, caspases-8 and 9 activity assays, and cell cycle analysis were performed. Furthermore, the mRNA levels of Bax and Bcl-2 genes were quantified using qPCR. Additionally, cell migration was evaluated using a scratch assay. The IC₅₀ value of NPs against MCF-7 cells measured 7.41 µg/mL. Apoptosis induction in NP-treated cells was confirmed by Annexin V/PI staining, accompanied by the observation of condensed chromatin and fragmented DNA. Moreover, the pro-apoptotic potential of NPs was evidenced by significant increases in caspases-8 and 9 activity and a decreased Bcl-2/Bax ratio. Furthermore, cell cycle arrest at the sub-G1 was noticed in the treated cells. Additionally, the NPs markedly inhibited the migration rate of MCF-7 cells. These findings suggest that CS-ZnO-Ber NPs induce cell-cycle arrest and activate the apoptotic pathways in MCF-7 cells, highlighting their potential as a hopeful therapeutic agent for breast cancer.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-87445-2.

Introduction

Breast cancer is a highly pervasive type of malignancy identified in females, marked by the uncontrolled growth of mammary tissue. Breast cancer is the second reason for cancer-relevant deaths among women. It ranks as the second most widespread form of cancer globally, constituting approximately a quarter of all documented cases of cancer in females¹. Surgery, radiotherapy, and chemotherapy are the prevailing therapeutic approaches for breast cancer; nevertheless, a significant portion of patients often encounter drug resistance or experience relapse at a later stage. The disruption of the equilibrium between proliferating cells and apoptosis is a distinctive feature of cancer cells. Inducing apoptotic pathways in tumor cells is a vital strategy in cancer therapy².

Employing nanoparticles (NPs) as drug adjuvants or delivery tools results in enhanced drug accumulation at the tumor site, thereby augmenting the efficacy of cancer treatment. The impact of zinc oxide nanoparticles (ZnO NPs) on cancer cells has been documented, suggesting a notable influence on triggering apoptosis^3,4. Thus, ZnO nanostructures could be a potential tool for anticancer purposes, offering a potential approach for developing anti-tumor treatments.

Additionally, various natural substances such as baicalin, rutin, and curcumin have shown a wide array of biological functions, making them increasingly favored within the healthcare sector due to their cost-effectiveness and safety. Berberine, an isoquinoline alkaloid present in medicinal plants of the Ranunculaceae, Rutaceae, and Berberidaceaefamilies, offers an array of medicinal attributes involving antimicrobial, anti-inflammatory, and anticancer properties⁵.

Biodegradable polymeric nanoparticles offer several benefits in cancer treatment, as they have been shown to reduce overall toxicity by providing a protective enclosure for drugs and limiting their interaction with healthy cells. Encapsulation additionally enhances the effectiveness, retention time, bioavailability, and penetration of the drugs⁶. Tan et al. reported that a poly(lactic acid)-alginate nanocarrier enhanced the anticancer efficacy of betulinic acid (BA) and ceranib-₂ (Cer) against PC-₃prostate cancer cells compared to free BA-Cer⁷. Chitosan (CS) is a natural linear biopolymer composed of D-glucosamine (GlcN) and N-acetylglucosamine (GlcNAc) units. CS is derived from the deacetylation of chitin, the second most prevalent natural polymer. The distinctive attributes of chitosan nanoparticles (CS NPs), such as their biodegradability, biocompatibility, and high molecule-carrying capacity, make them highly suitable for applications in drug delivery and tissue engineering. Additionally, CS can effectively adhere to negatively charged mucus membranes, enhancing retention time and improving cellular uptake⁸. These properties make CS an ideal candidate for encapsulating therapeutic agents.

This work investigated the effect of berberine-zinc oxide conjugated chitosan nanoparticles (CS-ZnO-Ber NPs) on inhibiting the growth of breast cancer cells (MCF-7). To our knowledge, no prior research has explored the potential application of CS-ZnO-Ber NPs for treating MCF-7 breast cancer cells.

Materials and methods

Materials

ZnO NPs were purchased from US Research Nanomaterials, Inc (USA). Berberine chloride hydrate (L03807, water < 17%) was obtained from Alfa Aesar (USA). Medium molecular weight chitosan (448877, 75–85% deacetylated), 2,7-Dichlorofluorescein diacetate (DCFH-DA), Annexin V-FITC Apoptosis Detection Kit, acridine orange, and propidium iodide (AO/PI), Hoechst 33,342, and paraformaldehyde were sourced from Sigma-Aldrich (USA). Caspase-8 and Caspase-9 Assay Kits (Colorimetric) were purchased from Abnova (Taiwan). Sheep red blood cell (RBC) suspension was acquired from Darvash Co. (Iran). The human breast cancer cell line (MCF-7) and the human embryonic kidney cell line (HEK-293) were acquired from the Pasteur Institute of Iran (Iran). Dulbecco’s Modified Eagle Medium (DMEM) high glucose, Roswell Park Memorial Institute 1640 (RPMI 1640) medium, fetal bovine serum (FBS), penicillin and streptomycin (Pen/Strep) 100x, Trypsin-EDTA(1X) 0.25%, and Trypan Blue (0.4%) were purchased Bioidea Co. (Iran). 3-(4,5-dimethyl-2-Thiazyl)−2, 5-diphenyl-2 H-tetrazolium bromide (MTT) was procured from Merck (Germany). Trizol reagent was obtained from Invitrogen (USA). Deoxyribonuclease I (DNase I) was acquired from Thermo Fisher Scientific (USA). cDNA synthesis kit and SYBR green qPCR master mix were purchased from Yekta Tajhiz (Iran).

