Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2025 Jan 27;72(1):e13072. doi: 10.1111/jeu.13072

Characterization of Allobodo yubaba sp. nov. and Novijibodo darinka gen. et sp. nov., cultivable free‐living species of the phylogenetically enigmatic kinetoplastid taxon Allobodonidae

Julia A Packer 1, Daryna Zavadska 2, Elizabeth J Weston 1, Yana Eglit 1,3, Daniel J Richter 2, Alastair G B Simpson 1,✉
PMCID: PMC11771631  PMID: 39868642

Abstract

Kinetoplastids are a large and diverse protist group, spanning ecologically important free‐living forms to medically important parasites. The taxon Allobodonidae holds an unresolved position within kinetoplastids, and the sole described species, Allobodo chlorophagus, is uncultivated, being a necrotroph/parasite of macroalgae. Here we describe Allobodo yubaba sp. nov. and Novijibodo darinka gen. nov. et sp. nov., both free‐living bacterivores isolated into monoeukaryotic cultures. Electron microscopy shows that both A. yubaba and N. darinka have a microtubular prism in the feeding apparatus (absent in A. chlorophagus), and an ovoid eukinetoplast, rather than pan‐kDNA as in A. chlorophagus. Phylogenetic analyses of SSU rDNA sequences robustly place A. yubaba as the sister to A. chlorophagus, while N. darinka branches separately within Allobodonidae, as a sister group of undescribed freshwater isolates. We view Allobodonidae as containing at least four genus‐level clades: Allobodo (A. chlorophagus and A. yubaba n. sp.), an undescribed fresh‐water clade, an undescribed marine clade, and now Novijibodo—with N. darinka as its sole known member. Electron microscopy also revealed a rod‐shaped gram‐negative bacterial cytoplasmic endosymbiont in our N. darinka isolate. The availability of these species in monoeukaryotic culture should facilitate future research, including resolving the position of Allobodonidae using phylogenomic approaches.

Keywords: alkaliphile, bacterivore, electron microscopy, evolution, free‐living, kinetoplastid, phylogenetics, protist

INTRODUCTION

Kinetoplastids are one of the major clades that comprise the Euglenozoa, along with euglenids, diplonemids, and symbiontids (Cavalier‐Smith, 1981; Gibson, 2017; Kostygov et al., 2021; Moreira et al., 2004; Simpson, 1997). Kinetoplastids are unicellular heterotrophs that typically have one or two flagella arising from a flagellar pocket (Gibson, 2017; Moreira et al., 2004; Tikhonenkov et al., 2021). They may be free‐living, commensal, symbiotic, or parasitic and have been found in a variety of habitats, including freshwater, soil, marine, hypersaline, and alkaline (Gibson, 2017; Gigeroff et al., 2023; Hausmann et al., 2003). Kinetoplastids include a wide diversity of parasites, most famously the uniflagellated trypanosomatids (Hausmann et al., 2003; Lukeš et al., 2014). Examples include Trypanosoma cruzi, Leishmania tropica, and Trypanosoma brucei, which cause Chagas' disease, leishmaniases, and sleeping sickness and nagana, respectively; diseases that, historically, have killed hundreds of thousands of people and livestock per year (Gibson, 2017; Kostygov et al., 2021; Simpson et al., 2006; Stuart et al., 2008). Free‐living kinetoplastids are phagotrophic biflagellates that prey on various microorganisms, especially bacteria (Etheridge, 2022; Gibson, 2017) and may be present at high relative abundance in aquatic ecosystems (Boenigk & Arndt, 2002; Deeg et al., 2018; Gibson, 2017). Some kinetoplastids have lifestyles that are harder to classify, such as Allobodo chlorophagus, which consumes cellular contents of the macroalga Codium fragile; since this behavior was observed in a laboratory environment on moribund algal material, A. chlorophagus could be a necrotroph rather than a parasite (Goodwin et al., 2018).

Kinetoplastids share the characteristic “kinetoplast,” from which they get their name (Borst & Hoeijmakers, 1979; Gibson, 2017; Simpson et al., 2002). The kinetoplast is a unique form of mitochondrial DNA (kDNA) that is usually comprised of maxicircles and minicircles and forms a large mass or masses that can help identify kinetoplastids under electron microscopy (Gibson, 2017; Shapiro & Englund, 1995; Shlomai, 2004). Many of the pre‐mRNAs of genes encoded on maxicircles undergo extensive editing to become functional mRNA through uridine insertions and deletions mediated by guide RNAs encoded mostly on minicircles (Aphasizheva et al., 2020; Campbell et al., 2000; Thomas et al., 2005). Another characteristic feature is their glycosome, a modified peroxisome that houses most enzymes of the glycolytic pathway and which only appears in kinetoplastids and their sister group, the diplonemids (Gibson, 2017; Gualdrón‐López et al., 2012; Hannaert et al., 2003). Features that most kinetoplastids share with most or all other Euglenozoa include paraxonemal rods inside the flagella, and an oral apparatus that is partly supported by the “MTR,” a characteristic arrangement of reinforced microtubules derived from the “R2” microtubular root (Brugerolle et al., 1979; Gadelha et al., 2006; Simpson, 1997; Tashyreva et al., 2022; Triemer & Farmer, 1991; Yubuki et al., 2013).

There are five main groups of kinetoplastids currently recognized: prokinetoplastids (Prokinetoplastina), neobodonids (Neobodonida), parabadonids (Parabadonida), eubodonids (Eubodonida), and trypanosomatids (Trypanosomatida), with the latter four grouped together as Metakinetoplastina (Kostygov et al., 2021). Trypanosomatids are exclusively parasitic (De Castro Neto et al., 2022; Etheridge, 2022; Gibson, 2017; Kaufer et al., 2017), while their sister group, eubodonids, currently contains one free‐living genus, Bodo, and Parabodonida contains a modest range of free‐living and parasitic taxa (Dolezel et al., 2000; Gibson, 2017; Moreira et al., 2004). Neobodonids, which are mostly free‐living, are the most phylogenetically diverse group. This assemblage is divided into several subgroups, with allobodonids (Allobodonidae) generally being considered one of them (Goodwin et al., 2018; von der Heyden & Cavalier‐Smith, 2005). However, the true phylogenetic placement of Allobodonidae is currently unclear (Goodwin et al., 2018).

Allobodonidae is the recently introduced formal name for “1E,” a clade of kinetoplastid isolates/sequences identified in SSU rDNA phylogenies (Goodwin et al., 2018; von der Heyden & Cavalier‐Smith, 2005). Only one species has been formally described, Allobodo chlorophagus, which consumes the chloroplasts of the green macroalga Codium fragile (Goodwin et al., 2018). Additional “marine” and “freshwater” subgroups have been identified, however, the isolates belonging to these clades have not been formally described; they are only known from their SSU rDNA sequences and some limited light microscopy data (von der Heyden & Cavalier‐Smith, 2005). Allobodonidae has an uncertain placement within kinetoplastids. SSU rDNA phylogenies indicate that they are either the sister group to (other) neobodonids, or that they are the sister to other metakinetoplastids (i.e. trypanosomatids + eubodonids + parabodonids) and thus might represent their own, sixth, major group (Goodwin et al., 2018). The uncertainty is due to the unreliability of the rooting of Metakinetoplastina with SSU rDNA sequences, with a very long branch separating metakinetoplastids from prokinetoplastids, or any other outgroups (Goodwin et al., 2018).

As part of efforts to cultivate and characterize new taxa from underrepresented sections of the kinetoplastid tree, we describe two isolates of allobodonids that thrive in monoeukaryotic cultures on bacterial prey. The first isolate, “BEAP0186,” is marine, while the second, “GEM‐kin,” is alkaliphilic (Gigeroff et al., 2023). On the basis of light microscopy, electron microscopy and SSU rDNA phylogenies, we propose that BEAP0186 represents a novel species of Allobodo, while GEM‐kin represents a novel genus and species. Unexpectedly, GEM‐kin proved to harbor a bacterial endosymbiont, an unusual feature among free‐living kinetoplastids.

