Abstract
Exosomal long noncoding RNAs (lncRNAs), which are highly expressed in tumor-derived exosomes, regulate various cellular behaviors such as cell proliferation, metastasis, and glycolysis by facilitating intercellular communication. Here, we explored the role and regulatory mechanism of tumor-derived exosomal lncRNAs in pituitary adenomas (PA). We isolated exosomes from PA cells, and performed in vitro and in vivo assays to examine their effect on the proliferation, metastasis, and glycolysis of PA cells. In addition, we conducted RNA pull-down, RNA immunoprecipitation, co-immunoprecipitation, and ubiquitination assays to investigate the downstream mechanism of exosomal AFAP1-AS1. Exosomes from PA cells augmented the proliferation, mobility, and glycolysis of PA cells. Moreover, AFAP1-AS1 was significantly enriched in these exosomes and stimulated the growth, migration, invasion, and glycolysis of PA cells in vitro, as well as tumor metastasis in vivo. It also enhanced the binding affinity between Hu antigen R (HuR) and SMAD-specific E3 ubiquitin protein ligase 1 (SMURF1), resulting in HuR ubiquitination and degradation accompanied by enhanced expression of hexokinase 2 (HK2) and pyruvate kinase M2 (PKM2). Moreover, HuR overexpression alleviated the exosomal AFAP1-AS1-mediated promotion of growth, metastasis, and glycolysis effects. These findings indicate that tumor-derived exosomal AFAP1-AS1 modulated SMURF1-mediated HuR ubiquitination and degradation to upregulate HK2 and PKM2 expression, thereby enhancing PA cell growth, metastasis, and glucose metabolism. This suggests targeting exosomal AFAP1-AS1 may be a potential strategy for the treatment of PA.
Supplementary Information
The online version contains supplementary material available at 10.1007/s12035-024-04387-y.
Keywords: Exosomes, Pituitary adenomas, AFAP1-AS1, Growth, Metastasis, Glycolysis
Introduction
Pituitary adenomas (PA), which account for 10–15% of all cranial tumors, are the third most common intracranial tumor [1, 2]. Its incidence ranges between 80 and 100 cases per 100,000 person-years, and the occurrence of clinically relevant PA is estimated at 4.36 per 100,000 person-years, ranking second among Central Brain Tumor Registry of the United States (CBTRUS)-associated diseases [3]. While surgical resection remains the mainstay treatment for PA, research indicates that incomplete removal of tumor cells increases the risk of recurrence and distant metastasis for many patients [4]. Although recent advancements in diagnosis and therapy have significantly enhanced the 5-year overall survival rates of PA patients [5], the disease outcomes remain poor, and thus, more effective strategies should be developed. Exosomes, extracellular vesicles with lipid bilayer membrane and a diameter ranging from 30 to 150 nm, are secreted by all cell types [6]. Increasing evidence shows that exosomes sourced from cancer cells play a fundamental function in tumor cell communication by conveying oncogenic molecules, comprising circRNAs, long noncoding RNAs (lncRNAs), microRNAs (miRNAs), mRNAs, proteins, and lipids, thereby promoting tumorigenesis, tumor growth, metastasis, angiogenesis, immune escape, and drug resistance [6, 7]. LncRNAs, a class of transcripts with > 200 nucleotides long without protein-coding potential, are highly enriched in exosomes and are involved in intercellular communication [8]. Studies have shown that exosomal lncRNAs can be transferred from nearby to distant cells, where they regulate tumor development [9, 10]. However, the functions and underlying mechanisms of cancer-derived exosomal lncRNAs in PAs are not well understood.
LncRNA actin filament associated protein 1 antisense RNA 1 (AFAP1-AS1), which is located on the antisense strand of the protein-coding gene AFAP1 located at 4p16.1, is composed of 6810 nucleotides [11]. It is reportedly overexpressed in several malignant tumors, playing a critical role in cancer progression [11–13]. In triple-negative breast cancer, AFAP1-AS1 knockdown inhibited cell proliferation and colony-forming ability [13]. In our previous study, we found that upregulation of AFAP1-AS1 stimulated PA cell proliferation and cell cycle progression, thereby alleviating apoptosis [14, 15]. Furthermore, exosomal AFAP1-AS1 was also shown to affect migration and metastasis of esophageal cancer [16]. Moreover, exosomal AFAP1-AS1 promoted endometrial stromal cell proliferation, migration, and invasion [17]. To date, however, the effect of exosomal AFAP1-AS1 on pituitary tumors has not been clarified and is unknown.
In this study, we aimed to investigate the mechanism underlying the exosome-mediated release of AFAP1-AS1 by PA cell lines. Our research revealed that treating PA cells with AFAP1-AS1-knockdown exosomes reduced their proliferation, migration, invasion, and glycolysis. This effect was ascribed to the enhancement of the degradation and ubiquitination of HuR via SMAD-specific E3 ubiquitin protein ligase 1 (SMURF1). These findings offer fresh perspectives for the future development of more effective therapeutic approaches for PA treatment.
Materials and Methods
Cell Culture
Two PA cell lines, GH1 and RC-4B/C, were purchased from Jennio Biotech (Guangzhou, China). The cells were cultured in RPMI1640 medium supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin, and 10% exosome-free fetal bovine serum (FBS). The exosome-free FBS was produced by centrifugation (100,000 g) at 4 °C overnight to ensure the removal of any bovine-derived exosomes [7]. All cell cultures were incubated under the following conditions: 95% humidity, 5% CO2, and 37 °C.
Exosome Isolation
Exosomes were extracted through serial ultracentrifugation procedures. After removing cells and other debris by centrifugation at 300 g and 3000 g at 4 °C, respectively. Fifty milliliters of the supernatants of GH1 and RC-4B/C cells were centrifuged at 10,000 × g at 4 °C for 20 min to remove shedding vesicles and the other vesicles with larger sizes. The resulting supernatant was transferred to a sterile centrifuge tube and then ultracentrifuged at 110,000 × g for 70 min to concentrate exosomes, and exosomes obtained were purified through centrifugation at 110,000 × g for 1 h. The exosomes were then resuspended in phosphate-buffered saline (PBS), filtered through 0.22-mm filters (C8848, Millipore, Boston, MA), and stored at − 80 °C in PBS until further experiments. For each assay, 10 µg of exosomes resuspended in 100 µL 1 × PBS were added to 1 × 105 cells for 24 h.