Synthesis of CS-ZnO-Ber NPs

First, ZnO NPs (US Research Nanomaterials, USA) were dispersed in acetic acid (1% v/v) at a concentration of 40 mg/mL. Additionally, berberine was dispersed in Dimethylsulfoxide (DMSO) to make a 20 mg/mL solution and then mixed with the ZnO NPs solution under stirring for 1 h. Afterward, the ZnO-Ber mixture was slowly dropped into a 0.5% chitosan solution in acetic acid (1% v/v). To adjust the pH to 10, a 2 M NaOH solution was added drop by drop. After 18 h of stirring, the mixture was subjected to centrifugation. The nanoparticles were then collected, washed with deionized water, and oven-dried at 50 °C (Fig. 1)⁹.

Fig. 1.

Schematic representation for the synthesis of CS-ZnO-Ber NPs.

Characterization of CS-ZnO-Ber NPs

The CS-ZnO-Ber NPs were subjected to analysis of their size and morphology using Field Emission Scanning Electron Microscopy (FESEM) (Carl Zeiss Supra 25). Fourier transform spectroscopy (FTIR-Thermo Nicolet Avatar 360, USA) was utilized to identify the functional groups, while the crystalline structure was characterized using an X-ray diffractometer (Philips PW 1730, Netherlands). Additionally, the zeta potential value was determined by a Zeta potential analyzer (SZ-100z, Horiba Jobin Jyovin, Japan). Energy Dispersive X-ray Spectroscopy (EDX, SAMX, France) was used to determine the elemental composition.

Cell culture

The MCF-7 and HEK-293 cells were cultivated in DMEM and RPMI 1640, respectively. The culture media was supplemented with FBS (10% v/v) and Pen-Strep (1% v/v). The cells were cultured in T75 flasks and kept in a humidified atmosphere at 37 °C with 5% CO₂ to reach the logarithmic growth phase.

Hemocompatibility of CS-Zno-ber NPs

The hemocompatibility assessment of CS-ZnO-Ber NPs was performed using the following protocol¹⁰. First, red blood cells (RBCs) were diluted in physiological saline (0.9% sodium chloride) to prepare a 2% suspension. The 2% RBC suspension was then mixed with varying concentrations of NPs (6.25–100 µg/mL) in a 1:1 ratio and maintained in an incubator at 37 °C with slight shaking for 2 h. 0.9% sodium chloride was considered the negative control, whereas distilled water was considered the positive control. The mixture was then centrifuged, and lysed RBCs were observed by the change in color of the supernatant. A quantitative investigation of hemolysis was conducted using UV/Vis spectrophotometer measurements at 430 nm. The percentage of RBC lysis was calculated using the following equation:

.

MTT assay

The cytocompatibility and cytotoxicity of CS-ZnO-Ber NPs against HEK-293 and MCF-7 cells, respectively, were measured using the MTT assay¹¹. A suspension of HEK-293 and MCF-7 cells was prepared and plated into 96-well microplates at a density of 1 × 10⁵ cells/well. The plates were transferred to a CO₂ incubator at 37 °C for 24 h. Then, various concentrations of CS-ZnO-Ber NPs were added to the cells and incubated overnight. Subsequently, the media was discarded, and the wells were filled with MTT dye (5 mg/mL). The 96-well microplates were then incubated in a CO₂ incubator at 37 °C, protected from light. The MTT dye was replaced with DMSO, and the plates were placed on a shaker to solubilize the formazan crystals. The microplate was inserted into an ELISA reader, and the absorbance was recorded at 570 nm. The percentage of viable cells was determined using the viability Eq. 1²:

ROS generation assay

DCFH-DA was utilized to assess intracellular reactive oxygen species (ROS) levels. Initially, MCF-7 cells were seeded in 6-well plates at a concentration of 2 × 10⁵ cells/well and incubated at 37 °C. The following day, the cells were exposed to the IC₅₀ of CS-ZnO-Ber NPs overnight. Subsequently, the cells were harvested by trypsinization and rinsed with phosphate-buffered saline (PBS). Subsequently, the cells were stained with 10 µM DCHF-DA solution for 30 min at 37 °C. Following washing the cells, the intensity of fluorescence was assessed using a flow cytometer.

