Curcumin administration alleviates seminal vesicle damage in type 1 diabetic rats by promoting AQP8 expression through AR activation

Abstract

Diabetes is a detriment to male reproductive health, notably through its capacity to diminish secretion from accessory glands such as the seminal vesicles and prostate, which are crucial for reproductive function. Curcumin, a naturally derived polyphenol renowned for its anti-inflammatory and antioxidative attributes, has demonstrated potential in mitigating tissue damage across various organs in diabetic patients. Despite its established benefits, the specific impact of curcumin on seminal vesicle damage in the context of diabetes remains underexplored. This investigation delves into the therapeutic potential of curcumin in ameliorating seminal vesicle damage in diabetic rats, thereby elucidating its underlying mechanisms. This study focused on twenty male SD rats divided into two distinct groups, a control cohort and a diabetic contingent, and employed a streptozocin (STZ)-induced type 1 diabetic rat model to ascertain seminal vesicle alterations secondary to diabetes. Ultrasonography was used to measure rat seminal vesicle sizes for comparison with postdissection measurements. This study revealed that (1) seminal vesicle volume and seminal fluid secretion were reduced in diabetic rats and (2) ultrasonography can predict seminal vesicle secretory dysfunction in diabetic rats, providing a theoretical basis for selecting animal models of diabetic seminal vesicle dysfunction for subsequent studies. Thirty male SD rats were subsequently divided into three groups: control, diabetic, and curcumin-treated. The curcumin group, which was subjected to a one-month-long intervention after STZ-induced diabetes onset, exhibited significant histological and functional recovery. Haematoxylin‒eosin (HE) staining revealed disordered seminal vesicle tissue structures and decreased epithelial cell height in diabetic rats, which was partially restored after curcumin treatment. Western blot and PCR results demonstrated that the expression levels of androgen receptor (AR) and aquaporin (AQP)8 in the seminal vesicle tissues of diabetic rats were decreased, whereas curcumin treatment led to increases in the expression levels of AR and AQP8. Seminal vesicle cells were cultured in vitro and divided into six groups: control, HG, HG-CUR-5 µM, HG-CUR-10 µM, HG-CUR-20 µM, and HG-CUR-50 µM. After 48 h of intervention, the fructose concentration in the culture medium was measured, and the expression of AR and AQP8 in the control, HG, and HG-CUR-20 µM groups was determined via Western blotting and PCR. The results revealed that the expression of AR and APQ8 in high glucose-treated seminal vesicle cells was decreased and that curcumin treatment upregulated the expression of AR and AQP8. After the addition of bicalutamide (an AR inhibitor), the expression of AQP8 was reduced. These findings suggest that curcumin may alleviate seminal vesicle damage in type 1 diabetic rats by activating the AR-AQP8 pathway.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-74750-5.

Introduction

Diabetes mellitus (DM), one of the most prevalent chronic diseases, is increasingly occurring in younger demographics as societal habits change, especially those concerning type 1 diabetes mellitus (T1DM). Recent research indicates that more than 90% of T1DM patients are diagnosed before the age of 30. T1DM can lead to various diseases and complications^1,2, including diabetic nephropathy, diabetic cardiomyopathy, sexual dysfunction, and male infertility, among others. Studies have shown that in male diabetic patients, the prevalence of erectile dysfunction is positively correlated with diabetes duration. T1DM can cause steroidogenesis disorders and damage to male accessory glands, thereby affecting male reproductive function³. Pei L et al.⁴ reported that the semen volume of men with diabetes is significantly lower than that of nondiabetic controls. Additionally, hyperglycaemia alters the expression of aquaporins (AQPs) in seminal vesicle tissue, thereby reducing seminal vesicle secretion. Dong B et al⁵. studied the seminal vesicle tissue of rats with T1DM and reported that T1DM causes a decrease in the expression of the transcription factor Nrf2 in seminal vesicle tissue and an increase in seminal vesicle cell apoptosis, leading to seminal vesicle atrophy and reduced secretion. However, after the rats were fed quercetin for four months, these conditions significantly improved. Further research has demonstrated a correlation between diabetes, erectile dysfunction, and abnormalities in semen secretion⁶, which are key factors contributing to male infertility.