Transmission Electron Microscopy (TEM)
The purified exosomes were fixed in 2% paraformaldehyde, and a drop of exosome fractions was floated on a nickel TEM grid lined with a formvar/carbon film and a mesh size of 400. The sample was stained with 2% uranyl acetate and examined on a TEM (Hitachi H7600, Japan) at 80 kV.
Nanoparticle Tracking Analysis (NTA)
The sizes and numbers of exosomes were determined on the NanoSight NS300 system (Malvern Instruments, Westborough, MA, USA). The exosomes obtained were suspended in PBS and then diluted 100–500 times to achieve a concentration of 20 to 100 objects per frame. Subsequently, they were injected into sample chambers at room temperature, which were equipped with a 488-nm laser and a high-sensitivity sCMOS camera. Each video was analyzed by examining a minimum of 200 completed tracks, and the data were processed using NTA analytical 2.3 software (Shanghai XP Biomed Ltd., Shanghai, China).
Exosome Concentration Measurement
ExoELISA Ultra CD81 assay (System Biosciences) was used to measure indirectly exosome concentration. Total protein was extracted from exosomes using the RIPA buffer with protease inhibitor (Thermo Fischer Scientific, Waltham, MA, USA) and quantified using the BCA kit. A total of 500 µg of total protein of each sample and CD81 standards was loaded onto a 96-well plate and incubated for 1 h at 37 °C. The wells were incubated with an anti-CD81 primary antibody at room temperature (RT) for 2 h and then incubated with a horseradish peroxidase-conjugated secondary antibody at RT for 1 h. Fifty microliters of tetramethylbenzidine substrate was added to each well and incubated for 10 min at RT. Stop buffer was added and absorbance was measured at 450 nm using a microplate reader (Thermo Fischer Scientific) [18].
Cell Transfection
Short hairpin RNA (shRNA) targeting AFAP1-AS1 (sh-AFAP1-AS1-1: CCGGGAGTACATCACCTCAAATTATCTCGAGATAATTTGAGGTGATGTACTC-TTTTTT; sh-AFAP1-AS1-2: CCGGAGGCAGAACTGGAGAAGAAATCTCGAGATTTCTTCTCCAGTTCTGCCTTTTTTT), and negative control (NC: CCGGTTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTT) lentivirus were purchased from Genechem (Shanghai, China) and were used to infect PA cell lines in the presence of polybrene (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 8 µg/mL. Puromycin (Thermo Fisher Scientific, Waltham, MA, USA) was included during transfections to select stable clones. Transfection efficiency was verified by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). Wild-type AFAP1-AS1 and mutant plasmids, as well as overexpressing HuR, were constructed by Genechem. Small interfering RNA SMURF1 (si-SMURF1) and si-NC were obtained from Genechem. PA cells were transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. The sequences of oligonucleotides and plasmids were listed in Supplementary Table 1 and Materials and methods.
Cell Counting Kit-8 (CCK-8) Assay
Briefly, about 3000 cells were seeded into 96-well plates and allowed to incubate overnight. They were treated with various agents as follows: control exosomes, AFAP1-AS1-knockdown exosomes, HuR plasmid, or a combination of AFAP1-AS1-knockdown exosomes and HuR plasmid, for 0, 24, 48, and 72 h. CCK-8 reagent (Dojindo, Kumamoto, Japan; 10 µL/well) was added to the cells at specified time points and incubated for 2 h, after which the absorbance was read at 450 nm using a microplate reader (Thermo Fischer Scientific).
Colony Formation Assay
Cells were seeded in 6-well plates, at a density of 1000 cells per well and incubated for 2 weeks at 37 °C. Next, the cells were fixed with 4% paraformaldehyde and subsequently stained with 0.5% crystal violet.
Wound Healing Assay
PA cells were first seeded in 6-well plates and incubated at 37 °C until they reached 100% confluency. Subsequently, a pipette tip was used to create a scratch wound, and wound closure was imaged after 48 h using a microscope equipped with a digital camera. Relative migration distance was measured using ImageJ software, by determining the fraction of cell coverage across the scratch and calculated using the following formula: (%) = migration area/total area × 100%.
Transwell Assay
Transwell assays were conducted using matrigel-coated invasion and polycarbonate membrane inserts with 8-µm pore size. Approximately 1 × 104 cells were added to the upper chamber, while 10% FBS was administered to the lower chamber. After 24 h, the chambers were fixed and stained with 0.05% crystal violet for 2 h. The cells in the upper surface were carefully scraped off, stained, and observed under a microscope equipped with a digital camera.
RNA Extraction and qRT-PCR
Total RNA was extracted from PA cell lines using the TRIzol reagent following the manufacturer’s instructions. The RNA was reverse transcribed to cDNA using the PrimeScript RT reagent Kit (Takara, China) and subjected to qRT-PCR using the SYBR-Green PCR Master Mix (Takara, China). Amplification was performed on the applied Biosystems Quant Studio system (Thermo Fisher Scientific). Expression of the target genes was analyzed using the 2−ΔΔct method and normalized to that of β-actin. Primer sequences are listed in Supplementary Table 1.
Northern Blotting
Ten micrograms of total RNA was separated by electrophoresis and then transferred to nitrocellulose filter membranes. Membranes were incubated with the hydration buffer containing biotin-labeled AFAP1-AS1 or 18S rRNA probes at 55 °C overnight. Finally, the RNA signal was detected using the Chemiluminescent Nucleic Acid Detection Module (Thermo Fisher Scientific). The sequences of biotin-labeled probes were listed in Supplementary Materials and methods.
Subcellular Fractionation
Nuclear and cytoplasmic RNA was isolated using the nuclear or cytoplasmic RNA purification kit (Thermo Fischer Scientific), following the manufacturer’s instructions. The cells were first lysed on ice for 10 min using cell fraction buffer and then centrifuged for 5 min at 500 g to separate cytoplasmic and nuclear fractions. The extracted RNA was converted to cDNA and subjected to qRT-PCR, utilizing β-actin and U6 as markers for cytoplasmic and nuclear compartments, respectively.
RNA-Fluorescence In Situ Hybridization (FISH)
This was performed using the Fluorescent In Situ Hybridization Kit (Ribo, Guangzhou, China), according to the manufacturer’s instructions. Briefly, cells were seeded onto cover slides, and AFAP1-AS1 detection was achieved using a specific probe labeled with Cy3. Detection was done on a Nikon Eclipse Ti microscope equipped with a digital camera (Nikon, Kanagawa, Japan).