Cell cycle analysis

The MCF-7 cells were treated with the NPs for 24 h. The cells were collected through trypsinization and then rinsed with PBS. For fixation, precooled ethanol (70%) was added to the cells, which were subsequently stored at − 20 ºC overnight. The cells were rinsed with PBS and resuspended in ribonuclease (RNase)/propidium iodide (PI) staining solution. After incubating for 30 min away from light and at 37 °C, the distribution of the cells in different phases was examined using a flow cytometer¹².

Apoptosis assays

Apoptotic/necrotic rates in MCF-7 cells were evaluated using Annexin V/Propidium Iodide (PI) staining¹². Briefly, MCF-7 cells (1 × 10⁶) were seeded in 6-well plates for 24 h, and then treated with the IC₅₀ value of the NPs. Following 24 h of incubation, cells were separated via trypsinization and rinsed with precooled PBS. Afterward, the cell pellet was solubilized in Annexin V binding buffer (1x) and stained with FITC-conjugated Annexin V and PI for 15 min, protected from light. Apoptotic cells were then analyzed using a flow cytometer and FlowJo software.

Acridine orange/propidium iodide (AO/PI) staining

Differentiation between cells at the various stages of apoptosis and necrosis was determined using the Acridine Orange (AO) and PI staining method¹². Briefly, MCF-7 cells were added in 6-well plates at a concentration of 1 × 10⁶ cells/well and cultivated for 24 h. The following day, cells were exposed to the NPs (IC₅₀ concentration, 24 h). After treatment, the cells were trypsinized, rinsed with PBS, and fixed with formaldehyde for 20 min. The cell pellets were stained with AO/PI solution for 2 min, and protected from light. Next, the mixture was transferred onto a glass microscope slide and examined under a fluorescence microscope (Eclipse 50i, Nikon, Tokyo, Japan).

Hoechst staining

Initially, MCF-7 cells were cultured in 6-well plates at a concentration of 4 × 10⁵ cells/well and maintained in a CO₂ incubator overnight. The cells were then exposed to the IC₅₀ concentration of NPs overnight. Subsequently, the cells were rinsed with PBS and fixed with 3.7% paraformaldehyde (4 °C for 30 min). After that, cells were stained with Hoechst 33,342 (1 mg/mL) for 30 min in the dark conditions, and cell nuclear morphology was observed by fluorescence microscope.

Caspase activity

The activity of caspase-8, and caspase-9 was evaluated using caspase assay kits. Briefly, MCF-7 cells were cultured in the presence of NPs overnight. Then, treated cells were collected and mixed with cell lysis buffer. After 1 h, cell lysates were incubated with specific substrates (IETD-p-nitroaniline and LEHD-p-nitroaniline) at 37 °C for 1 h, and the absorbance of each sample was assessed at 405 nm.

Real-time PCR assay

MCF-7 cells were treated with NPs (IC₅₀) for 24 h, and total RNA was extracted using the Trizol reagent according to the manufacturer’s instructions. The extracted RNA was then treated with DNase I and converted to cDNA using the reverse transcriptase enzyme. The relative mRNA expression levels of the target genes (Bax and Bcl-2) were measured by qPCR using the SYBR Green master mix and specific primers (SinaClon, Iran). The GAPDH gene was employed as an endogenous positive control to normalize expression, and the fold change value was calculated using the 2^–ΔΔCtmethod¹². Table 1 provides the details of the primers utilized for gene amplification.

Table 1.

Sequences of the primers used in qPCR.

Gene	Primer direction	Sequence (5′−3′)	Amplicon Size (bp)	Accession No.
Bax	Fw	CGGCAACTTCAACTGGGG	149	NM_001291428.2
Bax	Rev	TCCAGCCCAACAGCCG
Bcl-2	Fw	GGTGCCGGTTCAGGTACTCA	114	NM_000633.3
Bcl-2	Rev	TTGTGGCCTTCTTTGAGTTCG
GAPDH	Fw	CCCACTCCTCCACCTTTGAC	75	NM_002046.7
GAPDH	Rev	CATACCAGGAAATGAGCTTGACAA

Bax Bcl-2-associated X protein, Bcl-2 B-cell leukemia/lymphoma 2 protein, GAPDH Glyceraldehyde 3-phosphate dehydrogenase.

Cell migration assay

The anti-migration effects of CS-ZnO-Ber NPs in MCF-7 cells were evaluated using a scratch assay. Initially, MCF-7 cells were grown in 24-well plates to reach confluency. After aspirating the media, the adherent cells were rinsed with PBS. A sterile yellow pipette tip was utilized to generate a scratch in the monolayer, and the detached cells were then removed by washing. Then, DMEM containing FBS (2%) and CS-ZnO-Ber NPs (at IC₅₀ concentration) was added to the wells, and the plate was kept in a CO₂ incubator for 2 days. At 0, 24, and 48 h, the scratch areas were imaged under an inverted microscope, and the cell migration rate was analyzed using ImageJ software. The migration rate of MCF-7 cells was determined using the following formula:

Statistical analysis

The findings are expressed as the mean with standard deviation. Group differences were assessed using a T-test, and ANOVA with p-values below 0.05 deemed statistically significant.