MATERIALS AND METHODS

Isolation and cultivation

BEAP0186 was originally isolated from subsurface water samples from the Mediterranean Sea, in the vicinity of Blanes Bay in Spain, 41°40′N/2°40′E, at roughly noon on September 13, 2022. Environmental samples were enriched with RS medium (https://mediadive.dsmz.de/medium/P4, https://mediadive.dsmz.de/medium/P5), with the final ratio of nutrient component to nonnutrient component being 1:20 (“RS 1:20”), and salinity being 36 parts per thousand (ppt). Both the initial enrichment culture and resulting stable multi‐eukaryotic (here referred to as “mixed”) cultures were originally obtained and kept in RS 1:20 at 23°C with no access to light. Monoclonal cultures of a kinetoplastid were retrieved from the mixed culture by dilution to extinction (three sequential rounds of dilution). The monoclonal strain containing BEAP0186 is deposited in the Roscoff Culture Collection under ID RCC11336. The monoclonal isolate of BEAP0186 was maintained in a 23°C dark incubator, in RS 1:20, in 50 ml cell culture flasks (Corning, 003289); for maintenance, 3 ml of culture were passed into ~17 ml of fresh medium every 2–4 weeks. BEAP0186 grew at both 18 and 23°C in RS media with various ratios of the nutrient component to nonnutrient component (1:10, 1:50, 1:100) as well as in 15 ml autoclaved seawater with an autoclave‐sterilized wheat grain.

GEM‐kin was originally isolated from a dieukaryotic culture with its predator, the alveolate Neocolponema saponarium, from material sampled at Goodenough Lake, an alkaline lake in western Canada (Gigeroff et al., 2023). Initial isolation was made by picking several kinetoplastid cells together using a fine glass pipette. GEM‐kin was grown in 15 ml of “CR” media (Gigeroff et al., 2023) with an autoclave‐sterilized wheat grain, in 50 ml culture flasks (Falcon™, 353014) at various salinities: namely CR10, CR20, and CR50 (with the number representing salinity in ppt). A preliminary experiment established that relatively high growth was possible on CR10 media (Figure S1), with many but not all subsequent preparations made using CR10 cultures (see below). GEM‐kin was also temporarily maintained in freshwater, marine, alkaline, and halo‐alkaline (CR100) media. Cultures were maintained by weekly transfer (1 ml inoculum) and grown in a 21°C dark incubator.

Light microscopy

Images of BEAP0186 were collected on a Differential Interference Contrast (DIC) microscope with a 63× oil immersion objective (NA = 1.4). Images of GEM‐kin (grown on CR10 media) were collected on a DIC microscope with a 100X oil immersion objective (NA = 1.4), with or without an additional 1.6× optovar lens. Using Fiji (Schindelin et al., 2012) or AxioVision (Zeiss) image analysis software, respectively, 40 (BEAP0186) or 30 (GEM‐kin) cells were measured for length, width, and both anterior and posterior flagellum length. For flagellum length measurements, only cells where the flagellar tips were distinguishable were used.

Scanning electron microscopy

BEAP0186 cells were fixed using 2 ml of a 2.5% v/v glutaraldehyde solution, diluted from a 25% stock by PBS buffer. The cells were incubated for 1 h at 4°C, then filtered using a 0.8 𝜇m filter for 1.5 h. The filters were dehydrated using a series of ethanol washes (10%, 20%, 30%, 50%, 70%, 80%, 90%, and 96%) with the first rinse lasting 10 min, and each progressive rinse an extra 5 min (i.e. the 96% wash lasted 45 min), then incubated overnight in 96% ethanol. The filters were then critical‐point dried in liquid CO2, then mounted onto SEM stubs and sputter‐coated with 5 nm iridium. Cells were imaged on a Hitachi SU8600 SEM at 5 kV.

GEM‐kin cells grown in CR10 media were fixed using a 1% w/v osmium tetroxide (OsO4) solution diluted from a 4% stock by CR10 media. Glass coverslips coated in poly‐L‐lysine were immersed in culture fluid containing GEM‐kin cells and left for 30 min to allow cells to settle and adhere. The fix was then applied to the coverslips for 5 min, then the coverslips were immersed in RO water overnight at 4°C. The coverslips were then dehydrated using a series of ethanol washes (30%, 50%, 70%, 80%, 90%, 95%, and 100%) with each rinse sitting for 5 min. Coverslips were then placed into 100% ethanol for 15 min before being critical‐point dried in liquid CO2 and then mounted onto SEM stubs and sputter‐coated with 10 nm gold–palladium. Cells were imaged on a Hitachi S‐4700 SEM at 3 kV.

Transmission electron microscopy

The TEM of BEAP0186 was carried out using cells grown in sea water plus grain media (see above). The cells were concentrated by centrifugation, then fixed in 5% v/v glutaraldehyde for 45 min, rinsed, and then postfixed in 1% w/v OsO4 for 45 min; fixatives were diluted from 25% and 4% aqueous stocks, respectively, by 3× PHEM buffer (Montanaro et al., 2016). The TEM of GEM‐kin was carried out using the original dieukaryotic culture containing both GEM‐kin and Neocolponema saponarium (see above), grown in CR10 media and concentrated by centrifugation. The fix was a “simultaneous” fixation with final concentrations of 3% v/v glutaraldehyde and 1% w/v OsO4, diluted from 25% and 4% aqueous stocks, respectively, by CR10 media. The OsO4 and glutaraldehyde components were combined the instant before fixation and the cells were then immersed in the fix and left on ice for 30 min.

For both cultures, the fixed material was then re‐concentrated by centrifugation, the fixative was removed and the cells were washed in RO water. After centrifugation, excess supernatant was removed and cells were stored overnight at 4°C (for GEM‐kin) or dehydrated immediately (for BEAP0186). The cells were dehydrated using a series of acetone washes (33%, 50%, 75%, and 100%) and then added to an acetone/EPON812 mixture (1:1) and incubated at room temperature for 12 h to evaporate the acetone. The cells were then embedded in 100% EPON812 and cured for 24 h at 60°C. Then, 70 nm sections were cut using a Leica Ultracut UC6 ultramicrotome, mounted onto pioloform‐coated slot grids and stained using lead citrate and UranyLess (Electron Microscopy Sciences). The specimens were imaged on an FEI Tecnai 12 TEM at 120 kV.

SSU rDNA sequencing

DNA from BEAP0186 was extracted using DNeasy® PowerSoil Pro Kit (QIAGEN). The manufacturer's protocol was followed, with two modifications to increase yield: first, following the glass‐bead‐assisted lysis step, the cell lysate was passed five times through a 25 gauge needle; second, the DNA was eluted twice with a total volume of 30 μL of EcoLav water preheated to 40°C. The SSU rRNA gene sequence was amplified by PCR using Maximo Taq DNA polymerase (Niborlab, MT‐5) with universal eukaryotic primers 18S‐42F (CTCAARGAYTAAGCCATGCA) and 18S‐1510R (CCTTCYGCAGGTTCACCTAC) (López‐García et al., 2003; Vaulot et al., 2021) at an annealing temperature of 58°C. The resulting amplicons were cloned using the TOPO TA cloning kit® for sequencing (Invitrogen). Single‐colony PCR was performed on positive colonies using Maximo Taq DNA polymerase (Niborlab, MT‐5) and M13F and M13R primers at an annealing temperature of 55°C. Amplicons of size 1–2 kb were purified from the PCR mix with a Gelpure kit (NZYtech), but with the DNA eluted in 30 μL of EcoLav water preheated to 40°C. Each amplicon was Sanger‐sequenced (Eurofins Genomics, Cologne, Germany) from both ends, using M13F and M13R primers.

DNA from GEM‐kin (grown in CR10 media) was extracted using a DNeasy® Blood & Tissue kit (QIAGEN), but with the DNA eluted twice with 30 μL of RO water each time after being incubated at 30°C. The SSU rRNA gene sequence was PCR‐amplified using FrogTaq (FroggaBio) with primers Kineto14F (CTGCCAGTAGTCATATGCTTGTTTCAAGGA) (von der Heyden & Cavalier‐Smith, 2005) and EukB (TGATCCTTCTGCAGGTTCACCTAC) (Medlin et al., 1988) at an annealing temperature of 58°C. The resulting PCR product was Sanger‐sequenced (Génome Québec; Montréal, Canada). A full‐length sequence was assembled using Geneious Prime 2022.1.1.

Phylogenetic analysis

The sequences from BEAP0186, GEM‐kin, an undescribed allobodonid (GenBank accession number MT355140), two metakinetoplastid environmental sequences (GenBank numbers EF100234 and EF100238) and the recently described neobodonid Avlakibodo gracilis (Belyaev et al., 2022) were added to a master alignment containing 163 other metakinetoplastid sequences from Goodwin et al. (2018), resulting in an alignment of 169 sequences > 1500 bp. The six new sequences were aligned profile‐to‐profile using MUSCLE (Edgar, 2004) in SeaView v4 (Gouy et al., 2010), followed by visual editing. Gblocks (Castresana, 2000) followed by visual editing was used to select 1715 well‐aligned sites for analysis. The maximum likelihood tree was inferred in RAxML‐NG v1.2.1 (Kozlov et al., 2019) using a GTR + Γ model with 50 starting trees and 500 real bootstrap replicates. Under the same model, a Bayesian analysis was completed using MrBayes v. 3.2.7 (Ronquist et al., 2012) with two independent runs of four chains with temperature parameter = 0.2. The analysis ran until a threshold of 0.01 average standard deviation of split frequencies between runs was met (with 25% burn‐in); the runs converged after 1.52 × 106 generations. The resulting trees were visualized in iTOL v6.8.2 (Letunic & Bork, 2021).