Extracellular Acidification Rate (ECAR) and Mitochondrial Oxygen Consumption Rate (OCR) Assays
ECAR and OCR assays were performed using the Seahorse XF96 Extracellular Flux Analyzer (Agilent Technologies, Santa Clara, CA, USA) following the manufacturer’s instructions. Briefly, 8000 cells/well were seeded in a Seahorse XF96 culture microplate, rinsed with Seahorse buffer, and then mixed with Seahorse buffer supplemented with oligomycin (1 µM), FCCP (1 µM), or rotenone (1 µM) to measure OCR. Similarly, glucose (10 mM), oligomycin (1 µM), or 2-deoxy-glucose (2-DG, 100 mM) was added to measure the ECAR. The obtained data were analyzed using the Seahorse software. Cells were digested with trypsin and counted with a hemocytometer. ECAR and OCR were normalized to cell numbers.
Glucose Uptake
The uptakes of glucose were measured using the fluorescent 2-DG analog 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG). The cells were stained with 2-NBDG (10 µM) for 1 h, and washed twice by PBS. Luminescence intensity was read by a microplate reader (Thermo Fischer Scientific, Waltham, MA, USA). Cells were digested with trypsin and counted with a hemocytometer. Glucose uptake was normalized to cell numbers.
Lactate Assay
Lactate concentration in cell supernatants was measured using a lactate assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer’s instructions. Cells were digested with trypsin and counted with a hemocytometer. Lactate concentration was normalized to cell numbers.
Mice Xenograft Assay
Thirty male NOD-SCID mice (6 weeks) were procured from the Laboratory Animal Center of Southern Medical University (Guangzhou, China) and randomly allocated into five groups (6 mice/group) prior to inoculation. Control (cells were cultured in RPMI1640 medium containing exosome-free FBS), exosomes, sh-NC exosomes, sh-AFAP1-AS1-1 exosomes, and sh-AFAP1-AS1-2 exosome–treated GH1 luciferase cells (1 × 106) in 0.2 mL PBS were delivered into the tail veins of NOD-SCID mice. Cell metastasis was monitored weekly through bioluminescence imaging on the IVIS system (Xenogen, Alameda, CA, USA), with mice receiving 150 mg/kg d-luciferin potassium salt (Caliper Life Sciences, Hopkinton, MA). After 4 weeks, the representative bioluminescence imaging of metastases was measured, and the lung tissues were collected for hematoxylin–eosin staining (H&E staining) [7]. The protocol used in animal experimental procedures was approved by the Institutional Animal Care and Use Committee of Guangzhou First People’s Hospital, South China University of Technology (K-2021–041-01).
H&E Staining
Paraffin-embedded lung tissue sections from mice were dewaxed via heating at 65 °C for 2 h, hydrated, and then cell nuclei and cytoplasm stained with hematoxylin and eosin solution (Biosharp, Anhui, China), respectively. The slices were then dried and preserved in neutral resin (SCR, Shanghai, China).
Cycloheximide (CHX) Chase Assay
AFAP1-AS1 knockdown exosome–treated GH1 cells were treated with cycloheximide (50 mg/mL) from 0 to 12 h, proteins extracted from the cell lysates using a lysis buffer containing 2% sodium dodecyl sulfate (SDS), separated via SDS–polyacrylamide gel electrophoresis (PAGE), followed by western blot targeting the HuR antibody.
Western Blot and Coimmunoprecipitation (co-IP) Assays
Proteins were extracted from PA cell lines using the RIPA buffer with protease inhibitor (Thermo Fisher Scientific) and quantified using the BCA kit. The proteins were separated on a 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes (Millipore, USA). The membranes were hybridized overnight with primary antibodies CD9 (1:1000; Abcam, Cambridge, MA, USA), CD81 (1:1000; Proteintech, China), TSG101 (1:1000; Abcam), Alix (1:1000; Affinity, China), CDK2 (1:1000; Abcam), Cyclin D1 (1:5000; Proteintech), p21 (1:1000; Abcam), p27 (1:1000; Affinity), N-cadherin (1:5000; Abcam), Vimentin (1:1000; Abcam), MMP9 (1:1000; Abcam), E-cadherin (1:1000; Abcam), HuR (1:1000; Abcam), SMURF1 (1:1000; Proteintech), hexokinase 2 (HK2) (1:1000; Abcam), calnexin (1:1000; Abcam), and pyruvate kinase M2 (PKM2) (1:1000; Abcam) at 4 °C and then incubated with a secondary antibody at RT for 1 h. Finally, the protein blots were detected utilizing an ECL kit. For the co-immunoprecipitation (co-IP) assay, proteins were extracted using the Co-IP lysis buffer (Bersinbio, Guangzhou, China, Bes3011) with protease inhibitor (Thermo Fisher Scientific) and quantified using the BCA kit. A total of 500 µg of proteins were incubated overnight with primary antibodies against HuR (Abcam) and SMURF1 (Proteintech) at 4 °C, followed by a 4-h incubation with protein A/G beads at the same temperature. The immunoprecipitated proteins were subsequently eluted from the beads and subjected to western blot analysis using the specified antibodies.
Ubiquitination Assay
AFAP1-AS1-knockdown exosome–treated cells were treated with MG-132 (20 µM) for 8 h, proteins extracted using the Co-IP lysis buffer (Bersinbio, Bes3011), and incubated for 3 h with anti-HuR antibody at 4 °C. The proteins were incubated overnight with A/G beads (Invitrogen) at 4 °C. Precipitate protein complexes were subjected to western blot with an anti-ubiquitin antibody (Cell Signaling Technology, Beverly, MA, USA).
RNA Pulldown Assay
Cells were transfected for 24 h with biotin-labeled AFAP1-AS1 (GenePharma, Shanghai, China), lysed using lysis buffer (Bersinbio, Bes5102) containing magnetic beads, and incubated at room temperature with gentle rotation for 30 min. Next, the biotin-coupled RNA–coated beads were washed 4 times, purified, and subjected to western blot assay. The sequences of biotin-labeled AFAP1-AS1 probes were listed in Supplementary Materials and methods.
RNA-Binding Protein Immunoprecipitation (RIP) Assay
Cells were lysed with RIP lysis buffer, using magnetic beads washed with RIP wash buffer (Bersinbio, Bes5101), followed by the addition of anti-HuR (Abcam) and anti-IgG antibodies, and then incubated for 30 min at room temperature. Total RNA was used as a control during the RIP process. The samples were incubated overnight at 4 °C and washed 5 times with the RIP wash buffer. Total RNA was extracted using the TRIzol method, reverse transcribed to cDNA, and then subjected to qRT-PCR to determine the expression of AFAP1-AS1.