Results

Characterization of CS-ZnO-Ber NPs

As shown in Fig. 2a, CS-ZnO-Ber NPs exhibited an amorphous morphology, with sizes varying from 34.71 to 407.7 nm. Additionally, the zeta potential value of the CS-ZnO-Ber NPs was − 38.5 mV (Fig. 2b).

Fig. 2.

FESEM image (a) and Zeta potential graph (b) of CS-ZnO-Ber NPs.

The FT-IR spectra of CS, ZnO NPs, Ber, and CS-ZnO-Ber NPs were illustrated in Fig. 3a. In the FT-IR spectra of CS, C-H bands were identified at 2921 cm⁻¹ and 2879 cm⁻¹. Additionally, the band at 1666 cm⁻¹ is related to the C = O group. Moreover, the peaks at 1377 cm⁻¹ and 156 cm⁻¹ correspond to the CH₃ and C-O vibrations, respectively. As shown in the FT-IR spectrum of ZnO NPs, typical absorption peaks appeared at 630 cm⁻¹ and 660 cm⁻¹. Furthermore, minor absorption bands were found at 1510 cm⁻¹ and 1579 cm⁻¹. Two bands at 3405 cm⁻¹ and 2944 cm⁻¹ were identified in the FT-IR spectra of Ber, corresponding to O–H and C–H, respectively. The bands at 1626 cm⁻¹ and 1599 cm⁻¹ indicate the heterocyclic amines. The FT-IR spectra of CS-ZnO-Ber NPs clearly show the bands associated with CS, ZnO, and Ber.

Fig. 3.

FTIR spectra (a) and XRD patterns (b) of CS, ZnO NPs, Ber, and CS-ZnO-Ber NPs.

The XRD patterns of CS, ZnO, Ber, and CS-ZnO-Ber NPs are shown in Fig. 3b. Two prominent peaks at 11.6° and 20.09° were detected in the XRD spectra of CS. The crystalline structure of ZnO NPs was confirmed by diffraction peaks at 31.46°, 34.29°, 36.33°, 47.51°, 56.50°, 62.84°, 67.79°, and 76.83°. The Ber diffraction peaks appeared at 2θ angles of 9.12°, 13.00°, 16.32°, 21.19°, 22.94°, 24.54°, and 25.56°. The XRD pattern of CS-ZnO-Ber NPs showed that the crystalline structure of ZnO NPs was preserved despite being coated with Ber.

The elemental composition and mapping of CS-ZnO-Ber NPs were analyzed using EDX. As shown in Fig. 4a, the EDX spectrum displays peaks corresponding to zinc, carbon, nitrogen, and oxygen, which are attributed to ZnO, CS, and Ber. Furthermore, elemental mapping (Fig. 4b–f) confirmed the presence of these elements within the CS-ZnO-Ber NPs.

Fig. 4.

EDX spectrum (a) and elemental mapping analysis (b-f) of CS-ZnO-Ber NPs. (Zn: zinc, O: oxygen, C: carbon, N: nitrogen).

Biocompatibility of CS-Zno-ber NPs

The hemocompatibility of CS-ZnO-Ber NPs was assessed using a hemolysis assay. The RBCs were exposed to different concentrations of NPs, as shown in Fig. 5a. Our results revealed that the hemolytic activity caused by various concentrations of NPs ranged from 1 to 4%. A hemolysis percentage below 5% is considered to be safe. Consequently, the synthesized nanoparticles are biocompatible and do not cause damage to erythrocytes.

Fig. 5.

Biocompatibility evaluation of CS-ZnO-Ber NPs. (a) Hemocompatibility assessment: (top panel) Representative images of a 2% erythrocyte solution after exposure to various concentrations of CS-ZnO-Ber NPs, and (bottom panel) hemolysis (%) diagram. (b) Cytocompatibility assessment: (top panel) Representative images of HEK-293 cells after treatment with varying concentrations of CS-ZnO-Ber NPs for 24 h, observed using an inverted microscope: (A) 0 µg/mL, (B) 125 µg/mL, (C) 62.5 µg/mL, (D) 31.25 µg/mL, (E) 15.62 µg/mL, and (F) 7.81 µg/mL, and (bottom panel) cell viability graph. The images were taken at a magnification of 40X. Results are presented as mean ± standard deviation (SD). (**P < 0.01, and ***P < 0.001, indicate statistical significance, whereas ns is non-significance).

The cytocompatibility of CS-ZnO-Ber NPs against HEK-293 cells was assessed using the MTT assay. As shown in Fig. 5b, a concentration of 7.81 µg/mL did not significantly reduce HEK-293 cell viability, which remained at 91.34%. In contrast, concentrations ranging from 15.62 to 500 µg/mL significantly decreased cell viability compared to the control group. The percentage of cell viability at 15.62, 31.25, 62.5, 120, 250, and 500 µg/mL was 66.5%, 13.89%, 12.01%, 6.09%, 4.94%, and 5.79 respectively. Additionally, the IC₅₀ value was calculated to be 23 µg/mL.