The seminal vesicle (SV) is an essential accessory gland in the male reproductive system. The secreted seminal fluid is rich in fructose, vitamin C, and various enzymes, which serve as energy sources for sperm⁵. The SV contributes approximately 80% of the ejaculate, making seminal fluid vital for male sexual function and fertility. Additionally, male reproductive organs are abundant in androgen receptors (ARs), and the SV and prostate are known to be androgen-dependent organs⁶. Research by Stanworth RD⁷ regarding 233 diabetic patients revealed that diabetes can lead to reduced testicular testosterone levels, thereby affecting male sexual function and fertility. Moreover, Basaria S’s study indicated that prostate cancer patients undergoing long-term androgen deprivation therapy (ADT) are at increased risk for insulin resistance and hyperglycaemia, as well as cardiovascular diseases, suggesting a link between testosterone deficiency and the progression of diabetes in men⁸. However, research on diabetes-induced SV tissue damage is still limited. Therefore, delving into the specific mechanisms by which diabetes causes SV damage and exploring effective therapeutic drugs have become popular topics in research related to male fertility issues. Ultrasound imaging, as a non-invasive diagnostic technique, is widely used in the evaluation of male reproductive organs, providing accurate measurements of the size, morphology, and internal structure of the seminal vesicles. Low-frequency ultrasound is suitable for examining deep tissues, while high-frequency ultrasound, with its superior resolution, is ideal for assessing superficial organs and detailed structures. Our preliminary experiments revealed that diabetic rats exhibited reduced seminal vesicle volume and secretion, though not all models showed significant pathological changes. Therefore, this study aims to use high-frequency ultrasound to measure the length (ld), anteroposterior diameter (apd), and width (wd) of rat seminal vesicles and compare them with actual measurements. This approach will evaluate seminal vesicle size and function, providing theoretical support for establishing a model of seminal vesicle secretion dysfunction in diabetic rats.

Curcumin (CUR) is a natural polyphenol found in the rhizomes of turmeric plants. Owing to its antioxidant and anti-inflammatory properties, curcumin has been demonstrated to play a significant role in the treatment of chronic inflammatory diseases, neurodegenerative disorders, and cardiovascular diseases^9,10; studies have shown that curcumin can exert beneficial effects by regulating the expression of oestrogen receptor-α, endothelial protein C receptor, and androgen receptors. Rahmani S and colleagues¹¹ reported that, in obese patients, curcumin intake could reduce body mass index, total serum cholesterol (TC), and triglyceride (TG) levels. Kim JM¹² reported in a study on a mouse model of salivary gland damage that curcumin could improve radiation-induced salivary gland dysfunction in mice by promoting the expression of AQP5, suggesting that curcumin can improve the secretory function of microorgans by promoting the expression of cellular AQP proteins. However, reports on the ability of curcumin to ameliorate diabetic seminal vesicle damage and secretory function are scarce.

AQPs are a family of transmembrane channel proteins highly expressed in some secretory cells that play crucial roles in the influence of selective pores on the homeostasis of water and ions inside and outside the cell. The primary functions of SVs are to secrete seminal fluid; thus, AQPs must be expressed in the epithelial tissue. Studies have shown that AQPs 1, 4, 8, and 9 are expressed on the plasma membranes of rat SV epithelial cells. The AQP8 protein is localised to the plasma membranes and cytoplasms of germ cells and plays an important role in water transport in mouse sperm during osmoregulation, suggesting that AQPs may play a crucial role in regulating the secretory function of SVs. While AQP1-4 have been described in diabetes, AQP8 has not been described in diabetic SVs.

Therefore, by observing the specific effects of curcumin (CUR) on the SVs of rats with STZ-induced type 1 diabetes and on SV cells cultured in vitro, this study revealed that CUR could increase the expression of ARs and AQP8 in rat SV cells. Inhibiting AR expression decreased AQP8 expression levels, suggesting that CUR might protect SVs through the AR-AQP8 signalling pathway, providing a theoretical basis for the clinical use of CUR in preventing diabetic SV damage.

Materials and methods

Materials

CUR (S19245) was purchased from Yuan Ye Bio-Technology Co., Ltd. (Beijing, China); a blood glucose test kit was acquired from Rongsheng Biotechnology Co., Ltd. (Shanghai, China); a total RNA extraction kit was sourced from Tiangen Biochemical Technology Co., Ltd. (Beijing, China); a protein extraction kit and protein quantitation kit were purchased from KeyGEN BioTECH (Nanjing, China); the normal human SV cell line FC-0048 was obtained from Qingyuan Haosheng Biotechnology Co., Ltd. (Beijing, China); an AR antibody was purchased from Proteintech group (Wuhan, China); AQP 8 antibody was purchased from Affinity Biosciences LTD (nanjing, China); Bicalutamide (A5060) purchased from Apexbio (America); all secondary antibodies were acquired from Zhongshan Golden Bridge Biotechnology Co., Ltd. (Beijing, China); and an electrophoresis apparatus, electrotransfer device, and gel imaging system (Bio-Rad, USA) were used.