To search for additional environmental sequences related to the two species described here, using an approach analogous to that described in Flegontova et al. (2018), the GenBank nt database was iteratively searched for sequences related to Metakinetoplastina with the eukref_gbretrieve.py (https://github.com/eukref/pipeline/blob/master/eukref_gbretrieve.py) Python‐2 script from the EukRef pipeline (Del Campo et al., 2018). Sequences from the alignment from Goodwin et al. (2018), combined with sequences from BEAP0186 and GEM‐kin, and EF100234 were used as input, initially clustered and sorted by usearch according to the EukRef pipeline description, step 2b (https://pr2‐database.org/eukref/pipeline_overview/). The “‐‐idnt” (the % identity cutoff) argument was set to 80% and the name of the most inclusive group for the search according to the PR2 taxonomy was “Kinetoplastida.” The rest of the arguments were kept as the defaults as in step 6a of the EukRef pipeline description (https://pr2‐database.org/eukref/pipeline_overview/). The output file “current_DB_final.fas” from the eukref_gbretrieve.py, containing both the set of sequences used as an input for iterative search and sequences recovered as a result of the search, was aligned with MAFFT version 7.453 (Katoh et al., 2002) using default parameters. FastTree version 2.1.11 (Price et al., 2010) with default settings was used to identify sequences retrieved from the iterative search that clustered with allobodonids. Three new 584 bp sequences, annotated in GenBank as “Uncultured eukaryote clone 18S ribosomal RNA gene, partial sequence” were recovered within the clade that included BEAP0186 and Allobodo chlorophagus: JF774895, JF774901, and JF774896.

A secondary alignment containing these three partial 18S sequences were added to the 169‐species master alignment (described above). The additional sequences were aligned profile‐to‐profile using MUSCLE alignment (Edgar, 2004) followed by visual editing. Gblocks (Castresana, 2000) followed by visual editing were used to select 1710 well‐aligned sites for analysis. Maximum likelihood and Bayesian analyses were run as described above, with the latter converging after 8.2 × 105 generations. The resulting trees were visualized in iTOL.

RESULTS

Morphology of Allobodo yubaba n. sp.

Allobodo yubaba n. sp. isolate BEAP0186 is very narrowly ovoid in shape (Figure 1A–E), with a short rostrum making up the portion of the cell anterior to the opening of the flagellar pocket (Figure 1A–C,H,I). The feeding apparatus (cytopharynx) is a hollow structure with a broad opening (cytostome) just below the apex of the rostrum; this cytostome has a distinctive exterior rim (Figure 1A) most clearly visible by SEM (Figure 1F,H). Cells have an average body length of 8.3 μm (n = 40, SD = ± 1.0) and a width of 2.8 μm (n = 40, SD = ± 0.6). The anterior flagellum has a mean length of 9.0 μm (n = 36, SD = ± 1.1) and the longer posterior has a mean length of 20.9 μm (n = 34, SD = ± 3.7) (Table S1). Vacuoles and other internal cellular structures are visible by light microscopy (Figure 1E). The flagella emerge from the subapical flagellar pocket (Figure 1H,I). SEM and light microscopy images show clearly that the posterior flagellum of A. yubaba is “acronematic” with a narrowed tip (Figure 1C,F,I). The flagella appear to lack mastigonemes or fine hairs.

FIGURE 1.

FIGURE 1

Open in a new tab

Morphology of Allobodo yubaba n. sp. (A–E) Light microscopy images of live cells of BEAP0186 under 63× initial optical magnification: (A) cell with visible cytostome (C), posterior flagellum (PF), and anterior flagellum (AF). (B) Cell with cytostome (C) below rostrum apex, (C) cell with posterior flagellum's acronematic tip (AC), and both flagella arising from the flagellar pocket (FP), (D) cell showing anterior (AF) and posterior flagellum (PF), (E) whole cell with visible vacuoles (V) and nucleus (N). Scale bars = 10 μm for all images. (F–H) Scanning electron microscopy (SEM) images of BEAP0186: (F) dorsal view of cell body, (G) total lengths of the anterior (AF) and posterior (PF) flagella, (H) ventral view of cell showing the positions of the flagellar pocket (FP) and cytostome (C). (I) Ventral view of cell with both flagella arising from the flagellar pocket (FP). Scale bars = 2 μm for all images.

Transmission electron microscopy data obtained from A. yubaba was limited by fixation quality but confirmed the presence of a kinetoplast as a singular fibrous mass in the mitochondrion (Figure 2A,B,D) located adjacent to the bases of the basal bodies (Figure 2D), consistent with an “eukinetoplast.” The presence of an eukineplast was also confirmed by light microscopy of fixed cells stained with DNA‐binding dyes (Figure S2). A microtubular prism that extends to the opening of the feeding apparatus, and a “MTR” microtubular array that extends into the apex of the cell ahead of the feeding apparatus, support the cytopharynx and cytosome (Figure 2C), with the prism running alongside the mitochondrion for at least 1 μm (Figure 2B,C). The arrangement and position of the kinetoplast and microtubular prism are similar to those observed in Novijibodo darinka (see below). No bacterial symbionts were observed.

FIGURE 2.

FIGURE 2

Open in a new tab

Ultra‐thin section transmission electron micrographs of Allobodo yubaba n. sp. isolate BEAP0186. (A) Whole cell with kinetoplast (K), the nucleus (N), and longitudinal section of the microtubular prism (P). (B) Anterior end of cell showing longitudinal section of cytostome and cytopharynx (C) supported by the microtubular prism (P), with adjacent mitochondria containing kinetoplast (K). (C) Cytostomal opening, with MTR and microtubular prism (P) in oblique section. (D) Flagellar insertion point near apex of cell showing kinetoplast (K) next to basal bodies (BB). (E) Cross section of microtubular prism (P). Scale bars = 1 μm (A, B), 500 nm (C, D), and 200 nm (E).

Morphology of Novijibodo darinka n. gen n. sp.

Novijibodo darinka n. gen n. sp. isolate GEM‐kin is narrowly ovoid in shape, with a short, blunt rostrum anterior to the flagellar pocket opening (Figure 3A,B,I). The feeding apparatus is a hollow structure (cytopharynx) with a broad cytostome opening at the apex of the rostrum, and with a distinctive exterior rim visible by SEM (Figure 3J,K). The cells have an average body length of 7.9 μm (n = 30, SD = ± 1.6) and width of 3.0 μm (n = 30, SD = ±0.4). The anterior flagellum has a mean length of 6.7 μm (n = 7, SD = ± 2.8) and the longer posterior has a mean length of 12.7 μm (n = 10, SD = ± 1.8) (Table S2). The flagella emerge from the subapical flagellar pocket (Figure 2G,I). SEM images show clearly that both the anterior and posterior flagella of N. darinka are acronematic, with narrowed tips (Figure 2H,K). The longer posterior acroneme can also be seen clearly by light microscopy (Figure 2C). The flagella appear to lack mastigonemes or fine hairs. The endosymbiotic bacteria (see below) are visible in some light microscopy images (Figure 2E).

FIGURE 3.

FIGURE 3

Open in a new tab

Morphology of Novijibodo darinka n. gen n. sp. (A–F) Light microscopy images of live GEM‐kin cells under 100× and 160× initial optical magnification: (A) cell with visible flagellar pocket (FP), anterior (AF), and posterior (PF) flagella, (B) cell showing visible cytostome (C) and anterior acroneme (AC), (C) cell showing both the anterior and posterior flagella and their acronemes (AC), (D) cell with visible flagellar pocket (FP), anterior (AF), and posterior (PF) flagella, (E) cell showing nucleus (N), endosymbiotic bacteria (E), and anterior acroneme (AC). (F) Dividing cells. Scale bars = 5 μm for all images. (G–K) Scanning electron microscopy (SEM) images of GEM‐kin: (G) ventral view of cell, (H) dorsal view of cell, showing full length of anterior flagellum (AF) and posterior flagellum (PF), and their acronemes (AC), (I) subapical flagellar pocket (FP) at an angle to the cytostome (C), (J) cytostomal opening (C), (K) apical view of cell. Scale bars: 2 μm (G, H, K) or 600 nm (I, J).