Statistical Analysis
Data were statistically analyzed using SPSS 22.0 (IBM, Chicago, USA) and GraphPad Prism 9.0 (San Diego, USA) software and presented as means ± standard deviation. Comparisons between and among groups were performed using Student’s t-test and analysis of variance, respectively, and data with P-values of less than 0.05 were considered statistically significant.
Results
Pituitary Adenoma–Derived Exosomes Promote Proliferation, Migration, and Invasion of PA Cells
Previous studies have shown that tumor-derived exosomes are correlated with the proliferation and metastasis of cancer cells [7, 19]. To investigate the role of exosomes in PA, we isolated tumor cell–derived exosomes from GH1 and RC-4B/C cell lines and then subjected them to TEM and NTA. The exosomes appeared as spherical particles, with a double-layer membrane with a size of around 80–100 nm, which is consistent with common sizes of exosomes (Fig. 1A, B). Western blots revealed significant upregulation of exosome-specific markers, namely CD9, CD81, TSG101 and Alix, and the calnexin, a negative control marker absent in exosomes (Fig. 1C). Next, we examined whether exosomes influence the proliferation, migration, and invasion of PA cells and found that exosomes significantly promoted PA cell proliferation compared to the control groups (Fig. 1D). The colony formation ability of PA cells was also strongly elevated by the exosomes (Fig. 1E). Western blots revealed that exosomes upregulated expression of CDK2, and Cyclin D1, but downregulated that of p21 and p27, proteins (Fig. 1F). Wound healing and Transwell assay results showed that exosomes from PA cells markedly increased migration and invasion of PA cells (Fig. 1G, H). Furthermore, PA-derived exosomes upregulated the expression of N-cadherin, Vimentin, and MMP9 proteins, but downregulated that of E-cadherin (Fig. 1I). The efficacy was assessed in the in vivo metastasis model. Specifically, GH1-luciferase cells, either untreated (control) or treated with exosomes, were intravenously injected into nude mice. Tumor metastasis was monitored weekly using an in vivo imaging system. Notably, exosome-treated mice exhibited substantially higher fluorescence intensity in lung metastases compared to the control group (Fig. 1J). Furthermore, histological examination via HE staining revealed a significantly greater abundance of micro-metastases in the lung tissue of mice injected with exosome-treated GH1 cells compared to controls (Fig. 1K). These collective observations strongly suggest that exosomes originating from PA cells promote the proliferation, migration, and invasion of PA cells.
Fig. 1.
Pituitary adenoma (PA)-derived exosomes promote the proliferation, migration, and invasion of PA cells. A–C Transmission electron microscopy, nanoparticle tracking, and western blotting analysis of exosomes derived from PA cell lines, GH1, and RC-4B/C. D CCK-8 assay results showing cell viability in the indicated groups. E Representative bright-field images and profiles of the formed cell colonies. F Western blots analysis of the protein expression of CDK2, Cyclin D1, p21, and p27. G, H Wound healing and Transwell invasion assay results showing changes in migration and invasion abilities, respectively. I The protein expression levels of N-cadherin, Vimentin, MMP9, and N-cadherin. J Representative IVIS spectra illustrating lung metastasis signals. K The effect of exosomes on lung metastasis nodes. A–I Mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001. Control (Ctrl): Cells were cultured in RPMI1640 medium containing exosome-free FBS
Pituitary Adenoma–Derived Exosomes Promote Aerobic Glycolysis
Aerobic glycolysis ferments glucose into lactate to support the growth and metastasis of cancer [20]. To investigate whether exosomes modulate glucose metabolism, we utilized the glucose uptake, lactate, and seahorse assays to analyze metabolic changes in PA-derived exosome–treated cell lines. Results showed that exosomes mediated a considerable increase in glucose uptake, as well as lactate production (Fig. 2A, B). Meanwhile, cells with exosomes had a higher level of glycolysis and glycolytic capacity, but lower level of maximal respiration, and ATP production (Fig. 2C, D). To examine whether exosomes boosted the growth and movement of PA cells by stimulating glycolysis, we applied a glycolysis inhibitor 2-DG, and found that the proliferative and invasive behavior of PA cells was attenuated in the presence of the inhibitor (Fig. 2E, F). In summary, these data suggest that the promotion of glycolysis by exosomes could potentially facilitate the growth and invasion of PA cells.
Fig. 2.
Pituitary adenoma–derived exosomes promote aerobic glycolysis. A Glucose uptake, lactate production (B), ECAR (C), and OCR (D) assays in PA cells treated with or without exosomes. E, F The proliferation and invasion of PA cells co-treated with exosomes and glycolysis inhibitor 2-DG. Data are expressed as the mean ± standard deviation (n = 3). **P < 0.01, ***P < 0.001. Ctrl: No exosome
Proliferation, Migration, and Invasion Capability of PA Cells Are Augmented by Exosomal AFAP1-AS1
Previous studies have shown that AFAP1-AS1 is upregulated in PA tissues, and exosomal AFAP1-AS1 regulates the migration and metastasis of esophageal cancer cells [15, 16]. Our qRT-PCR and northern blot results reveal that AFAP1-AS1 was significantly upregulated in exosome-stimulated PA cells compared to the control group (Fig. 3A, Supplementary Fig. 1A, B). To investigate whether exosomal AFAP1-AS1 regulates PA cell growth, migration, and invasion, we used stably knocked down AFAP1-AS1 in exosomes from PA cells and transfected PA cells (Fig. 3A). PA cells treated with exosomes derived from AFAP1-AS1 knockdown cells demonstrated a markedly reduced decrease in cell viability compared to the control group (Fig. 3B). Similarly, PA cells treated with exosomes from AFAP1-AS1 knockdown cells exhibited a pronounced inhibition of clone formation (Fig. 3C). Furthermore, PA cells treated with AFAP1-AS1 knockdown exosomes displayed significantly decreased expression levels of CDK2 and Cyclin D1, alongside significant upregulation of p21 and p27, in comparison to controls (Fig. 3D). Transwell and wound healing assay results showed that exosomes from AFAP1-AS1 stable-silenced PA cells showed inhibitory effects on the migration and invasion ability of PA cells (Fig. 3E, F). Similarly, exosomes derived from AFAP1-AS1 stable silenced PA cells displayed higher expression of E-cadherin and lower expression of N-cadherin, Vimentin, and MMP9 (Fig. 3G). To further explore the function of exosomal AFAP1-AS1 in promoting metastasis, we established the SCID metastasis mouse model by injecting GH3-luciferase cells treated with AFAP1-AS1 knockdown or control exosomes into the tail vein of mice. After 4 weeks, in vivo IVIS Spectrum imaging revealed that AFAP1-AS1 knockdown exosomes significantly suppressed the ability of PA cells to metastasize to the lung relative to those in the control group (Fig. 3H). Notably, the AFAP1-AS1 knockdown exosome–treated group had a significantly lower number of lung metastasis nodes than the controls (Fig. 3I). Collectively, these findings indicated that exosomal AFAP1-AS1 plays a vital role in facilitating the growth and metastasis of PA cells.