Animal experiments and ethical considerations

Seventy adult male Sprague‒Dawley rats, aged 6–8 weeks with a body weight of 195-220  g, were purchased from the Xipu’er-Beikai Biotechnology Centre in Xuanwu District, Nanjing City. The licence number for experimental animal production was SCXK (Su) 2020-0009. All animals were maintained under SPF conditions (23 ± 2 °C, 50 ± 10% humidity, 12 h light‒dark cycle), with unrestricted access to rat feed and water. The animals were randomly divided into 2 groups (10 rats each), with the T1DM model established via the intraperitoneal injection of 55 mg/kg streptozotocin (STZ) and the control rats receiving 6 ml/kg saline. Rat blood glucose levels were randomly measured. Blood glucose levels were measured via the tail-prick method with test strips and a monitor (Accuchek Advantage II; Roche, Mannheim, Germany), and levels above 16.7 mmol/L were considered indicative of T1DM ⁸. One month after model establishment, high-frequency ultrasound was used to measure the longitudinal, anterior-posterior and wide Diameter(ld,apd,wd) of the SVs in both groups. Before specimen collection, the rats were fasted for 12 h and then anaesthetised via an intraperitoneal injection of pentobarbital sodium (50 mg/kg). The pelvis was dissected, the vas deferens was ligated with 4–0 silk thread, and the SVs were completely removed after excising the surrounding fat and blood vessels. A ruler was used to measure the longitudinal, anteroposterior, and transverse diameters of the SVs. The weights of the SVs, the expelled seminal fluid, and the weights of the SVs after fluid expulsion were measured. More rats were then maintained and divided randomly into a control group (n = 10) and two groups of diabetic rats, with 10 rats each: a T1DM group and a CUR group (curcumin 150 mg/kg/d); CUR was dissolved in olive oil for feeding¹³, and the rats in the T1DM and control groups received the same volumes of olive oil. One month later, high-frequency ultrasound was again used to measure the dimensions of the SVs in all three groups. Before specimen collection, the rats were fasted for 12 h and anaesthetised, and the SVs were removed as previously described. The dimensions and weights of the SVs and expelled fluid were measured to assess the secretory function of the SVs for subsequent experiments.

All experimental procedures were conducted in strict compliance with pertinent guidelines and regulations. Additionally, this study adhered to the ARRIVE guidelines (https://arriveguidelines.org/), which are essential for reporting animal experiments. The Ethics Committee of Anhui Medical University reviewed and approved the study, granting Ethics approval code No. LLSC 20,240,536.

Cell culture and grouping

The normal human SV cell line FC-0048 (LIFE-LINE) was acquired from Beijing Qingyuan Haosheng Biotechnology Co., Ltd. The cell line was cultured with a ProstaLife™ Medium Complete Kit at 37 °C and treated with CUR at concentrations of 5 µM, 10 µM, 20 µM, and 50 µM for 48 h. The fructose content in the seminal vesicle cell culture medium was determined via a colorimetric method, in which fructose and indole produce coloured compounds under strongly acidic and heating conditions. These coloured compounds exhibit a maximum absorption peak at 470 nm, and their absorbance is directly proportional to the fructose content. The cells were then collected for assessment of relevant indicators.

PCR, immunohistochemistry, and Western blot analysis of AR and AQP8 protein expression in SV tissues and cells

Real-time fluorescence quantitative PCR to determine the mRNA expression of AR and AQP8 in each group

Extract the total RNA from the seminal vesicle tissues and cells of each group according to the instructions of the RNA extraction kit. Design primers for AR and AQP8 based on sequences obtained from the GenBank database. The primers are shown in Tables 1 and 2. PCR amplification protocol: Use GAPDH as an internal control, and calculate the relative amount of target gene in the same system using the 2 -∆∆Ct method. GAPDH is used as the reference gene, and the primers are shown in Table 1. All experiments were repeated three times.

Table 1.

Human PCR primer sequences.

Primer	Genbank ID	Sequence (5’-3’)	TM(℃)
AR	NM_000044	forward:5’- GAGGCGTTGGAGCATCTGAGTC − 3’ reverse:5’- CGCTGTCGTCTAGCAGAGAACC − 3’	60.5
AQP8	NM_001169	forward:5’- TGGCGAGTGTCCTGGTACGAA − 3’ reverse:5’- CGACAGGCACCCGATGAAGATG − 3’	62.4
GAPDH	NM_001256799	forward:5’- AGATCATCAGCAATGCCTCCT − 3’ reverse:5’- TGAGTCCTTCCACGATACCAA − 3’	61.8

Table 2.