Transmission electron microscopy of N. darinka GEM‐kin shows the nucleus appearing similar to that of other kinetoplastids, with densely staining material in the nucleolus and along the inside of the nuclear envelope (Figure 4A). The mitochondrion has many discoidal cristae and a kinetoplast that is fibrous (Figure 4A,E,H). The kinetoplast is one large continuous mass located near the bases of the basal bodies (i.e. an eukinetoplast; Figure 4H), as confirmed by light microscopy using DNA‐staining dyes (Figure S3). Evenly spaced microtubules run under the cell membrane of most of the cell, but are absent from the entrance of the cytostome and flagellar pocket, and the region between the two (Figure 4D). The cell also contains glycosomes and vacuoles containing strands of electron‐dense material, potentially acidocalcisomes (Figure 4A). Each cell also houses in the cytoplasm several rod‐shaped bacteria that have Gram‐negative envelopes (Figure 4A,E,G). The feeding apparatus consists of a broad “cytostome” about 300 nm wide, and an extension into the cell, the “cytopharynx,” at least 1.5 μm long (Figure 4B,C). The cytopharynx is initially a broad chamber, then rapidly narrows to a tube as it extends through the cell alongside the mitochondrion, next to the kinetoplast (Figure 4B,D,E). The cytopharynx is supported directly by the “descending” portion of the “MTR” microtubular array (Figure 4C,D,F) and more distantly by a bundle of microtubules with a triangular “prism” shape in cross‐section that originates at the material supporting the cytostome margin (Figure 4D,F). Next to the cytopharynx is a region rich in small endomembrane vesicles (Figure 4E). The basal bodies of the flagella are located at the base of the flagellar pocket (Figure 4H), with the flagellar insertion point being next to the kinetoplast (Figure 4H). Each flagellum contains a paraxonemal rod (Figure 4I,J) that begins at an electron‐dense plate at the top of the transition zone (Figure 3H). The anterior flagellum paraxonemal rod has a circular cross‐section (Figure 4I), and the posterior flagellum rod has a rectangular lattice cross‐section (Figure 4J).

FIGURE 4.

FIGURE 4

Open in a new tab

Ultra‐thin section transmission electron micrographs of Novijibodo darinka n. gen n. sp. isolate GEM‐kin. (A) Section through middle of cell with mitochondrion (M) containing kinetoplast (K), the nucleus (N), glycosomes (G), possible acidocalcisomes (#), and endosymbiotic bacteria (B). (B) Anterior end of cell showing longitudinal section of cytostome and cytopharynx (C). (C) Cytostomal opening, with MTR and microtubular prism (P) in oblique section. (D) Transverse section near apex of cell showing ascending and descending portions of the MTR (bottom‐left and centre, respectively), with the latter supporting the cytopharynx (C). Note also microtubular prism (P), discoidal cristae in adjacent profile of mitochondrion (M), and corset of microtubules under the cell membrane (asterisk). (E) Narrow portion cytopharynx (C) next to kinetoplast (K) and associated with extensive field of vesicles. (F) Transverse section of narrow portion of cytopharynx showing supporting microtubules, including microtubular prism. (G) Detail of endosymbiotic bacterium showing Gram‐negative‐type cell envelope. (H) Flagella insertion point next to kinetoplast (K). (I) Anterior flagellum with round paraxonemal rod cross‐section. (J) Posterior flagellum with latticed paraxonemal rod cross‐section. Scale bars = 500 nm (A, B, C, D, E, H) and 200 nm (G, I, J).

Phylogenetic analysis

The SSU rDNA amplicon of Allobodo yubaba BEAP0186 had a length of 2054 bp. Using a BLAST search of the NCBI database (nt), A. yubaba showed 97.3% identity to Allobodo chlorophagus (accession number MH656403.1). The SSU rDNA amplicon of Novijibodo darinka GEM‐kin was 2152 bp long, with lower identity (94.2%) to A. chlorophagus. The most similar sequence to N. darinka was an uncultured environmental sequence assigned to the “freshwater clade” (see below) of allobodonids (accession number AY490219.1; 96.13% identity). The most similar non‐allobodonid to both sequences was Bodo saltans and identity was much lower (89.2% to A. yubaba and 90.3% to N. darinka).

Phylogenetic analyses of 169 metakinetoplastid SSU rRNA gene sequences placed A. yubaba and N. darinka within Allobodonidae with strong support (Figure 5A: ML bootstrap support—BS 100%, Bayesian posterior probability—PP 1). Allobodo yubaba branched as a sister to A. chlorophagus with strong statistical support (BS 94%, PP 1). Similarly, N. darinka fell as a sister to the “freshwater clade” of undescribed allobodonids with strong support (BS 98%, PP 1). Thus, N. darinka branched closer to the freshwater clade than the marine clade, which A. chlorophagus and A. yubaba grouped with (BS 66%, PP 0.94). The freshwater clade and marine clade were moderately to strongly supported (BS 81%, PP 1 and BS 100%, PP 1 respectively). More broadly, the bipartition representing “other neobodonids” was strongly supported (BS 92%, PP 1). All “other metakinetoplastids” formed a clan with weak ML bootstrap support (BS 63%, PP 0.98), with two similar environmental sequences (Genbank numbers EF100234 and EF100238) as the deepest branch. The bipartition without these two sequences was modestly supported (BS 74%; PP 0.94).

FIGURE 5.

FIGURE 5

Open in a new tab

Phylogenetic placement of Allobodo yubaba n. sp. isolate BEAP0186 and Novijibodo darinka n. gen n. sp. GEM‐kin within allobodonids. (A) Maximum likelihood tree constructed using 169 metakinetoplastid sequences and a GTR + Γ model. Bootstrap support values > 50% and posterior probabilities > 0.5 are shown. The tree was visualized using iTOL v6.8.2 (Letunic & Bork, 2021). A list of accession numbers and details of the collapsed branches is in Table S3. Collapsed clades are shaped according to the total length of the branches of each sequence within the clade (length; range shown by the short and long edges). The number in brackets next to each collapsed branch label represents the number of sequences within the clade. (B) Subtree showing the allobodonid clade, from a maximum likelihood analysis (GTR + Γ model) of 172 metakinetoplastid sequences, including three Allobodonidae‐related environmental sequences < 600 bp long. Bootstrap support values > 50% and posterior probabilities > 0.5 are shown. Scale bars represent the expected number of substitutions per site. Genus or species names in inverted commas indicate dubious identifications from the original Genbank entries.

The subsidiary analyses containing three additional environmental sequences < 600 bp (172 sequences total) maintained maximum support for the Allobodonidae clade, while showing slightly lower support for some internal branches (Figure 5B); for example, Allobodo yubaba and A. chlorophagus branched together with slightly weaker support (BS 93%, PP 0.96), and support for the “fresh‐water clade” was reduced (BS 77%, PP 0.98). The three additional short environmental sequences branched robustly together within the “fresh‐water clade,” grouping strongly with isolates SCCAP BD56 and SCCAP BD57 (BS 94%, PP 1; Figure 5B). The three additional environmental sequences were sampled from a water cooling tower (Valster et al., unpublished; data from GenBank entries JF774895, JF774901, and JF774896), thus their placement in the “fresh‐water clade” does not broaden the known environmental range of this group.

DISCUSSION

Morphology

Measuring an average of 7.9 and 8.3 μm, respectively, Novijibodo darinka and Allobodo yubaba are similar in size compared to other typical free‐living kinetoplastids such as Bodo saltans and Neobodo designis (Hausmann et al., 2003; Moreira et al., 2004). Other cellular aspects are also consistent with many free‐living kinetoplastids, as well as with Allobodo, such as a biflagellate cell with a longer posterior flagellum, paraxonemal rods, a kinetoplast, a (near‐) apical‐opening feeding apparatus, “MTR,” and a microtubule‐supported cytopharynx (Belyaev et al., 2022; Goodwin et al., 2018; Moreira et al., 2004; Stoeck et al., 2005; Tikhonenkov et al., 2016, 2021; Triemer & Farmer, 1991). Unlike Allobodo chlorophagus, A. yubaba and N. darinka have an eukinetoplast and have a microtubular prism supporting the cytopharynx, traits which are consistent with various other free‐living kinetoplastids (Belyaev et al., 2022; Goodwin et al., 2018; Simpson et al., 2002; Tikhonenkov et al., 2016).