Fig. 3.
Exosomal AFAP1-AS1 augments proliferation, migration, and invasion capability of PA cells. A qRT-PCR results showing the expression level of AFAP1-AS1 expression in exosomes and cell lysates from PA cells infected with sh-AFAP1-AS1 or negative control lentivirus. B–D The CCK-8, colony formation, and western blotting results showing the impact of AFAP1-AS1 knockdown in exosomes on PA cell growth. E–G Transwell and wound healing assay results depicting the effect of AFAP1-AS1 silencing in exosomes on PA cell migration and invasion. H Bioluminescence images illustrating the metastatic potential to the lung in NOD/SCID mice injected with AFAP1-AS1 knockdown or control exosomes treated-GH1 luciferase cells through their tail vein. I The number of lung metastasis nodes for AFAP1-AS1 knockdown or control exosomes treated group. A–G Data are presented as the mean ± standard deviation (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001. Ctrl: Cells were cultured in RPMI1640 medium containing exosome-free FBS
Exosomal AFAP1-AS1 Positively Affects Aerobic Glycolysis in PA Cells
Next, we explored whether exosomal AFAP1-AS1 modulates aerobic glycolysis in PA cells and found that sh-AFAP1-AS1 exosome–treated cells exhibited a remarkable decrease in glucose consumption and lactate production compared to controls (Fig. 4A, B). Cells treated with AFAP1-AS1 knockdown exosomes exhibited significantly decreased glycolysis and glycolytic capacity, as evidenced by the ECAR (Fig. 4C). Conversely, the OCR showed a significant decline in ATP production and maximal respiratory capacity (Fig. 4D). Collectively, these results implied that exosomal AFAP1-AS1 facilitates energy metabolism.
Fig. 4.
Exosomal AFAP1-AS1 promotes aerobic glycolysis in PA cells. A, B Glucose uptake and lactate assay results showing glucose uptake and lactate concentration in the sh-AFAP1-AS1 exosome–treated cells. C OCR and ECAR (D) assay results indicating the status of glycolytic metabolism. Data are presented as the mean ± standard deviation (n = 3). **P < 0.01, ***P < 0.001
Exosomal AFAP1-AS1 Interacts with HuR to Impede SMURF1-Mediated Ubiquitination and Degradation of HuR
Next, we performed cellular localization analysis to elucidate the precise physiological mechanism underlying exosomal AFAP1-AS1–mediated regulation of PA cell proliferation, migration, invasion, and glucose metabolism. RNA FISH and subcellular fractionation assay results revealed that AFAP1-AS1 was mainly localized in the cytoplasm of PA cell lines (Fig. 5A, B). Typically, cytoplasmic lncRNAs exert their biological functions through the formation of interactions with RNA-binding proteins (RBPs) [21]. Next, we employed ENCORI (StarBase) [22] and RBPDB databases [23] to predict AFAP1-AS1’s RBPs and found that HuR is the potential RBP of AFAP1-AS1. We then performed the RIP assay to determine the validity of the interaction between AFAP1-AS1 and HuR and found a significant amplification in the level of AFAP1-AS1 in HuR-bound samples acquired from exosome-treated PA cells (Fig. 5C). These results were further corroborated by findings from the RNA pull-down assay, indicating the specific binding of HuR to the sense AFAP1-AS1 probe (Fig. 5D). Moreover, we generated a mutant AFAP1-AS1 vector based on the forecasted binding domains, with a view to elucidating the precise binding sites of AFAP1-AS1 and HuR (Fig. 5E, F). Furthermore, we found no significant difference in mRNA abundance of HuR between AFAP1-AS1 knockdown and control exosome–treated groups, although substantial changes were observed in HuR proteins in AFAP1-AS1 knockdown exosome–treated PA cells (Fig. 5G, H). Collectively, these results indicated that exosomal AFAP1-AS1 could possibly interact with HuR at the posttranscriptional level. We further investigated whether HuR protein is degraded via the ubiquitination process by implementing CHX (a protein synthesis inhibitor) or MG-132 (a specific proteasome inhibitor) on AFAP1-AS1 knockdown exosomes treated PA cells. Results showed that the downregulation of HuR protein in AFAP1-AS1 knockdown exosome–treated PA cells was mitigated by MG-132 (Fig. 5I). Meanwhile, HuR protein stability was greatly reduced by AFAP1-AS1-knockdown exosomes (Fig. 5J). Ubiquitination assay results revealed notable upregulation in HuR ubiquitination in AFAP1-AS1-knockdown exosome–treated PA cells (Fig. 5K). Overall, these findings suggest that AFAP1-AS1 exosomes inhibit the ubiquitination of HuR.
Fig. 5.