Rat PCR primer sequences.

Primer	Genbank ID	Sequence (5’-3’)	TM(℃)
AR	NM_013476	forward:5’- TCCAAGACCTATCGAGGAGCG − 3’ reverse:5’- GTGGGCTTGAGGAGAACCAT − 3’	61.2
AQP8	NM_007474	forward:5’- ACACCAATGTGTAGTATGGACCT − 3’ reverse:5’- TGACCGATAGACATCCGATGAAG − 3’	61.0
GAPDH	NM_008084	forward:5’-TGAGTATGTCGTGGAGTCTA − 3’ reverse:5’- CTTGAGGGAGTTGTCATATT − 3’	62.6

Western blotting to determine AR and AQP8 protein expression in SV tissues and cells

Total protein from each group of SV cells was extracted according to the instructions of the total protein extraction kit. After adding sample buffer, the samples were boiled and denatured for 5 min. Thirty micrograms of total protein from each group was subjected to SDS‒PAGE at 80 V, followed by transfer to a PVDF membrane. The membrane was blocked with 5% nonfat milk for 2 h and incubated overnight at 4 °C with AR and AQP8 antibodies diluted 1:1000, followed by incubation with secondary antibodies diluted 1:5000 at room temperature for 2 h. After washing three times with PBST for 10 min each, the membrane was scanned via a gel imaging analysis system. The ratio of the grayscale values of the AR and AQP8 bands to that of the GAPDH band was calculated for semiquantitative analysis.

Immunohistochemistry staining

Immunohistochemical staining was used to determine the protein expression of AR and AQP8 in the SV tissues of each group. SV sections were incubated with primary antibodies against AR and AQP8 (diluted 1:100) at 37 °C for 2 h. This was followed by incubation with anti-rabbit IgG (diluted 1:500). The cell nuclei were stained with DAPI, and the images were observed under a fluorescence microscope (BX 50; Olympus Microsystems, Tokyo, Japan). Use ImageJ to separately open the microscope images stained for AR and AQP8, convert the images to single channels (Image-Color-Split Channels); adjust the corresponding thresholds and set measurement parameters, then perform semi-quantitative analysis by calculating the average fluorescence intensity of AR and AQP8 in three groups of rat seminal vesicle tissues.

Statistical analysis

The data obtained are presented as the means ± standard deviations (means ± S.D.s). The comparison of means between groups was conducted via one-way ANOVA. Pearson analysis was used for correlation analysis, and a t test was used to compare two independent samples. The predictive ability was assessed via receiver operating characteristic (ROC) curves. GraphPad was used for statistical analysis and graphing. Differences were considered significant at P < 0.05 or P < 0.01.

Results

Blood glucose levels and body weights of rats with T1DM

In this study, a T1DM rat model was established through a single intraperitoneal injection of STZ. After one month of consuming a regular diet, the fasting blood glucose levels and body weights of the rats were collected. Compared with those in the control group, the fasting blood glucose levels in the T1DM group were significantly greater, and the body weights were lower (Fig. 1A-B).

Fig. 1.

Changes in blood glucose levels and body weights between the diabetic and control groups (n = 10 rats per group). (A) Compared with those in the control group, fasting blood glucose levels were increased in the T1DM group. (B) Compared with those in the control group, body weights were decreased in the T1DM group. The data are presented as the means ± SDs; **P < 0.01 indicates a significant difference compared with the control group.

Application of High-Frequency Ultrasound in Seminal Vesicle Volume and Secretory Function of Diabetic Rats

The SV volume data for each group of rats were collected via ultrasonography, followed by dissection to remove and measure the weight and volume of the SVs. Compared with those in the control group, the SV volumes and weights in the T1DM group were lower (Fig. 2A-F). High-frequency ultrasound was used to measure the SV dimensions in both groups, and these values were then correlated with the actual measurements via Pearson correlation analysis. The results revealed a positive correlation between the high-frequency ultrasound measurements of ld, apd and wd and the actual measurements, with the length diameter (ld) showing the highest correlation (Fig. 2G-I).  2J-L). Pearson correlation analysis of the high-frequency ultrasound measurements of ld, pbd, and wd with the weights of the expelled seminal fluid revealed a close correlation (Fig. 2J-L), indicating the value of high-frequency ultrasound in diagnosing SV weight and seminal fluid content.