Previous observations of free‐living allobodonids have either regarded them as undescribed kinetoplastids or have identified them with the problematic taxon Neobodo designis, basionym Bodo designis. Neobodo is a notably highly diverse and non‐monophyletic genus (Kostygov et al., 2021), with organisms identified as Neobodo (and usually specifically as Neobodo designis) forming several distinct clades inside the group we refer to as “other Neobodonids,” and even phylogenetically outside Neobodonida in some cases (Goodwin et al., 2018; Koch & Ekelund, 2005; von der Heyden & Cavalier‐Smith, 2005). Light microscopy images of all three described allobodonids show a more slender ovoid appearance compared to the classical observations of Neobodo designis, which are much broader (Goodwin et al., 2018; von der Heyden & Cavalier‐Smith, 2005). It will be interesting to see if this slenderness is consistent across allobodonids, and may represent a guide to distinguish allobodonids from “typical” Neobodo designis (e.g. from Neobodonida clade 1C) by light microscopy.

The kinetoplast

As with all kinetoplastids, Novijibodo darinka and Allobodo yubaba, contain the characteristic kinetoplast. The kinetoplast is often in a single position near the basal bodies, either as a dense disk or a more diffuse ovoid mass with a fibrous appearance (eukinetoplast). Conversely, it can be condensed into several masses in some neobodonids and parabadonids, and most prokinetoplastids, in one of several distinct forms such as poly‐kDNA, pro‐kDNA, and pan‐kDNA (Isaksen et al., 2007; Lukeš et al., 2002; Tikhonenkov et al., 2021). Allobodo chlorophagus has been documented to have a pankinetoplast, with a network of fibrous material threading through the mitochondrial matrix (Goodwin et al., 2018). In both A. yubaba and N. darinka, the kinetoplast forms a classic loosely packed ovoid eukinetoplast. This provides further evidence that the morphology of the kinetoplast is not conserved within kinetoplastids, even among some closely related species (Kostygov et al., 2021; Lukeš et al., 2002; Simpson et al., 2002).

Microtubular prism

Unlike Allobodo chlorophagus, Allobodo yubaba and Novijibodo darinka have a microtubular prism running parallel to the length of their cytopharynx. However, the prism of A. yubaba is slightly shorter than in N. darinka. The prism is a rod of parallel microtubules with triangular or trapezoidal cross‐section and acts as structural support for the cytopharynx (Eyden, 1977; Tikhonenkov et al., 2021). It has been previously recorded in several known or presumed neobodonids and free‐living prokinetoplastids (Belyaev et al., 2022; Eyden, 1977; Tikhonenkov et al., 2016, 2021). Due to this phylogenetic distribution, it is likely that the prism is an ancestral trait for kinetoplastids, and its presence in Allobodonidae is consistent with either inferred phylogenetic position for this taxon (see below).

Taxonomic conclusions

Neobodonida is a large taxon containing many distinct subgroups, and with increases in sampling and genetic sequencing it has been determined that various subgroups within Neobodonida can be considered to form distinct families and genera (Adl et al., 2012; Goodwin et al., 2018; von der Heyden & Cavalier‐Smith, 2005). Allobodonidae is an example of one such newly described family (Goodwin et al., 2018) and until now has contained one genus, Allobodo.

In our view, it is reasonable to consider GEM‐kin as the sole known representative of a separate genus. The phylogenetic relationship between Allobodo chlorophagus and GEM‐kin, as inferred from SSU rDNA trees, appears quite distant, and their respective habitats differ considerably. If GEM‐kin were to be placed in the same genus as A. chlorophagus then it would imply that all known allobodonids belong to a single genus. We believe that it is more consistent with current systematic practice to consider GEM‐kin as a new genus as well as species and formally describe it as Novijibodo darinka (taxonomic description below).

Isolate BEAP0186 by contrast is the closest known relative to A. chlorophagus, and phylogenetically speaking, the strongest candidate to represent a second species of this genus. This would require admitting the morphological and life history differences between BEAP0186 (prism‐bearing eukinetoplastidic bacterivore) and A. chlorophagus (prism‐lacking pankinetoplastidic algal parasite/necrotroph) within one genus, given their molecular affinity and habitat similarity, with both being marine organisms. Regardless, we consider BEAP0186 to represent a species of Allobodo, and formally describe it as Allobodo yubaba (taxonomic description below).

Our phylogenetic analyses of the SSU rRNA gene divide Allobodonidae into four main clades, which could reasonably represent separate genera. The first is the previously described genus, Allobodo, containing two members, A. chlorophagus and A. yubaba. The second, we propose, is Novijibodo containing only one member, N. darinka. The third is the probable sister to Novijibodo, containing several freshwater isolates and environmental sequences. Finally, the fourth group is the sister to Allobodo, containing several marine isolates/sequences. Further isolation and characterization of these organisms are required to formally describe these “freshwater” and “marine” clades, and test further whether they can, in fact, be defined based on these habitat preferences.

Endosymbiotic bacteria of GEM‐kin

Endosymbiotic bacteria were found in abundance in the transmission electron micrographs of Novijibodo darinka isolate GEM‐kin. Unsurprisingly, this is the first record of endosymbionts in an allobodonid. Endosymbiotic bacteria are seen in some species of (probable) neobodonids (Burzell, 1975; Eyden, 1977; Nikolaev et al., 2003). Only in the eubodonid Bodo saltans have endosymbiotic bacteria inside a free‐living kinetoplastid been studied intensively (Midha et al., 2021). There could be several explanations as to why N. darinka contains endosymbiotic bacteria. Perhaps, the endosymbiont might be involved in an addictive relationship with N. darinka, in which N. darinka needs the bacterium to survive but does not directly benefit from the bacterium, as has been proposed for B. saltans (Midha et al., 2021). The relationship B. saltans has with its bacterium is considered antagonistic because instead of exporting essential nutrients to the host, the bacterium imports them, thus causing the host to put more energy into gaining nutrients (Midha et al., 2021). Alternatively, the bacteria may be directly beneficial for N. darinka. This phenomenon has been recorded in the trypanosomatids (i.e. parasitic kinetoplastids) Angomonas and Strigomonas, which host the bacterium Kinetoplastibacterium (Morales et al., 2016). Kinetoplastibacterium supplies the trypanosomatid host with essential vitamins, amino acids and heme (Alves et al., 2013; Skalický et al., 2021). Molecular investigation is underway to identify the symbiotic bacterium in N. darinka, possibly as a first step to elucidating the exact role this bacterium plays in the biology of N. darinka.

CONCLUSION AND FUTURE DIRECTIONS

Previous SSU rDNA phylogenies root the metakinetoplastid tree in a wide range of places, generally with low statistical support, likely due to very high divergence between the metakinetoplastids and any outgroups with this marker (see Goodwin et al., 2018). This marker is also a single gene. By contrast, most protein phylogenies, including phylogenomic analyses of dozens‐to‐hundreds of nucleus‐encoded proteins, root the metakinetoplastid tree between most/all included neobodonids and all other metakinetoplastids (Deschamps et al., 2011; Simpson et al., 2004; Yazaki et al., 2017). These protein phylogenies, however, have much weaker taxon sampling than SSU rDNA data sets, and, for example, do not include Allobodonidae. Our analyses agree with previous studies in grouping all “other neobodonids” as a strongly supported clan to the exclusion of Allobodonidae (Goodwin et al., 2018; von der Heyden & Cavalier‐Smith, 2005), such that Allobodonidae could fall on either of the sides of the metakinetoplastid root, if this root has been inferred accurately in protein phylogenies. Therefore, it is particularly important to include allobodonids in phylogenomic analyses in order to accurately trace the evolutionary history of kinetoplastids. The availability of Novijibodo darinka and Allobodo yubaba as monoprotistan cultures will facilitate this, through transcriptome and/or genome sequencing.

TAXONOMIC SUMMARY

Eukarya, Discoba, Kinetoplastea, Metakinetoplastina, Allobodonidae

Allobodo yubaba, Zavadska and Richter, n. sp.

Description: Free‐living narrowly ovoid bi‐flagellate kinetoplastid. Posterior flagellum ~2.5 times cell length with long acroneme. Anterior flagellum about cell length. Conspicuous cytostome just below apex of short rostrum. With an eukinetoplast. Isolated from marine environment.

Etymology: This species features a small nose‐shaped protrusion from its rostrum, and is named for Yubāba (湯婆婆), a witch who is the principal antagonist in Hayao Miyazaki's film Spirited Away and who has a prominent nose.

Type material: The name‐bearing type (an hapantotype) is an SEM stub deposited in the Marine Biological Reference Collection (CMBR) at the Institut de Ciències del Mar (ICM‐CSIC, Barcelona, Spain) under the catalog/accession number ICMCBMR000674 (Guerrero et al., 2023).

Type locality: subsurface water, Mediterranean Sea, Blanes Bay, Spain, 41°40′N/2°40′E.

Gene sequence: The SSU rRNA gene sequence of isolate BEAP0186 is deposited in Genbank as PQ358889.