Exosomal AFAP1-AS1 regulates HuR via ubiquitination. A, B The subcellular location of AFAP1-AS1 was explored by qRT-PCR and RNA-fluorescence in situ hybridization. C, D RNA pull-down and RIP assay results showing the association between AFAP1-AS1 and HuR. E, F RIP assay results validating the binding of AFAP1-AS1 to HuR in PA cells overexpressing AFAP1-AS1 (WT) and mutant constructs. G qRT-PCR and western blot (H) results showing HuR mRNA and protein levels, respectively, in AFAP1-AS1-knockdown exosome–treated cells. I, J Western blots showing HuR protein expression in AFAP1-AS1-knockdown exosome–treated cells with or without 20 µM of MG-132 for 8 h or 50 mg/mL CHX for 12 h, 24 h, or 36 h. K Western blots indicating the ubiquitination levels of HuR in cell lysates of AFAP1-AS1-knockdown exosome–treated cells treated with 20 µM MG-132 for 8 h, following immunoprecipitation with the anti-HuR antibody. L UbiBrowser depicted that E3 ligase interacts with HuR. M–O SMURF1 interacted with HuR and ubiquitinated to degrade HuR in PA cells. P Co-IP results showing the interaction of SMURF1/HuR in AFAP1-AS1-knockdown exosome–treated cells. Q The HK2 and PKM2 protein expression in AFAP1-AS1-knockdown exosome–treated cells. Data are expressed as the mean ± standard deviation (n = 3). ***P < 0.001
Next, we employed a computational predictive tool UbiBrowser [24] to identify the characteristics of E3 ligases that interact with HuR and found that HuR displayed the strongest interaction with SMURF1, with a confidence score of 0.688 (Fig. 5L). The interaction between SMURF1 and HuR was further confirmed by Co-IP assay results (Fig. 5M); SMURF1 overexpression increased HuR protein expression, and SMURF1 knockdown decreased the protein expression of HuR (Fig. 5N, Supplementary Fig. 1C). Furthermore, overexpression of SMURF1 ubiquitinated and degraded HuR protein levels (Fig. 5O). Next, we investigated the interaction between SMURF1 and HuR upon AFAP1-AS1-knockdown exosomes and found that PA cells with AFAP1-AS1-knockdown exosomes exhibited a stronger SMURF1/HuR interaction (Fig. 5P). A previous study showed that HuR regulated the expression of HK2 and PKM2 [25]. Our western blots also revealed that AFAP1-AS1-knockdown exosomes significantly downregulated HK2 and PKM2 protein expression (Fig. 5Q). Taken together, these results indicated that exosomal AFAP1-AS1 could potentially decrease the interaction between SMURF1 and HuR, which in turn blocks SMURF1-mediated degradation and ubiquitination of HuR.
Exosomal AFAP1-AS1 Regulates Aerobic Glycolysis, Proliferation, and Mobility Through HuR in PA Cells
Next, we performed rescue experiments to ascertain whether exosomal AFAP1-AS1 promotes PA cell proliferation, migration, and invasion by stabilizing HuR. Notably, overexpression of HuR in PA cells eliminated the repressive effect of AFAP1-AS1 knockdown exosomes on the expression of HuR, PKM2, and HK2 (Fig. 6A). Similarly, overexpression of HuR rescued the altered proliferation ability of PA cells caused by AFAP1-AS1 silenced exosomes (Fig. 6B–D). Notably, the reduction in cell motility induced by exosomes derived from cells with AFAP1-AS1 knockdown was reversed by HuR (Fig. 6E–G), consistent with proliferation data. Moreover, transfection of the HuR plasmid countered the restraining effects of AFAP1-AS1 knockdown exosomes on glucose and lactate levels (Fig. 7A, B). ECAR and OCR assay results further showed that the inhibition of glycolysis and glycolytic capacity, as well as induction of ATP production and maximal respiratory capacity by exosomes with suppressed AFAP1-AS1, was reversed by HuR upregulation (Fig. 7C, D). Collectively, these results indicate that exosomal AFAP1-AS1’s effect on promoting proliferation, migration, invasion, and glucose metabolism is attributed to its ability to modulate HuR protein stability.
Fig. 6.
Exosomal AFAP1-AS1 regulates proliferation and mobility through HuR in PA cells. A–G CCK-8, clone formation, Scratch, Transwell, and western blot assay results showing the proliferation and mobility of PA cells treated with exosomes with AFAP1-AS1 knockdown and HuR plasmids. Data are expressed as the mean ± standard deviation (n = 3). **P < 0.01, ***P < 0.001
Fig. 7.
Exosomal AFAP1-AS1 regulates aerobic glycolysis by HuR in PA cells. A Glucose uptake, lactate production (B), ECAR (C), and OCR (D) assay results showing glycolysis levels in PA cells treated with exosomes with downregulated AFAP1-AS1 expression and HuR plasmid. Data are presented as the mean ± standard deviation (n = 3). **P < 0.01, ***P < 0.001
Discussion
The tumor microenvironment influences tumor progression and metastasis by altering intercellular communications [26, 27]. Exosomes, as a dynamic element in this system, transport biological molecules including lncRNAs to tumor cells, thereby promoting tumorigenesis or tumor progression [18]. A recent study showed that exosomes containing AFAP1-AS1 can promote migration, invasion, and lung metastasis of esophageal cancer cells [16]. Numerous studies have also shown that AFAP1-AS1 is often dysregulated in various human cancers, including thyroid, lung, and breast cancer, as well as osteosarcoma and PA, and its aberrant expression regulates numerous hallmarks to promote tumor development, invasion, and metastasis, such as proliferation, apoptosis, metastasis, and glycolysis [12, 14, 28–31]. In PA, downregulation of AFAP1-AS1 impeded cell proliferation, growth hormone, and prolactin secretion and induced cell apoptosis and G/S cell cycle arrest [14]. In the present study, we found that AFAP1-AS1 was significantly upregulated in cells treated with exosomes derived from PA. Moreover, exosomal AFAP1-AS1 enhanced the proliferation, clonal formation, migration, invasion, and sugar metabolism of PA cells.
The subcellular distribution of lncRNAs contributes to their functional diversity [32]. In this study, we found that AFAP1-AS1 was primarily localized in the cytoplasm. Further, cytoplasmic lncRNAs could bind directly to proteins and affect the posttranslational modification of proteins including their phosphorylation, ubiquitination, acetylation, and glycosylation to modulate the degradation or production of protein. Through this mechanism, it modulates protein expression and activity [33]. Protein ubiquitination is a common post-translational modification in many diseases, such as cancer [34]. Ubiquitination regulates various life activities, including DNA damage repair, cell cycle regulation, and signaling [32]. In our study, AFAP1-AS1 interacted with RNA-binding protein HuR, and inhibition of exosomal AFAP1-AS1 enhanced the degradation and ubiquitination of HuR. HuR, also known as ELAVL1, belongs to the family of ELAV-like proteins and is expressed in a wide range of tissues [35]. Recent evidence has demonstrated that HuR can function as an oncogene in various cancer types [36, 37]. HuR regulates numerous cellular processes, including cell growth, angiogenesis, migration, invasion, glycolysis, and differentiation [24, 37, 38]. In this study, ectopic expression of HuR significantly weakened the effects of AFAP1-AS1-knockdown exosomes on the proliferation, migration, invasion, and glucose metabolism of PA cell lines. E3 ubiquitin ligase is one of the most important heterogeneous enzymes involved in the ubiquitination pathway that regulates the expression of various proteins [39–41]. In asthma, lncTRPM2-AS inhibits TRIM21-mediated ubiquitination of TRPM2, which is followed by inhibition of autophagy-induced apoptosis [40]. In colorectal cancer, the interaction between Linc02023 and PTEN inhibits the ability of WWP2 to both bind and ubiquitinate PTEN, thereby decreasing cell proliferation and inducing apoptosis as well as causing rearrangement of the cell cycle [41]. Similarly, our study demonstrates that the association between AFAP1-AS1 and HuR hinders SMURF1-induced ubiquitination and subsequent degradation of HuR, thereby strengthening the growth, migration, invasion, and glucose metabolism of PA cells.