MTT assay

The antiproliferative effects of CS-ZnO-Ber NPs against MCF-7 cells were evaluated using the MTT method. Increasing the concentration of CS-ZnO-Ber NPs led to a decrease in cell viability percentage, as illustrated in Fig. 6. Also, the IC₅₀ was 7.41 µg/mL. Moreover, the microscopic images of MCF-7 cells after exposure to NPs are presented in Fig. 6A-F. As illustrated in Fig. 6A, in the absence of NPs, MCF-7 cells display characteristic dome-shaped structures. Nevertheless, the cells subjected to NPs treatment exhibit distinct changes in both morphology and quantity (Fig. 6B-F). Specifically, the cells tend to assume a more rounded morphology, and the cell density progressively decreases with increasing NPs concentration.

Fig. 6.

MTT assay of MCF-7 cells incubated with different concentrations of CS-ZnO-Ber NPs. Representative images of MCF-7 cells after treatment with varying concentrations of CS-ZnO-Ber NPs for 24 h, observed using an inverted microscope: (A) 0 µg/mL, (B) 62.5 µg/mL, (C) 31.25 µg/mL, (D) 15.62 µg/mL, (E) 7.81 µg/mL, and (F) 3.90 µg/mL. (G) cell viability graph. The images were taken at a magnification of 40X. Results are presented as mean ± standard deviation (SD). (**P < 0.01, ***P < 0.001, and ****P < 0.0001 indicate statistical significance).

ROS generation assay

We quantified ROS levels in cells using flow cytometry. DCFH-DA is converted to DCFH- after deacetylation by cellular esterases. ROS induces the oxidation of DCFH- to the fluorescent compound DCFH+. As shown in Fig. 7a and b, control cells exhibited 7.05% DCFH+, while the NP-treated cells showed a substantial 85% increase in DCFH + levels. Our results demonstrate a significant elevation in ROS levels within MCF-7 cells after exposure to IC₅₀ of CS-ZnO-Ber NPs.

Fig. 7.

Effect of IC₅₀ of CS-ZnO-Ber NPs on ROS generation in MCF-7 cells compared to the untreated cells: (a) Flow cytometry analysis using 2,7-dichlorofluorescein diacetate (DCFH-DA) to evaluate ROS generation, and (b) fluorescence intensity (%) diagram in control and NP-treated groups. Values are expressed as mean ± standard deviation (SD). (**P < 0.01 indicate statistical significance).

Cell cycle assay

The evaluation of cell cycle arrest after 24-h treatment of MCF-7 cells with IC₅₀ of NPs was performed using flow cytometry. According to the results (Fig. 8a, b), the percentage of cells in the Sub G0/G1 phase increased from 1.25 to 35% compared to the untreated cells, indicating apoptotic cell death. The cell count in the G0/G1 phase decreased to 45.87%, as opposed to the control group, which had 64.42%. Moreover, the NPs reduced the cell population in the S and G2/M phases, indicating the hindering of DNA replication and cell division, respectively.

Fig. 8.

Cell cycle analysis: (a) Histogram of untreated and NP-treated MCF-7 cells, and (b) Quantitative analysis of the cell cycle.

Apoptosis assays

To assess the effect of NPs (IC₅₀ value for 24 h) on the apoptotic and necrotic cell populations, we employed flow cytometry analysis. As depicted in Fig. 9, the proportion of viable cells in the control group markedly reduced from 95.79 to 55.92% after exposure to NPs. Additionally, the percentage of early apoptotic cells (annexin V FITC+/PI- quadrant) increased from 0.39 to 28.09%, and late apoptotic cells (annexin V FITC+/PI + quadrant) increased from 0.16 to 14.93% following treatment with NPs. However, the percentage of necrotic cells remained largely unchanged in both groups. Our results indicate that NPs induce apoptosis in MCF-7 cells.

Fig. 9.

Apoptosis induced by CS-Zno-Ber NPs (IC₅₀ value) in MCF-7 cells was evaluated after 24 h using flow cytometry and annexin V-FITC/PI staining. Q4, Annexin V‑ PI‑ (living cells); Q3, Annexin V + PI‑ (early apoptotic cells); Q2, Annexin V + PI+ (late apoptotic cells), and Q1, Annexin V- PI+ (necrotic cells).

Acridine Orange/Propidium Iodide (AO/PI) staining

Qualitative analysis of apoptosis and necrosis was conducted using AO/PI staining. As shown in Fig. 10a, a high population of orange-colored cells was observed in the NP-treated group, indicating cell apoptosis. Moreover, cell membrane blebbing and chromatin condensation, which are morphological changes associated with early apoptosis, were observed in cells treated with CS-ZnO-Ber NPs. Furthermore, the presence of reddish-orange cells indicates PI binding to denatured DNA during late apoptosis. In contrast, untreated cells were green-colored with normal morphology (Fig. 10b).

Fig. 10.