Cell culture: The monoclonal strain containing Allobodo yubaba as the only eukaryote is deposited in the Roscoff Culture Collection under ID RCC11336.

Zoobank registration: Described under the Zoological Code; Zoobank registration urn:lsid:zoobank.org:act:24434EBB‐E1AD‐4D6B‐B112‐706D62F5D5B5.

Novijibodo Packer, Weston, Eglit and Simpson, n. gen.

Description: Free‐living narrowly ovoid bi‐flagellate kinetoplastids, with an eukinetoplast and microtubular prism alongside cytopharynx. Closely related to Allobodo, but forming a distinct clade in SSU rDNA phylogenies.

Etymology: Noviji‐ Slavic (e.g. Croatian) adjective meaning “newer”; ‐bodo, after Bodo, the kinetoplastid genus. Masculine.

Type species: Novijibodo darinka (see below).

Zoobank registration: Described under the Zoological Code; Zoobank registration urn:lsid:zoobank.org:act:DE9BDA69‐0E58‐476A‐BBD8‐64C1B99A8FD4.

Novijibodo darinka Packer, Weston, Eglit and Simpson, n. sp.

Description: Free‐living, narrowly ovoid, biflagellate kinetoplastids averaging 7.9 μm long. Posterior flagellum ~1.5 times cell length, anterior flagellum nearly cell length, both flagella acronematic. Conspicuous cytostome at apex of short rostrum. With an eukinetoplast. Contains cytoplasmic endosymbiotic bacteria. Bacterivorous: grows in alkaline, haloalkaline, and marine media.

Type material: The name‐bearing type (an hapantotype) is a collection of resin‐embedded cells of isolate GEM‐Kin deposited with the Institute of Parasitology, Czech Academy of Sciences, České Budějovice as ICPAS_Prot_88. This material also contains the alveolate Neocolponema saponarium, and uncharacterised prokaryotes, which do not form part of the hapantotype.

Type locality: Near‐shore sediment from Goodenough Lake, BC (51°19′38.6″N 121°38′52.5″W).

Etymology: Slavic (e.g. Croatian) name meaning “gift,” referring to the enclosed symbiotic bacteria.

Gene sequence: The SSU rRNA gene sequence of isolate GEM‐kin is deposited with Genbank as PQ373183.

Zoobank registration: Described under the Zoological Code; Zoobank registration urn:lsid:zoobank.org:act:493D08DC‐B166‐46F9‐80F5‐3E2A5DF06778.

This publication (work) has been registered with Zoobank as: urn:lsid:zoobank.org:pub:F594EE45‐69F0‐4187‐BAC3‐7C771820D4CD.

Supporting information

Figure S1.

JEU-72-e13072-s004.pdf (76.1KB, pdf)

Figure S2.

JEU-72-e13072-s006.pdf (119.5KB, pdf)

Figure S3.

JEU-72-e13072-s003.pdf (116.8KB, pdf)

Table S1.

JEU-72-e13072-s007.xlsx (10.7KB, xlsx)

Table S2.

JEU-72-e13072-s005.xlsx (13KB, xlsx)

Table S3.

JEU-72-e13072-s002.xlsx (20.7KB, xlsx)

Appendix S1.

JEU-72-e13072-s001.docx (14.7KB, docx)

ACKNOWLEDGMENTS

We thank Ping Li and Mary Ann Trevors (Dalhousie University) for assistance with transmission and scanning electron microscopy, respectively. We also thank Andra Bugler and Adriana Jenkins (Dalhousie University) for assisting with culture maintenance. This work was supported by NSERC discovery grant 298366‐2019 to AGBS, grant QC2021‐007134‐P funded by MCIN/AEI/10.13039/501100011033 and by the “European Union NextGenerationEU/PRTR” for electron microscopy, the European Research Council (ERC) under the European Union's Horizon 2020 research and innovation programme (grant agreement No. 949745), and the Departament de Recerca i Universitats de la Generalitat de Catalunya (exp. 2021 SGR 00751).

Packer, J.A. , Zavadska, D. , Weston, E.J. , Eglit, Y. , Richter, D.J. & Simpson, A.G.B. (2025) Characterization of Allobodo yubaba sp. nov. and Novijibodo darinka gen. et sp. nov., cultivable free‐living species of the phylogenetically enigmatic kinetoplastid taxon Allobodonidae. Journal of Eukaryotic Microbiology, 72, e13072. Available from: 10.1111/jeu.13072