Fig. 2.

Application of High-Frequency Ultrasound in Seminal Vesicle Volume and Secretory Function of Diabetic Rats (A–F) Compared with those in the control group, both the actual and ultrasonography measurements of SV ld, apd and wd in the T1DM group were decreased. (G–I) Actual measurements were positively correlated with ultrasonography measurements of ld, apd, and wd. (J‒L) Ultrasound measurements of the three dimensions of the seminal vesicles show a significant positive correlation with seminal vesicle fluid volume. The data are presented as the means ± SDs; *P < 0.05 indicates a significant difference compared with the control group. In correlation studies, P＜0.05 indicates significant correlation, and r represents the correlation coefficient, with positive values indicating a positive correlation.

Establishing a reference range for decreased seminal fluid volumes in rats and predictive ROC curves for high-frequency ultrasound measurements

To determine the normal range of seminal fluid volumes in rats, we collected SV tissues post euthanasia and squeezed out the seminal fluid for statistical analysis. We established a calculation standard for normal seminal fluid (seminal fluid/SV) and defined the reference range for seminal fluid volumes. Based on this established range, we obtained high-frequency ultrasound data for SV ld, apd and wd for both the normal group and the decreased seminal fluid group (Fig. 3A‒C). Independent t tests revealed significant differences in all three dimensions between the two groups. Furthermore, to evaluate the predictive ability of high-frequency ultrasound measurements for seminal secretion, we plotted the ROC curve for the three dimensions. We found that all three ultrasound measurements could predict seminal secretion capacity, and the ld had the best predictive ability (Fig. 3D). On the basis of these results, we established a model of seminal secretion dysfunction in diabetic rats, providing an important reference for subsequent research.

Fig. 3.

Construct the ROC curve for predicting seminal vesicle secretory function based on ultrasound measurements of three diameters (ld, apd, wd). (A-C) Comparison of SV ld, pbd, and wd between the normal group and the reduced seminal fluid group. (D) ROC curve for predicting the weight of expelled seminal fluid in three dimensions, with the ld showing the best predictive ability.

Curcumin administration increases SV volume, SV fluid content and alleviate SV tissue damage in diabetic rats

More rats were cultivated and dissected to extract their SVs, and weights and volumes were measured. Compared with the control group, the T1DM group presented a reduced SV volume and secretion. Treatment with CUR improved this condition, and statistically significant differences were observed between the CUR and T1DM groups (Fig. 4A-B). By measuring the SV ld, pbd, and wd of each group via actual and ultrasonic methods, a reduction in SV volume was noted in the T1DM group compared with the control group, which was ameliorated following CUR treatment (Fig. 4C-H). HE staining of the collected SV tissues revealed that, compared with the control group, the T1DM group presented a disorganised SV cell structure, hyperchromatic nuclei, and reduced epithelial cell height, whereas the CUR group presented a notable improvement in the cellular tissue structure compared with the T1DM group (Fig. 4I,J). The ratios of seminal fluid weight to SV weight and the water content in the SV were significantly greater in the CUR group than in the T1DM group (Fig. 4K,L).

Fig. 4.

Effects of CUR administration on SV volume and seminal fluid content in diabetic rats. (A) Ultrasonic measurement of SV volume in three groups of rats; (B) Measurement of SV weight changes in three groups, with the diabetic group showing reduced SV weight compared with the control group and an increase in the CUR group; (C–E) Actual measurements of SV ld, pbd, and wd values for each group, showing a decrease in the diabetic group and an increase in the CUR group compared with the control group; (F-H) Ultrasonic measurements of SV ld, pbd, and wd values, indicating a decrease in the diabetic group and an increase in the CUR group compared with the control group; (I, J) HE staining of SV tissue structures in three groups, showing disorganisation and reduced epithelial height in the diabetic group compared with the control group, and a restoration of cell structure and increased epithelial height in the CUR group; (K, L) Measurement of the ratio of seminal fluid to SV weight and the proportion of water content in SVs, showing a decrease in the diabetic group and an increase in the CUR group compared with the control group. The data are presented as the means ± SDs; **P < 0.01 indicates a significant difference compared with the control group. #P < 0.05 indicates a significant difference compared with the diabetic group.

Curcumin administration enhances fructose levels in SV cells

SV cells were cultured and treated with CUR at concentrations of 5 µM, 10 µM, 20 µM, or 50 µM for 24 h. The fructose content in the SV cell culture medium was measured via colorimetry. The fructose levels in the SV cells of the hyperglucose (HG) group was lower than that in the control group, whereas CUR treatment increased the fructose level. 20 µM CUR was chosen as the dose for subsequent experiments (Fig. 5).