(a, b) Fluorescence microscopy analysis of MCF-7 cells using AO/PI staining. (a) untreated and (b) CS-Zno-Ber NPs-treated cells. Untreated cells displayed an intact green color with normal morphology. In contrast, NP-treated cells exhibited a bright green color with chromatin condensation and membrane blebbing, indicating early apoptosis. Furthermore, late apoptotic features, such as apoptotic bodies and orange-colored cells, were observed in the NP-treated group. (c, d) Nuclear morphologic changes of MCF-7 cells using Hoechst 33,342 staining. (c) Untreated, and (d) NP-treated (IC₅₀ for 24 h) cells. Apoptotic features were clarified by fragmented nuclei and intense blue fluorescence in the NP-treated group, compared to the untreated group, which showed round nuclei and weak blue fluorescence.

Hoechst staining

Nuclear changes induced by CS-ZnO-Ber NPs in MCF-7 cells were examined using Hoechst 33,342 staining. Based on fluorescence images, the NP-treated cells exhibited condensed chromatin, fragmented nuclei, and intense blue fluorescence, indicating apoptotic body formation (Fig. 10c). In contrast, untreated cells appeared as normal cells with round nuclei and weak blue fluorescence (Fig. 10d). These observations strongly support the effective induction of apoptosis in MCF-7 cells following NPs treatment.

Caspase activity

The impact of the NPs on caspase-8 and caspase-9 activity in MCF-7 cells was assessed to elucidate the apoptosis mechanism. The activation of caspase-8 represents the extrinsic-mediated pathway of apoptosis, while the activation of caspase-9 indicates the intrinsic-mediated pathway. As depicted in Fig. 11a, the activity of both caspases considerably rose (P < 0.001) in the NP-treated groups compared to the untreated cells. Following treatment with NPs, the activity of caspases-8 and 9 increased to 3.27 and 2.95 times, respectively, suggesting the dominant role of the extrinsic pathway of apoptosis.

Fig. 11.

Induction of caspase-8 and caspase-9 activity in MCF-7 cells after 24 h of treatment with CS-ZnO-Ber NPs, indicating significant apoptosis (a), and Effect of CS-Zno-Ber NPs on Bax and Bcl-2 mRNA expression in MCF-7 cells (b). Values represent means ± standard deviation (SD). (**P < 0.01, and ***P < 0.001, whereas ns is non-significance).

Real-time PCR assay

The expression levels of apoptotic genes of (Bax and Bcl-2) in NP-treated and control cells were assessed using a qPCR assay. As illustrated in Fig. 11b, treating MCF-7 cells with NPs upregulated Bax gene expression to 3.42-fold, whereas Bcl-2 gene expression was reduced by 0.34-fold. The qPCR data are provided in Supplementary File 1.

Cell migration assay

As shown in Fig. 12a and b, the rate of cell migration was considerably diminished in the NP-treated cells. In the absence of NPs, the migration rate of MCF-7 cells after 24 and 48 h was measured as 80.61% and 98.04%, respectively. Meanwhile, the cell migration rates in the presence of NPs were calculated as 39.76% and 58.03% after 24 and 48 h, respectively.

Fig. 12.

Scratch assay of MCF-7 cells. (a) Microscopy examination of cell migration after treatment by CS-ZnO-Ber NPs, and (b) quantitative analysis of migration rate. Data are expressed as mean ± standard deviation (SD). (**P < 0.01 relative to negatively untreated cells).

Discussion

Today, cancer is among the primary causes of mortality globally. Many traditional anticancer therapies fail to prevent the disease’s progression¹. ZnO NPs have been found to exhibit potent antiproliferative activity against MCF-7 cells. For example, Boroumand Moghaddam et al. showed ZnO NPs at 121 µg/mL concentration inhibited 50% growth of MCF-7 cells¹³. Additionally, combining metal NPs with anticancer agents amplifies their anticancer efficacy. Malaikozhundan et al. demonstrated that 32.8 µg/mL of Pongamia pinnata-coated ZnO NPs reduced MCF-7 cell viability to 50%¹⁴.

In the current work, the cytotoxicity impact of CS-ZnO-Ber NPs on MCF-7 cells was assessed using the MTT assay. This colorimetric assay quantifies the production of the water-insoluble purple formazan product, formed through reducing the yellow compound MTT by mitochondrial succinic dehydrogenase within viable cells. The cytotoxicity results revealed that these NPs can decrease the number of viable cells in a concentration-dependent manner. The calculation of the IC₅₀ value indicated that a concentration of 7.41 µg/mL after 24 h led to the death of 50% of the cells. Furthermore, the microscopic images of the MCF-7 cells after treatment with NPs showed significant alterations in both cell morphology and quantity. Before exposure to NPs, the MCF-7 cells displayed their typical dome structures. However, following treatment with NPs, the cells exhibited noticeable changes in shape and number. They appeared to take on a more rounded form, and the density of cells decreased as the concentration of NPs increased. These observed changes in cell morphology and quantity provide additional evidence of the cytotoxic effects of the NPs on the MCF-7 cells.