Studies have demonstrated metabolic reprogramming is a hallmark feature of cancer progression [42]. The metabolic pathways of cancer cells are reprogrammed to increase the viability and rapid multiplication of the cells. Even in the presence of oxygen, cancer cells preferentially prefer glycolysis over mitochondrial oxidative phosphorylation [43]. This altered energy metabolism is known as aerobic glycolysis. Inhibition of aerobic glycolysis can potentially inhibit the growth and metastasis of cancer cells [44]. HK2 is a metabolic enzyme that enhances glucose absorption into cells and promotes the Warburg effect [45]. Its overexpression has been detected in numerous cancer types, where it promotes glycolysis, tumor growth, and metastasis [45, 46]. PKM2, a rate-limiting player in glycolysis, was found to regulate the metabolism, growth, and metastasis of tumor cells [47]. Other scholars have documented that PKM2 is upregulated in various types of human cancers, where it enhances cancer development and progression [48]. HuR inhibited the expression of miR‐199a, thereby facilitating the expression of HK2 and PKM2 [25]. In this study, we found that HK2 and PKM2 were upregulated in HuR-overexpressing PA cells. Furthermore, increased expression of HuR-reversed cancer–derived exosomal AFAP1-AS1–induced HK2 and PKM2 expression, which stimulated tumor growth and metastasis.
In conclusion, this study demonstrates that tumor-derived exosomal AFAP1-AS1 promotes the proliferation, migration, invasion, and glucose metabolism by inhibiting SMURF1-mediated ubiquitination of HuR, thereby upregulating HK2 and PKM2 expression (Fig. 8). Therefore, AFAP1-AS1 may be a diagnostic marker and therapeutic target for PA treatment.
Fig. 8.
An illustration of the molecular mechanism. Exosomal AFAP1-AS1 promotes the growth, metastasis, and glycolysis of pituitary adenomas by suppressing SMURF1-mediated ubiquitination and degradation of HuR, causing increased HK2 and PKM2 expression
Supplementary Information
Below is the link to the electronic supplementary material.
Author Contribution
HXT conceived the study design, performed the in vitro experiments, and wrote the manuscript. DLZ and WXL performed the in vivo experiments. GZZ and HZ prepared all the figures. QJP conducted the data analysis. All authors read and approved the final manuscript.
Funding
This work was supported by Guangzhou Nansha Planned Project of Science and Technology (No. 2021MS001). Guangzhou Planned Project of Science and Technology (No. 2023A03J0964).
Data Availability
No datasets were generated or analysed during the current study.
Declarations
Ethics Approval
This study was approved by the Institutional Animal Care and Use Committee of Guangzhou First People’s Hospital, South China University of Technology (K-2021–041-01).
Conflict of Interest
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Wu L et al (2022) The AKT/mTOR signaling pathway was mediated through the LINC00514/miR-28-5p/TRIM44 axis. Dis Markers 2022:1889467 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 2.Wu W, et al (2022) Emerging roles of miRNA, lncRNA, circRNA, and their cross-talk in pituitary adenoma. Cells 18(11). 10.3390/cells11182920 [DOI] [PMC free article] [PubMed]
- 3.Lu L et al (2022) Prognostic factors for recurrence in pituitary adenomas: recent progress and future directions. Diagnostics (Basel) 4(12):977 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zhao P et al (2021) LncRNA PCAT6 regulates the progression of pituitary adenomas by regulating the miR-139-3p/BRD4 axis. Cancer Cell Int 1(21):14 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 5.Mao D et al (2022) LncRNA SNHG6 induces epithelial-mesenchymal transition of pituitary adenoma via suppressing MiR-944. Cancer Biother Radiopharm 4(37):246–255 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Sreerenjini L et al (2021) Exosomes and exosomal RNAs in breast cancer: a status update. Eur J Cancer 144:252–268 [DOI] [PubMed] [Google Scholar]
- 7.Shang A et al (2020) Exosomal circPACRGL promotes progression of colorectal cancer via the miR-142-3p/miR-506-3p- TGF-beta1 axis. Mol Cancer 1(19):117 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Parisa V et al (2023) Exosomal lncRNAs in gastrointestinal cancer. Clin Chim Acta 540:117216 [DOI] [PubMed] [Google Scholar]
- 9.Pathania AS et al (2020) Exosomal long non-coding RNAs: emerging players in the tumor microenvironment. Mol Ther Nucleic Acids. Mol Ther Nucleic Acids 23:1371–1383 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ren J et al (2018) Carcinoma-associated fibroblasts promote the stemness and chemoresistance of colorectal cancer by transferring exosomal lncRNA H19. Theranostics 14(8):3932–3948 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sattar A et al (2020) Bidirectional interaction of lncRNA AFAP1-AS1 and CRKL accelerates the proliferative and metastatic abilities of hepatocarcinoma cells. J Adv Res 24:121–130 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhong Y et al (2021) Long non-coding RNA AFAP1-AS1 accelerates lung cancer cells migration and invasion by interacting with SNIP1 to upregulate c-Myc. Signal Transduct Target Ther 1(6):240 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Xi Y et al (2018) Histone modification profiling in breast cancer cell lines highlights commonalities and differences among subtypes. BMC Genomics 19(1):150 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Tang H et al (2019) AFAP1-AS1 promotes proliferation of pituitary adenoma cells through miR-103a-3p to activate PI3K/AKT signaling pathway. World Neurosurg 130:e888–e898 [DOI] [PubMed] [Google Scholar]
- 15.Tang H et al (2018) Knockdown of long non-coding RNA AFAP1-AS1 inhibits growth and promotes apoptosis in pituitary adenomas. Int J Clin Exp Pathol 3(11):1238–1246 [PMC free article] [PubMed] [Google Scholar]