Fig. 5.

Colorimetric detection of the fructose content in SV cell culture medium. Compared with that in the control group, the fructose abundance level in the HG group was lower, whereas it increased after the addition of CUR. The data are presented as the means ± SDs; *P <0.05 indicates a significant difference compared with the HG group.

Curcumin administration promotes AR expression in SV tissues and cells

The AR expression levels in SV tissues and cells were determined via qRT‒PCR; immunohistochemistry was used to determine AR protein expression in rat SV tissues. The results revealed that the AR mRNA expression levels in the TIDM and HG groups were lower than those in the control group. One month after CUR administration, the AR mRNA expression levels were greater in the CUR group than in the TIDM and HG groups (Fig. 6A-B). Immunohistochemical determination of AR protein expression in rat SV tissues revealed an increase in the CUR group compared with the T1DM group (Fig. 6C-D).

Fig. 6.

Effects of curcumin administration on AR expression in the SVs of diabetic rats and human SV cells. (A, B) PCR determination of changes in AR mRNA expression levels in rats tissues and human SV cells. (C, D) Immunohistochemical staining to determine AR protein expression levels in rat SV tissues (50 μm). The data are presented as the means ± SDs; *P < 0.05 indicates a significant difference compared with the control group. #P < 0.05 and ##P < 0.01 indicate significant differences compared with the TIDM and HG groups.

Curcumin administration promotes AQP8 expression in SV tissues and cells

We used PCR to determine changes in AQP8 protein expression in SV tissues and cells. Compared with those in the control group, the mRNA expression levels of AQP8 in the T1DM and HG groups were lower, indicating that the AQP8 expression levels in rats and human SV cells were lower. One month after CUR treatment, the AQP8 expression level increased (Fig. 7A-B). Additionally, immunohistochemical determination of AQP8 expression in SV tissues revealed that AQP8 protein expression in the CUR group was greater than that in the T1DM group (Fig. 7C-D), suggesting that CUR administration enhances AQP8 expression in SV cells.

Fig. 7.

The impact of curcumin administration on AQP8 expression in the SVs of diabetic rats and human SV cells. (A, B) PCR determination of changes in AQP8 mRNA expression levels in rats tissues and human SV cells. (C, D) Immunohistochemical staining was used to determine the protein expression levels of AQP8 in rat SV epithelial cells. The images show AQP8 expression in the cytoplasms and plasma membranes of the epithelial cells in SV tissues. The data are presented as the means ± SDs; *P < 0.05 indicates a significant difference compared with the control group. #P < 0.05 indicates a significant difference compared with the TIDM and HG groups.

Changes in AR and AQP8 expression after the addition of an AR inhibitor in vitro

After the addition of an AR inhibitor (bicalutamide, 10 μm), PCR was used to determine changes in AR mRNA expression levels in SV cells (Fig. 8A), and Western blotting was used to assess AR and AQP8 protein expression. Compared with those in the CUR group, the AR and AQP8 protein expression levels in the CUR-ARi group were lower (Fig. 8B-D), suggesting that the AQP8 expression levels in human SV cells may be inhibited through the AR pathway.

Fig. 8.

Effects of an AR inhibitor on AR and AQP8 expression. (A) AR expression levels were lower in the ARi group than in the CUR group – (B-D) Compared with those in the control group, the expression levels of AR and AQP8 in the HG group were lower, and in the CUR-ARi group, the protein expression levels of AR and AQP8 were lower than those in the CUR group. The data are presented as the means ± SDs; *P < 0.05 indicates a significant difference compared with the control group. #P < 0.05 indicates a significant difference compared with the diabetic group, and $P < 0.05 indicates a significant difference compared with the CUR-20 µM group.