The small size of NPs enables them to penetrate cells and engage with biomolecules. Kalındemirtaş et al.‘s study underscores the potential of NPs to enhance the anticancer efficacy of free compounds¹⁵. They observed that free Fluorouracil (5FU) at a concentration of 39.39 µg/mL induced 50% cell death in MCF-7 cells. However, encapsulating 5FU within albumin nanoparticles significantly boosted its anticancer activity, reducing the IC₅₀value to 2.5 µg/mL. This demonstrates the efficacy of nanoparticle-based delivery systems in improving drug potency. Moreover, they have the potential to clump together within the cytoplasm, leading to the destruction of cell organelles and DNA^16,17. The low IC₅₀value of the synthesized NPs may be attributed to the combination of berberine with ZnO NPs, which has enhanced the anti-proliferative activity of ZnO NPs. Production of ROS is one of the primary mechanisms by which metal NPs, including ZnO NPs, destroy cancer cells. In the present work, NP-treated cells displayed markedly elevated ROS levels compared to the control cells. Therefore, the production of ROS is one of the anticancer mechanisms of the synthesized NPs, which subsequently activates apoptotic pathways. Moreover, Zn ions released from ZnO NPs are capable of disrupting mitochondrial membranes and releasing cytochrome C, subsequently activating apoptosis pathways³. Furthermore, earlier research has demonstrated that berberine inhibits the proliferation and metastasis of MCF-7 cells by blocking the EGFR/MEK/ERK signaling pathway and targeting ephrin-B2^18,19.

Controlling cell cycle progression is considered an efficient approach for managing tumor growth. According to the results, the sub-G1 population indicative of apoptotic cells, increased following a 24 h exposure of cells to NPs. The reduction in the cell population in the S and M phases also indicates the inhibitory potential of NPs on DNA replication and nuclear divisions. Overall, our results suggest that treating MCF-7 cells with NPs has an inhibitory effect on cell cycle progression, inducing apoptosis in the sub-G1 phase. A similar result to our study was observed when MCF-7 cells were treated with ZnO NPs²⁰. Furthermore, the encapsulation of berberine in this work has enhanced the anticancer potential of ZnO NPs. Berberine has been shown to prevent the growth of cancer cells by disrupting cell cycle progression, interfering with DNA replication, and upregulating p21²¹.

Apoptosis, a process of programmed cell death, is crucial for the homeostasis of multicellular organisms²². In the current work, the impact of NPs on apoptosis in MCF-7 cells was assessed using flow cytometry analysis. Our findings revealed a dramatic reduction in the percentage of viable cells in the NP-treated group compared to the untreated group. Additionally, the treated group exhibited an increase in the percentage of early apoptotic cells and late apoptotic cells. Interestingly, the percentage of necrotic cells remained unchanged in both groups. In addition to the various mechanisms by which ZnO NPs induce apoptosis, many studies have reported increased levels of ROS and the induction of apoptosis in various cancer cells following exposure to berberine^18,23–25. These findings strongly indicate that treatment with CS-ZnO-Ber NPs induces apoptosis in MCF-7 cells.

Apoptosis is marked by specific morphological changes, such as cell shrinkage, chromatin condensation, and DNA fragmentation. In addition to flow cytometry, we investigated apoptosis using AO/PI and Hoechst staining. AO/PI staining revealed a notable rise in apoptotic cells following nanoparticle treatment compared to the untreated group. Furthermore, chromatin condensation and membrane blebbing were observed in the NP-treated cells. Hoechst staining also distinguished apoptotic cells by their intense blue color and fragmented nuclei in the NP-treated group relative to the control. Consistent with our findings, Kavithaa et al., using DAPI and Acridine Orange Ethidium bromide staining (AO/EtBr) staining, demonstrated that treatment of MCF-7 cells with ZnO NPs causes cell shrinkage, chromatin condensation, and nuclear alterations, which are characteristic of apoptosis²⁶. The increase in the percentage of early and late apoptotic cells observed in the Annexin V-FITC assay is consistent with the morphological changes observed in AO/PI and Hoechst staining, suggesting that synthesized NPs induce apoptosis in MCF-7 cells.

The disruption of apoptosis regulation is associated with the onset of various cancers. Therefore, triggering apoptosis in cancer cells is crucial in the fight against cancer. Caspase-8 and caspase-9 are essential components of the apoptotic pathway, acting as initiators of the extrinsic and mitochondrial apoptotic pathways, respectively²⁷. In the current study, the activity of caspase-8 and caspase-9 in MCF-7 cells significantly increased after exposure to the synthesized NPs. Caspase-8 is primarily involved in the extrinsic apoptotic pathway, which is activated by the interaction of death ligands such as the Fas ligand or TNF-alpha. Given that previous studies have established a relationship between increased ROS levels and enhanced caspase-8 activity, the ROS produced by nanoparticles may have led to an increase in caspase-8 activity. On the other hand, caspase-9 serves as a key initiator caspase in the intrinsic apoptotic pathway, activated in response to intracellular stress signals such as DNA damage or cellular stress. The release of cytochrome c from the mitochondria into the cytoplasm triggers the formation of the apoptosome, leading to the activation of caspase-9. This activation, in turn, activates downstream effector caspases, initiating the apoptotic cascade²⁸. In the present work, the increased ROS levels in NP-treated cells could result in mitochondrial membrane depolarization, leading to the release of cytochrome C and apoptosis-inducing factor (AIF), which subsequently activate caspase-9. Furthermore, the oxidative stress induced by ROS activates apoptosis signal-regulating kinase 1 (ASK1), which subsequently activates caspases-9 and 3. In this study, enhanced caspase activity in NP-treated cells resulted in significant cellular damage. The observed DNA fragmentation and membrane blebbing, as revealed by Hoechst and AO/PI staining, further corroborate this mechanism. Similarly, berberine has been shown to enhance the activity of caspases-8 and 9 in breast cancer cells^29–31. Additionally, previous works showed that ZnO NPs elevated the activity of caspases 8³² and 9³³ in MCF-7 cells. This finding supports the potential of the synthesized NPs to induce apoptosis.