- 16.Mi X et al (2020) M2 macrophage-derived exosomal lncRNA AFAP1-AS1 and microRNA-26a affect cell migration and metastasis in esophageal cancer. Mol Ther Nucleic Acids 22:779–790 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wang X et al (2022) Exosomal AFAP1-AS1 binds to microRNA-15a-5p to promote the proliferation, migration, and invasion of ectopic endometrial stromal cells in endometriosis. Reprod Biol Endocrinol 1(20):77 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Dutta S et al (2021) alpha-Synuclein in blood exosomes immunoprecipitated using neuronal and oligodendroglial markers distinguishes Parkinson’s disease from multiple system atrophy. Acta Neuropathol 142(3):495–511 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Liu D et al (2020) Exosome-transmitted circ_MMP2 promotes hepatocellular carcinoma metastasis by upregulating MMP2. Mol Oncol 6(14):1365–1380 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sumana P et al (2022) Tumor glycolysis, an essential sweet tooth of tumor cells. Semin Cancer Biol 86(Pt 3):1216–1230 [DOI] [PubMed] [Google Scholar]
- 21.Li B et al (2022) LncRNA GAL promotes colorectal cancer liver metastasis through stabilizing GLUT1. Oncogene 13(41):1882–1894 [DOI] [PubMed] [Google Scholar]
- 22.Fernando C et al (2019) Integration of CLIP experiments of RNA-binding proteins: a novel approach to predict context-dependent splicing factors from transcriptomic data. BMC Genomics 20(1):521 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kate BC, et al (2011) RBPDB: a database of RNA-binding specificities. Nucleic Acids Res 39(Database issue):D301–8. 10.1093/nar/gkq1069 [DOI] [PMC free article] [PubMed]
- 24.Anne O et al (2021) Analysis of tripartite motif (TRIM) family gene expression in prostate cancer bone metastases. Carcinogenesis 42(12):1475–1484 [DOI] [PubMed] [Google Scholar]
- 25.Zhang LF et al (2015) Suppression of miR-199a maturation by HuR is crucial for hypoxia-induced glycolytic switch in hepatocellular carcinoma. EMBO J 21(34):2671–2685 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Paskeh MDA et al (2022) Emerging role of exosomes in cancer progression and tumor microenvironment remodeling. J Hematol Oncol 1(15):83 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kevin BC et al (2019) Glycosylation in the tumor microenvironment: implications for tumor angiogenesis and metastasis. Cells 8(6):544 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ma H et al (2022) Long non-coding RNA AFAP1-AS1 promotes thyroid cancer progression by sponging miR-204-3p and upregulating DUSP4. J Biochem 1(171):131–140 [DOI] [PubMed] [Google Scholar]
- 29.Zhang X et al (2021) Long noncoding RNA AFAP1-AS1 promotes tumor progression and invasion by regulating the miR-2110/Sp1 axis in triple-negative breast cancer. Cell Death Dis 7(12):627 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Fei D et al (2020) Long noncoding RNA AFAP1-AS1 promotes osteosarcoma progression by regulating miR-497/IGF1R axis. Am J Transl Res 5(12):2155–2168 [PMC free article] [PubMed] [Google Scholar]
- 31.Zhong X et al (2023) Construction of a prognostic glycolysis-related lncRNA signature for patients with colorectal cancer. Cancer Med 1(12):930–948 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Li B et al (2022) The N(6)-methyladenosine-mediated lncRNA WEE2-AS1 promotes glioblastoma progression by stabilizing RPN2. Theranostics 14(12):6363–6379 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wang Y et al (2021) Long noncoding RNA SOX2OT promotes pancreatic cancer cell migration and invasion through destabilizing FUS protein via ubiquitination. Cell Death Discov 1(7):261 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Wang J et al (2022) LINC00941 promotes pancreatic cancer malignancy by interacting with ANXA2 and suppressing NEDD4L-mediated degradation of ANXA2. Cell Death Dis 8(13):718 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Xiao M et al (2020) MAFG-AS1 promotes tumor progression via regulation of the HuR/PTBP1 axis in bladder urothelial carcinoma. Clin Transl Med 8(10):e241 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Sofia LO et al (2022) Hu Antigen R (HuR) Protein structure, function and regulation in hepatobiliary tumors. Cancers (Basel) 14(11):2666 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Rajeswari R et al (2022) Drug delivery approaches for HuR-targeted therapy for lung cancer. Adv Drug Deliv Rev 180:114068 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Vittoria B et al (2021) Targeting the RNA-binding protein HuR as potential therapeutic approach for neurological disorders: focus on amyotrophic lateral sclerosis (ALS), spinal muscle atrophy (SMA) and multiple sclerosis. Int J Mol Sci 22(19):10394 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Long B et al (2020) Long noncoding RNA ASB16-AS1 inhibits adrenocortical carcinoma cell growth by promoting ubiquitination of RNA-binding protein HuR. Cell Death Dis 11(11):995 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Li X et al (2021) LncTRPM2-AS inhibits TRIM21-mediated TRPM2 ubiquitination and prevents autophagy-induced apoptosis of macrophages in asthma. Cell Death Dis 12(12):1153 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wang Q et al (2019) Long noncoding RNA Linc02023 regulates PTEN stability and suppresses tumorigenesis of colorectal cancer in a PTEN-dependent pathway. Cancer Lett 451:68–78 [DOI] [PubMed] [Google Scholar]
- 42.Xie Y et al (2022) Ubiquitination regulation of aerobic glycolysis in cancer. Life Sci 292:120322 [DOI] [PubMed] [Google Scholar]
- 43.Huang J et al (2022) FTO suppresses glycolysis and growth of papillary thyroid cancer via decreasing stability of APOE mRNA in an N6-methyladenosine-dependent manner. J Exp Clin Cancer Res 1(41):42 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wu Y et al (2022) RNA m(1)A methylation regulates glycolysis of cancer cells through modulating ATP5D. Proc Natl Acad Sci U S A 28(119):e2119038119 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Chen J et al (2019) Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer. Mol Cancer 1(18):33 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 46.Francesco C et al (2021) Hexokinase 2 in cancer: a prima donna playing multiple characters. Int J Mol Sci 22(9):4716 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Wang JZ et al (2021) The role of the HIF-1alpha/ALYREF/PKM2 axis in glycolysis and tumorigenesis of bladder cancer. Cancer Commun (Lond) 7(41):560–575 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Ali HEF et al (2022) Cancer metabolism control by natural products: pyruvate kinase M2 targeting therapeutics. Phytother Res 36(8):3181–3201 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
No datasets were generated or analysed during the current study.