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Adl, S.M. , Simpson, A.G.B. , Lane, C.E. , Lukeš, J. , Bass, D. , Bowser, S.S. et al. (2012) The revised classification of eukaryotes. Journal of Eukaryotic Microbiology, 59, 429–514. Available from: 10.1111/j.1550-7408.2012.00644.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alves, J.M. , Serrano, M.G. , Da Silva, F.M. , Voegtly, L.J. , Matveyev, A.V. , Teixeira, M.M. et al. (2013) Genome evolution and phylogenomic analysis of candidatus Kinetoplastibacterium, the betaproteobacterial endosymbionts of Strigomonas and Angomonas . Genome Biology and Evolution, 5(2), 338–350. Available from: 10.1093/gbe/evt012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aphasizheva, I. , Alfonzo, J. , Carnes, J. , Cestari, I. , Cruz‐Reyes, J. , Ulrich Göringer, H. et al. (2020) Lexis and grammar of mitochondrial RNA processing in trypanosomes. Trends in Parasitology, 36(4), 337–355. Available from: 10.1016/j.pt.2020.01.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Belyaev, A.O. , Zagumyonnyi, D.G. , Mylnikov, A.P. & Tikhonenkov, D.V. (2022) The morphology, ultrastructure and molecular phylogeny of a new soil‐dwelling kinetoplastid Avlakibodo gracilis gen. et sp. nov. (Neobodonida; Kinetoplastea). Protist, 173(4), 125885. Available from: 10.1016/j.protis.2022.125885 [DOI] [PubMed] [Google Scholar]
  5. Boenigk, J. & Arndt, H. (2002) Bacterivory by heterotrophic flagellates: community structure and feeding strategies. Antonie Van Leeuwenhoek, 81, 465–480. Available from: 10.1023/A:1020509305868 [DOI] [PubMed] [Google Scholar]
  6. Borst, P. & Hoeijmakers, J.H.J. (1979) Kinetoplast DNA. Plasmid, 2, 20–40. Available from: 10.1016/0147-619X(79)90003-9 [DOI] [PubMed] [Google Scholar]
  7. Brugerolle, G. , Lom, J. , Nohynkova, E. & Joyon, L. (1979) Comparaison et évolution des structures cellulaire chez plusieurs espèces de Bodonidés et Cryptobiidés appartenant aux genres Bodo, Cryptobia et Trypanoplasma (Kinetoplastida, Mastigophora). Protistologica, 15, 197–221. [Google Scholar]
  8. Burzell, L.A. (1975) Fine structure of Bodo curvifilus Griessmann (Kinetoplastida: Bodonidae). Journal of Protozoology, 22, 35–39. Available from: 10.1111/j.1550-7408.1975.tb00942.x [DOI] [PubMed] [Google Scholar]
  9. Campbell, D.A. , Sturm, N.R. & Yu, M.C. (2000) Transcription of the kinetoplastid spliced leader RNA gene. Parasitology Today, 16(2), 78–82. Available from: 10.1016/s0169-4758(99)01545-8 [DOI] [PubMed] [Google Scholar]
  10. Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution, 17(4), 540–552. Available from: 10.1093/oxfordjournals.molbev.a026334 [DOI] [PubMed] [Google Scholar]
  11. Cavalier‐Smith, T. (1981) Eukaryote kingdoms: seven or nine? Biosystems, 14(3–4), 461–481. Available from: 10.1016/0303-2647(81)90050-2 [DOI] [PubMed] [Google Scholar]
  12. De Castro Neto, A.L. , Da Silveira, J.F. & Mortara, R.A. (2022) Role of virulence factors of trypanosomatids in the insect vector and putative genetic events involved in surface protein diversity. Frontiers in Cellular and Infection Microbiology, 12, 807172. Available from: 10.3389/fcimb.2022.807172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Deeg, C.M. , Chow, C.T. & Suttle, C.A. (2018) The kinetoplastid‐infecting Bodo saltans virus (BsV), a window into the most abundant giant viruses in the sea. eLife, 7, 33014. Available from: 10.7554/elife.33014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Del Campo, J. , Kolisko, M. , Boscaro, V. , Santoferrara, L.F. , Nenarokov, S. , Massana, R. et al. (2018) EukRef: phylogenetic curation of ribosomal RNA to enhance understanding of eukaryotic diversity and distribution. PLoS Biology, 16(9), e2005849. Available from: 10.1371/journal.pbio.2005849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Deschamps, P. , Lara, E. , Marande, W. , Lopez‐Garcia, P. , Ekelund, F. & Moreira, D. (2011) Phylogenomic analysis of kinetoplastids supports that trypanosomatids arose from within bodonids. Molecular Biology and Evolution, 28(1), 53–58. Available from: 10.1093/molbev/msq289 [DOI] [PubMed] [Google Scholar]
  16. Dolezel, D. , Jirků, M. , Maslov, D.A. & Lukeš, J. (2000) Phylogeny of the bodonid flagellates (Kinetoplastida) based on small‐subunit rRNA gene sequences. International Journal of Systematic and Evolutionary Microbiology, 50(5), 1943–1951. Available from: 10.1099/00207713-50-5-1943 [DOI] [PubMed] [Google Scholar]
  17. Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32(5), 1792–1797. Available from: 10.1093/nar/gkh340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Etheridge, R.D. (2022) Protozoan phagotrophy from predators to parasites: an overview of the enigmatic cytostome‐cytopharynx complex of Trypanosoma cruzi . Journal of Eukaryotic Microbiology, 69(6), e12896. Available from: 10.1111/jeu.12896 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Eyden, B.P. (1977) Morphology and ultrastructure of Bodo designis Skuja 1948. Protistologica, 13(2), 169–179. [Google Scholar]
  20. Flegontova, O. , Flegontov, P. , Malviya, S. , Poulain, J. , De Vargas, C. , Bowler, C. et al. (2018) Neobodonids are dominant kinetoplastids in the global ocean. Environmental Microbiology, 20(2), 878–889. Available from: 10.1111/1462-2920.14034 [DOI] [PubMed] [Google Scholar]
  21. Gadelha, C. , Wickstead, B. , McKean, P.G. & Gull, K. (2006) Basal body and flagellum mutants reveal a rotational constraint of the central pair microtubules in the axonemes of trypanosomes. Journal of Cell Science, 119(12), 2405–2413. Available from: 10.1242/jcs.02969 [DOI] [PubMed] [Google Scholar]
  22. Gibson, W. (2017) Kinetoplastea. In: Archibald, J.M. , Simpson, A.G.B. & Slamovits, C.H. (Eds.) Handbook of the protists, 2nd edition. Cham: Springer International Publishing, pp. 1–50. Available from: 10.1007/978-3-319-32669-6_7-1 [DOI] [Google Scholar]
  23. Gigeroff, A.S. , Eglit, Y. & Simpson, A.G.B. (2023) Characterisation and cultivation of new lineages of colponemids, a critical assemblage for inferring alveolate evolution. Protist, 174(2), 125949. Available from: 10.1016/j.protis.2023.125949 [DOI] [PubMed] [Google Scholar]
  24. Goodwin, J.D. , Lee, T.F. , Kugrens, P. & Simpson, A.G. (2018) Allobodo chlorophagus n. gen. n. sp., a kinetoplastid that infiltrates and feeds on the invasive alga Codium fragile . Protist, 169(6), 911–925. Available from: 10.1016/j.protis.2018.07.001 [DOI] [PubMed] [Google Scholar]
  25. Gouy, M. , Guindon, S. & Gascuel, O. (2010) SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Molecular Biology and Evolution, 27(2), 221–224. Available from: 10.1093/molbev/msp259 [DOI] [PubMed] [Google Scholar]
  26. Gualdrón‐López, M. , Brennand, A. , Hannaert, V. , Quiñones, W. , Cáceres, A.J. , Bringaud, F. et al. (2012) When, how and why glycolysis became compartmentalised in the Kinetoplastea. A new look at an ancient organelle. International Journal for Parasitology, 42(1), 1–20. Available from: 10.1016/j.ijpara.2011.10.007 [DOI] [PubMed] [Google Scholar]
  27. Guerrero, E. , Abell, P. , Lombarte, A. , Villanueva, R. , Ramón, M. , Sabatés, A. et al. (2023) Marine Biological Reference Collections ICM‐CSIC. Version 1.30. Instituto de Ciencias del Mar (CSIC). Available from: 10.15470/qlqqdx [DOI]
  28. Hannaert, V. , Bringaud, F. , Opperdoes, F.R. & Michels, P.A. (2003) Evolution of energy metabolism and its compartmentation in Kinetoplastida. Kinetoplastid Biology and Disease, 2(1), 11. Available from: 10.1186/1475-9292-2-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hausmann, K. , Hülsmann, N. & Radek, R. (2003) Protistology, 3rd edition. Stuttgart, Germany: E. Schwizerbart'sche Verlagbuchhandlung. [Google Scholar]
  30. Isaksen, T. , Karlsbakk, E. & Nylund, A. (2007) Ichthyobodo hippoglossi n. sp. (Kinetoplastea: Prokinetoplastida: Ichthyobodonidae fam. nov.), an ectoparasitic flagellate infecting farmed Atlantic halibut Hippoglossus hippoglossus . Diseases of Aquatic Organisms, 73, 207–217. Available from: 10.3354/dao073207 [DOI] [PubMed] [Google Scholar]
  31. Katoh, K. , Misawa, K. , Kuma, K. & Miyata, T. (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research, 30(14), 3059–3066. Available from: 10.1093/nar/gkf436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kaufer, A. , Ellis, J. , Stark, D. & Barratt, J. (2017) The evolution of trypanosomatid taxonomy. Parasites & Vectors, 10(1), 287. Available from: 10.1186/s13071-017-2204-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Koch, T.A. & Ekelund, F. (2005) Strains of the heterotrophic flagellate Bodo designis from different environments vary considerably with respect to salinity preference and SSU rRNA gene composition. Protist, 156(1), 97–112. Available from: 10.1016/j.protis.2004.12.001 [DOI] [PubMed] [Google Scholar]