Discussion

Diabetes mellitus (DM) is a metabolic disease characterised primarily by elevated blood glucose levels, and its incidence and prevalence have been increasing in recent years. Diabetic complications represent severe health issues, including macrovascular and microvascular diseases, neuropathy, male sub/infertility, and erectile dysfunction¹⁴; notably, the incidence of erectile dysfunction in diabetic men is approximately 3.5 times greater than that in nondiabetic men¹⁵. Studies have shown that diabetes can disturb spermatogenesis and steroidogenesis, suppress secretion by male accessory glands (including SVs), and thus affect male reproductive function. Research by Sawatpanich T et al.¹⁶ revealed that extracts from Dolichandrone serrulata flowers could increase testosterone levels and decrease caspase-3 protein expression levels, thereby increasing the secretion of seminal fluid, suggesting that diabetes is one of the causes of SV tissue dysfunction. Yannasithinon S reported that the levels of phosphorylated proteins in the seminal fluids of diabetic mice might be related to the quality of the semen¹⁷. Hyperglycaemia caused by diabetes increases oxidative stress, which can lead to impaired male reproductive function. Therefore, diabetes can lead to SV damage, which in turn can cause male reproductive disorders. Preventing and treating SV damage could reduce the progression of diabetic reproductive complications.

The SV is a pair of ovoid extraperitoneal convoluted tubular structures along the male reproductive tract¹⁸. Located at the base of the prostate, adjacent to the base of the bladder, rectum, and vas deferens, the average length of an adult SV is approximately 5 cm, its width is approximately 1.2 cm, and its volume is 3 cm³¹⁹. The SVs, as significant accessory glands, produce a milky white fluid, seminal fluid, during ejaculation, which is alkaline and rich in fructose, vitamin C, and other enzymes, and serves as an energy source and nutrition for sperm. Additionally, semen comprises various metabolites, including calcium (Ca), phosphorus (P), fructosamine (FRA), magnesium (MG), aspartate aminotransferase (GOT), alanine aminotransferase (GPT), and alkaline phosphatase (ALP), which are vital for sperm motility, viability, and the acrosome reaction^20,21. This study revealed that SV tissue volume and seminal fluid secretion levels are reduced in DM rats, which is consistent with previous findings. However, the pathways through which T1DM causes SV damage are not well understood.

Curcumin (CUR) possesses antioxidant, anti-inflammatory, and antidiabetic properties and has been shown to delay the progression of T1DM, improve β-cell function, prevent β-cell death, and reduce insulin resistance in animals^22,23. Curcumin can affect the secretory function of SVs by regulating the expression levels of oestrogen receptor-α, histamine receptors, and androgen receptors (ARs)²⁴. In a randomised, double-blinded, controlled trial, Chuengsamarn S²⁵ reported that, compared with placebo, oral supplementation with curcumin extract for nine months significantly improved blood glucose levels and reduced insulin resistance in patients with type 2 diabetes, indicating the crucial role of curcumin in treating and preventing the progression of diabetes. Research by Rahimnia AR²⁶ revealed that curcumin administration could reduce HbA1c and fasting blood glucose levels in diabetic subjects, as well as lower LDL cholesterol levels and body mass indices, suggesting that CUR may delay the progression of T1DM by protecting β-cell function, reducing β-cell apoptosis, and decreasing insulin resistance. In a study by Maithilikarpagaselvi regarding male Wistar rats fed a high-fructose diet, curcumin was found to alleviate insulin resistance by reducing IRS-1 serine phosphorylation and increasing IRS-1 tyrosine phosphorylation in the skeletal muscles of the rats. It also reduces hyperinsulinaemia, glucose intolerance, and oxidative stress levels²⁷. Therefore, when curcumin was administered to T1DM rats, we observed an increase in SV volume and seminal fluid secretion in the CUR group compared with the T1DM group, with HE staining indicating regular SV tissue structures and increased epithelial cell height, suggesting that curcumin can reduce SV damage and promote seminal secretion in T1DM rats. In vitro, the addition of curcumin increased fructose secretion in SV cells, suggesting that curcumin can enhance the secretory function of SVs.

The AR is a member of the steroid hormone receptor family and regulates male physiological functions by binding to its steroid ligands: dehydroepiandrosterone (DHEA), testosterone, and dihydrotestosterone²⁸. In the presence of androgens, AR migrates to the nuclei in prostate cells, binds to androgen response elements (AREs) in the promoter regions of target genes, and controls their expression²⁹. AR is a key driver in the pathophysiology of prostate cancer, regulating proliferation, migration, and metabolism, and is an effective therapeutic target. Testosterone, which is mediated by the AR, has a well-documented effect on male visceral obesity and insulin resistance (IR), with low testosterone levels promoting insulin resistance and increasing diabetes risk³⁰. ARs play a significant role in regulating obesity, insulin resistance, and type 2 diabetes³¹. Studies have shown that men with DM have lower levels of total testosterone and sex hormone-binding globulin than healthy controls do. Through the determination of AR expression in SV tissue, we found that AR expression was lower in the T1DM group than in the control group, while AR expression levels in the SV tissues of rats fed curcumin for one month were increased, which was corroborated at the cellular level, suggesting that curcumin administration might improve SV volume and seminal fluid secretion in diabetic rats by promoting AR expression.