In the present work, the mRNA expression levels of apoptosis-related genes (Bax and Bcl-2) in MCF-7 cells after treatment with CS-ZnO-Ber NPs were evaluated using qPCR. Bcl-2 is frequently expressed in cancer cells and is known to confer resistance to common treatment methods. Studies have shown that Bcl-2 is an anti-apoptotic gene that inhibits cell death, and suppressing Bcl-2 expression enhances the effectiveness of drug treatments by promoting apoptosis. Contrary, Bax is a pro-apoptotic gene that promotes cell death. The balance between Bax and Bcl-2expression is critical for maintaining cellular homeostasis and preventing the development of cancer³⁴. The results of the current work showed that the fabricated NPs considerably increased Bax gene expression, while the expression of the Bcl-2 gene was reduced. These findings suggest that the NPs may induce apoptosis in MCF-7 cells by regulating the expression of Bax and Bcl-2 genes. Bax regulates the integrity of the mitochondrial membrane potential, leading to the release of cytochrome C. The release of cytochrome C triggers the initiation of the caspase cascade, ultimately leading to apoptosis. Hence, CS-ZnO-Ber NPs upregulated Bax levels in MCF-7 cells, enhancing mitochondrial outer membrane permeability, which triggered cytochrome C release and subsequent caspase-9 activation. In agreement with our study, Boroumand Moghaddam et al. reported that ZnO NPs increased Bax/Bcl-2ratio in MCF-7 cells¹³. The upregulation of the Bax gene in this study, along with the increased activity of caspases 8 and 9, strengthens the pro-apoptotic potential of the synthesized NPs.

Considering the critical role of cell migration in cancer metastasis, a scratch assay was performed to assess the effect of CS-ZnO-Ber NPs on the progression of MCF-7 cells. The findings of the cell migration assay validated that the closure of the scratch was markedly inhibited by the NPs. In line with our findings, Ma et al. reported that berberine inhibited metastasis in breast cancer cells by targeting MMP-2 and MMP-9¹⁹. Furthermore, Mongy and Shalaby, using a scratch assay, revealed that exposure of MDA-MB-231 cells, a breast cancer cell line, to ZnO NPs leads to a considerable decrease in wound closure rates²⁰. This finding indicates that the CS-ZnO-Ber NPs possess significant anti-migration properties.

Our study demonstrated that CS-ZnO-Ber NPs possess anti-proliferative properties by elevating ROS levels, increasing the Bax/Bcl-2 ratio, enhancing caspase activity, arresting the cell cycle, inhibiting cell migration, and inducing apoptosis via both mitochondrial and extrinsic pathways in MCF-7 cancer cells. Figure 13 provides a schematic representation of the potential cytotoxic mechanisms of CS-ZnO-Ber NPs observed in the current work.

Fig. 13.

Schematic illustration of the potential cytotoxic mechanisms of CS-ZnO-Ber NPs.

Conclusion

In this study, CS-ZnO-Ber NPs efficiently inhibited MCF-7 cell proliferation and triggered apoptosis by activating caspases and increasing the Bax/Bcl-2 expression ratio. Overall, the cytotoxic effects of CS-ZnO-Ber NPs on MCF-7 cells, mediated by the stimulation of apoptotic pathways, were confirmed in this research. Our findings suggest that CS-ZnO-Ber NPs could be a promising approach for developing new treatments for MCF-7 cancer. Nevertheless, the anti-cancer potential of CS-ZnO-Ber NPs requires further validation through in vivo animal studies.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

Fatemeh Esnaashari: Investigation, Methodology, Formal analysis, Contribute to manuscript drafting; Hojjatolah Zamani: Conceptualization, Data Curation, Supervision, Project administration, Review and revision of manuscript; Hossein Zahmatkesh: Methodology, Analysis and data interpretation, Writing the original manuscript, Supervision, Project administration; Mojtaba Soleimani: Investigation, Visualization. Golnesa Amirian Dashtaki: Methodology, Visualization; Behnam Rasti: Conceptualization, Resources, Validation, Software, Review and revision of manuscript. The authors read and approved the final manuscript.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The majority of data used to support the findings of this study are included in the manuscript. Additional data are available from the corresponding authors upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

This manuscript does not contain any studies with human participants or animals performed by any of the authors.