  34. Kostygov, A.Y. , Karnkowska, A. , Votýpka, J. , Tashyreva, D. , Maciszewski, K. , Yurchenko, V. et al. (2021) Euglenozoa: taxonomy, diversity and ecology, symbioses and viruses. Open Biology, 11(3), 200407. Available from: 10.1098/rsob.200407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kozlov, A.M. , Darriba, D. , Flouri, T. , Morel, B. & Stamatakis, A. (2019) RAxML‐NG: a fast, scalable and user‐friendly tool for maximum likelihood phylogenetic inference. Bioinformatics, 35, 4453–4455. Available from: 10.1093/bioinformatics/btz305 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Letunic, I. & Bork, P. (2021) Interactive tree of life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Research, 49(W1), W293–W296. Available from: 10.1093/nar/gkab301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. López‐García, P. , Philippe, H. , Gail, F. & Moreira, D. (2003) Autochthonous eukaryotic diversity in hydrothermal sediment and experimental microcolonizers at the mid‐Atlantic ridge. Proceedings of the National Academy of Sciences, 100(2), 697–702. Available from: 10.1073/pnas.0235779100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lukeš, J. , Guilbride, D.L. , VotýPka, J. , ZíKova, A. , Benne, R. & Englund, P.T. (2002) Kinetoplast DNA network: evolution of an improbable structure. Eukaryotic Cell, 1(4), 495–502. Available from: 10.1128/ec.1.4.495-502.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lukeš, J. , Skalický, T. , Týč, J. , Votýpka, J. & Yurchenko, V. (2014) Evolution of parasitism in kinetoplastid flagellates. Molecular and Biochemical Parasitology, 195(2), 115–122. Available from: 10.1016/j.molbiopara.2014.05.007 [DOI] [PubMed] [Google Scholar]
  40. Medlin, L. , Elwood, H.J. , Stickel, S. & Sogin, M.L. (1988) The characterization of enzymatically amplified eukaryotic 16S‐like rRNA‐coding regions. Gene, 71, 491–499. Available from: 10.1016/0378-1119(88)90066-2 [DOI] [PubMed] [Google Scholar]
  41. Midha, S. , Rigden, D.J. , Siozios, S. , Hurst, G.D.D. & Jackson, A.P. (2021) Bodo saltans (Kinetoplastida) is dependent on a novel Paracaedibacter‐like endosymbiont that possesses multiple putative toxin‐antitoxin systems. The ISME Journal, 15(6), 1680–1694. Available from: 10.1038/s41396-020-00879-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Montanaro, J. , Gruber, D. & Leisch, N. (2016) Improved ultrastructure of marine invertebrates using non‐toxic buffers. PeerJ, 4, e1860. Available from: 10.7717/peerj.1860 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Morales, J. , Kokkori, S. , Weidauer, D. , Chapman, J. , Goltsman, E. , Rokhsar, D. et al. (2016) Development of a toolbox to dissect host‐endosymbiont interactions and protein trafficking in the trypanosomatid Angomonas deanei . BMC Evolutionary Biology, 16(1), 247. Available from: 10.1186/s12862-016-0820-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Moreira, D. , López‐García, P. & Vickerman, K. (2004) An updated view of kinetoplastid phylogeny using environmental sequences and a closer outgroup: proposal for a new classification of the class Kinetoplastea. International Journal of Systematic and Evolutionary Microbiology, 54(5), 1861–1875. Available from: 10.1099/ijs.0.63081-0 [DOI] [PubMed] [Google Scholar]
  45. Nikolaev, S.I. , Mylnikov, A. , Berney, C. , Fahrni, J. , Petrov, N. & Pawlowski, J. (2003) The taxonomic position of Klosteria bodomorphis gen. et sp. nov. (Kinetoplastida) based on ultrastructure and SSU rRNA gene sequence analysis. Protistology, 3, 126–135. [Google Scholar]
  46. Price, M.N. , Dehal, P.S. & Arkin, A.P. (2010) FastTree 2 – approximately maximum‐likelihood trees for large alignments. PLoS One, 5(3), e9490. Available from: 10.1371/journal.pone.0009490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ronquist, F. , Teslenko, M. , Van Der Mark, P. , Ayres, D.L. , Darling, A. , Höhna, S. et al. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61(3), 539–542. Available from: 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Schindelin, J. , Arganda‐Carreras, I. , Frise, E. , Kaynig, V. , Longair, M. , Pietzsch, T. et al. (2012) Fiji: an open‐source platform for biological‐imageanalysis. Nature Methods, 9, 676–682. Available from: 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Shapiro, T.A. & Englund, P.T. (1995) The structure and replication of kinetoplast DNA. Annual Review of Microbiology, 49(1), 117–143. Available from: 10.1146/annurev.mi.49.100195.001001 [DOI] [PubMed] [Google Scholar]
  50. Shlomai, J. (2004) The structure and replication of kinetoplast DNA. Current Molecular Medicine, 4(6), 623–647. Available from: 10.2174/1566524043360096 [DOI] [PubMed] [Google Scholar]
  51. Simpson, A.G.B. (1997) The identity and composition of the Euglenozoa. Archiv für Protistenkunde, 148(3), 318–328. Available from: 10.1016/s0003-9365(97)80012-7 [DOI] [Google Scholar]
  52. Simpson, A.G.B. , Gill, E.E. , Callahan, H.A. , Litaker, R.W. & Roger, A.J. (2004) Early evolution within kinetoplastids (Euglenozoa), and the late emergence of trypanosomatids. Protist, 155(4), 407–422. Available from: 10.1078/1434461042650389 [DOI] [PubMed] [Google Scholar]
  53. Simpson, A.G.B. , Stevens, J.R. & Lukeš, J. (2006) The evolution and diversity of kinetoplastid flagellates. Trends in Parasitology, 22(4), 168–174. Available from: 10.1016/j.pt.2006.02.006 [DOI] [PubMed] [Google Scholar]
  54. Simpson, A.G.B. , Lukeš, J. & Roger, A.J. (2002) The evolutionary history of kinetoplastids and their kinetoplasts. Molecular Biology and Evolution, 19(12), 2071–2083. Available from: 10.1093/oxfordjournals.molbev.a004032 [DOI] [PubMed] [Google Scholar]
  55. Skalický, T. , Alves, J.M.P. , Morais, A.C. , Režnarová, J. , Butenko, A. , Lukeš, J. et al. (2021) Endosymbiont capture, a repeated process of endosymbiont transfer with replacement in trypanosomatids Angomonas spp. Pathogens, 10(6), 702. Available from: 10.3390/pathogens10060702 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Stoeck, T. , Schwarz, M.V.J. , Boenigk, J. , Schweikert, M. , Von Der Heyden, S. & Behnke, A. (2005) Cellular identity of an 18S rRNA gene sequence clade within the class Kinetoplastea: the novel genus Actuariola gen. nov. (Neobodonida) with description of the type species Actuariola framvarensis sp. nov. International Journal of Systematic and Evolutionary Microbiology, 55(6), 2623–2635. Available from: 10.1099/ijs.0.63769-0 [DOI] [PubMed] [Google Scholar]
  57. Stuart, K. , Brun, R. , Croft, S. , Fairlamb, A. , Gürtler, R.E. , McKerrow, J. et al. (2008) Kinetoplastids: related protozoan pathogens, different diseases. Journal of Clinical Investigation, 118(4), 1301–1310. Available from: 10.1172/jci33945 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tashyreva, D. , Simpson, A.G. , Prokopchuk, G. , Škodová‐Sveráková, I. , Butenko, A. , Hammond, M. et al. (2022) Diplonemids – a review on “new” flagellates on the oceanic block. Protist, 173(2), 125868. Available from: 10.1016/j.protis.2022.125868 [DOI] [PubMed] [Google Scholar]
  59. Thomas, S. , Westenberger, S.J. , Campbell, D.A. & Sturm, N.R. (2005) Intragenomic spliced leader RNA array analysis of kinetoplastids reveals unexpected transcribed region diversity in Trypanosoma cruzi . Gene, 352, 100–108. Available from: 10.1016/j.gene.2005.04.002 [DOI] [PubMed] [Google Scholar]
  60. Tikhonenkov, D.V. , Gawryluk, R.M.R. , Mylnikov, A.P. & Keeling, P.J. (2021) First finding of free‐living representatives of Prokinetoplastina and their nuclear and mitochondrial genomes. Scientific Reports, 11(1), 2946. Available from: 10.1038/s41598-021-82369-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Tikhonenkov, D.V. , Janouškovec, J. , Keeling, P.J. & Mylnikov, A.P. (2016) The morphology, ultrastructure and SSU rRNA gene sequence of a new freshwater flagellate, Neobodo borokensis n. sp. (Kinetoplastea, Excavata). Journal of Eukaryotic Microbiology, 63(2), 220–232. Available from: 10.1111/jeu.12271 [DOI] [PubMed] [Google Scholar]
  62. Triemer, R.E. & Farmer, M.A. (1991) An ultrastructural comparison of the mitotic apparatus, feeding apparatus, flagellar apparatus and cytoskeleton in euglenoids and kinetoplastids. Protoplasma, 164(1–3), 91–104. Available from: 10.1007/bf01320817 [DOI] [Google Scholar]
  63. Vaulot, D. , Geisen, S. , Mahé, F. & Bass, D. (2021) pr2‐primers: an 18S rRNA primer database for protists. Molecular Ecology Resources, 22(1), 168–179. Available from: 10.1111/1755-0998.13465 [DOI] [PubMed] [Google Scholar]
  64. von der Heyden, S. & Cavalier‐Smith, T. (2005) Culturing and environmental DNA sequencing uncover hidden kinetoplastid biodiversity and a major marine clade within ancestrally freshwater Neobodo designis . International Journal of Systematic and Evolutionary Microbiology, 55(6), 2605–2621. Available from: 10.1099/ijs.0.63606-0 [DOI] [PubMed] [Google Scholar]
  65. Yazaki, E. , Ishikawa, S.A. , Kume, K. , Kumagai, A. , Kamaishi, T. , Tanifuji, G. et al. (2017) Global Kinetoplastea phylogeny inferred from a large‐scale multigene alignment including parasitic species for better understanding transitions from a free‐living to a parasitic lifestyle. Genes & Genetic Systems, 92(1), 35–42. Available from: 10.1266/ggs.16-00056 [DOI] [PubMed] [Google Scholar]
  66. Yubuki, N. , Simpson, A.G.B. & Leander, B.S. (2013) Reconstruction of the feeding apparatus in Postgaardi mariagerensis provides evidence for character evolution within the Symbiontida (Euglenozoa). European Journal of Protistology, 49(1), 32–39. Available from: 10.1016/j.ejop.2012.07.001 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1.

JEU-72-e13072-s004.pdf (76.1KB, pdf)

Figure S2.

JEU-72-e13072-s006.pdf (119.5KB, pdf)

Figure S3.

JEU-72-e13072-s003.pdf (116.8KB, pdf)

Table S1.

JEU-72-e13072-s007.xlsx (10.7KB, xlsx)

Table S2.

JEU-72-e13072-s005.xlsx (13KB, xlsx)

Table S3.

JEU-72-e13072-s002.xlsx (20.7KB, xlsx)

Appendix S1.

JEU-72-e13072-s001.docx (14.7KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from The Journal of Eukaryotic Microbiology are provided here courtesy of Wiley

RESOURCES