Aquaporins (AQPs) are a family of transmembrane proteins expressed in most organisms. To date, 13 homologues named AQP0-12 have been identified in mammals, each possessing distinct permeability characteristics and specific tissue, cellular, and subcellular localisations³². Based on their selective permeability and primary structure, this protein family is divided into three subgroups: classic aquaporins (AQP0, 1, 2, 4, 5, 6, and 8), which are considered primarily selective for water; aquaglyceroporins (AQP3, 7, 9, and 10), which can also transport small uncharged solutes such as glycerol and urea owing to their larger pore size; and nonclassic aquaporins (AQP11 and 12), whose pore selectivity and functions are still under investigation. However, recent studies have also shown that AQP8 can transport urea and ammonia. AQPs are involved in numerous biological functions, including cell proliferation, adipocyte metabolism, cell migration, epidermal water retention, and neuronal excitability³⁵. In their study on diabetic cardiomyopathy, Eltobshy SAG et al.^33,34]]36 reported that feeding diabetic rats empagliflozin reduced the protein expression of AQP-1-3 and AQP-4 in the heart and decreased the level of cell apoptosis. Fan Y et al.³⁷ reported that oestrogen promotes an increase in AQP5 expression in prostate cells and leads to prostate cell proliferation. Research by Yazdani Z³⁸ revealed that curcumin could block the aquaporin-1 (AQP-1) channel in melanoma cells, reducing their oxidative stress levels. AQPs are reported to be expressed in the testes, epididymis, vas deferens, and SVs³⁹. AQP8 was initially described as highly expressed in the testes and liver and was later reported to be expressed in neural tissues as well⁴⁰. Studies on diabetic rats by Cui et al. revealed that AQP8 expression levels in submandibular gland tissue decreased, whereas insulin treatment significantly upregulated AQP8 expression. The reduction in AQP8 expression may be related to decreased secretion in the submandibular glands of diabetic rats, leading to increased thirst and water intake in these rats. Krüger C et al.⁴¹ also reported that knocking down AQP8 expression can lead to pancreatic β-cell death, whereas the overexpression of AQP8 promotes β-cell proliferation and increases insulin content. These findings suggest that AQP8 plays a crucial role in the treatment of diabetes. We hypothesise that AQP8 may regulate SV cell secretion function by modulating cellular water transport, thereby improving diabetic rat SV cell function. By evaluating the expression of AQP8 in T1DM rat SV tissue and in vitro cultured SV cells, our results revealed decreased expression of AQP8 in T1DM rat SV tissue and in high-glucose conditions, with increased expression observed upon curcumin supplementation. These findings indicate that curcumin administration improves SV tissue secretion function by promoting AQP8 expression. Additionally, adding an AR inhibitor to SV cells reduces AQP8 expression, suggesting that AR may be involved in the curcumin-mediated regulation of AQP8 expression and thus contribute to diabetic rat SV damage.

Our investigations demonstrated that curcumin treatment significantly increased the volumes of SV tissues and the levels of seminal fluid in diabetic rats. At the cellular level, curcumin promoted AR expression, thereby regulating AQP8 expression, improving SV damage, and enhancing seminal fluid secretion. These findings provide a novel therapeutic approach and a theoretical basis for the prevention and treatment of reproductive function disorders in male diabetic patients.

Conclusion

In summary, curcumin administration may improve the structural and functional damage to SVs in T1DM patients by activating the AR-AQP8 pathway, thereby increasing SV volume and seminal fluid secretion. These findings provide a crucial reference for future therapeutic strategies aimed at reducing SV damage and enhancing male fertility in male T1DM patients.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

D.N.: Conceptualized and designed the study, conducted the in vivo and experiments, analyzed the data and Wrote a paper.K.L.: Carried out the in vitro experiments and performed detailed data analysis.N.W., B.Y.,B.Y.: Assisted in executing experimental procedures and contributed to data analysis.Y.D. and W.W.: Provided valuable insights in result interpretation and offered critical intellectual support.All authors: Collaboratively participated in writing and revising the manuscript.

Funding

This study was funded by the Traditional Chinese Medicine Research Project of the Anhui Provincial Association of Traditional Chinese Medicine (Project Approval Number: 2024ZYYXH165).

Data availability

Data is provided within the manuscript or supplementary information files.

Declarations

Competing interests

The authors declare no competing interests.