Skip to main content
NCBI home page
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2023 Feb 22;149(10):6883–6899. doi: 10.1007/s00432-023-04624-2

Inhibition of Polo-like kinase 1 (PLK1) triggers cell apoptosis via ROS-caused mitochondrial dysfunction in colorectal carcinoma

Ya Feng 1, Tianjiao Li 1, Zhoujun Lin 1, Yin Li 1, Xiao Han 1, Xiaolin Pei 1, Zhenkun Fu 1,2, Qiao Wu 3, Di Shao 4,✉, Chenggang Li 1,✉
PMCID: PMC11797568  PMID: 36810816

Abstract

Background

Colorectal cancer (CRC) is one of the most frequently diagnosed cancers. Polo-like kinase 1 (PLK1), a member of the serine/threonine kinase PLK family, is the most investigated and essential in the regulation of cell cycle progression, including chromosome segregation, centrosome maturation and cytokinesis. However, the nonmitotic role of PLK1 in CRC is poorly understood. In this study, we explored the tumorigenic effects of PLK1 and its potential as a therapeutic target in CRC.

Methods

GEPIA database and immunohistochemistry analysis were performed to evaluate the abnormal expression of PLK1 in CRC patients. MTT assay, colony formation and transwell assay were performed to assess cell viability, colony formation ability and migration ability after inhibiting PLK1 by RNAi or the small molecule inhibitor BI6727. Cell apoptosis, mitochondrial membrane potential (MMP) and ROS levels were evaluated by flow cytometry. Bioluminescence imaging was performed to evaluate the impact of PLK1 on CRC cell survival in a preclinical model. Finally, xenograft tumor model was established to study the effect of PLK1 inhibition on tumor growth.

Results

First, immunohistochemistry analysis revealed the significant accumulation of PLK1 in patient-derived CRC tissues compared with adjacent healthy tissues. Furthermore, PLK1 inhibition genetically or pharmacologically significantly reduced cell viability, migration and colony formation, and triggered apoptosis of CRC cells. Additionally, we found that PLK1 inhibition elevated cellular reactive oxygen species (ROS) accumulation and decreased the Bcl2/Bax ratio, which led to mitochondrial dysfunction and the release of Cytochrome c, a key process in initiating cell apoptosis.

Conclusion

These data provide new insights into the pathogenesis of CRC and support the potential value of PLK1 as an appealing target for CRC treatment. Overall, the underlying mechanism of inhibiting PLK1-induced apoptosis indicates that the PLK1 inhibitor BI6727 may be a novel potential therapeutic strategy in the treatment of CRC.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00432-023-04624-2.

Keywords: Colorectal cancer, PLK1, BI6727, Bcl2, Mitochondrial dysfunction, Apoptosis

Introduction

Colorectal cancer (CRC) is one of the most common malignancies with a high mortality rate in the world (Liu et al. 2017a). Because of the absence of specific and distinct symptoms, most CRC patients are diagnosed in the advanced unresectable stage, accompanied by poor prognosis. To date, the complex molecular mechanisms of CRC pathogenesis are only partially known, which hinders the treatment of CRC. Consequently, understanding the underlying molecular mechanisms of CRC occurrence and development is of great significance for the identification of new therapeutic targets and prognosis of CRC.

Polo-like kinases (PLKs) are a family of five highly conserved serine/threonine protein kinases that are involved in the regulation of cell cycle progression and DNA damage response (Weerdt and Medema 2006). Polo-like kinase 1 (PLK1), a member of the PLK families, is characterized by an N-terminal serine/threonine kinase domain (KD) and a C-terminal polo-box domain (PBD), which mediates substrate recognition and specific subcellular localization, and regulates kinase activity (Carcer et al. 2011; Jang et al. 2002). The functions of PLK1 are traditionally linked to the regulation of the cell cycle and stress response. In recent years, more functions of PLK1 have been proposed than just their traditional roles in various aspects of mitosis (Raab et al. 2021). Increasing evidences have demonstrated that PLK1 contributes to the regulation of DNA replication (Yim and Erikson 2009), mTOR signaling and autophagy, apoptosis (Ruf et al. 2017), and the epithelial-to-mesenchymal transition (Fu and Wen 2017). The new roles of PLK1 broaden the therapeutic potential of targeting PLK1.

Mitochondrial apoptosis is the most commonly deregulated form of cell death and plays a key role in cancer development (Yu et al. 2017). Different apoptotic stimuli, such as mitochondrial DNA damage and reactive oxygen and nitrogen species, generally result in mitochondrial outer membrane permeabilization, which is regulated largely by members of the Bcl2 family (Circu and Aw 2008; Lopez and Tait 2015). Subsequently, the release of several proapoptotic factors from the mitochondrial intermembrane into the cytosol follows, notably Cytochrome c and Smac/Omi, leading to caspase activation and cell death through the parallel cleavage of hundreds of different substrates (Li et al. 2016).

Numerous studies have shown that PLK1 is overexpressed and involved in the regulation of tumor occurrence and malignant biological behavior of various cancers including colorectal cancer (Klauck et al. 2018), melanoma (Chen and Villanueva 2015), prostate cancer (Liu et al. 2011), non-small cell lung cancer (Li et al. 2017), and breast cancer (Weichert et al. 2005). Upregulated PLK1 signaling is accompanied by deregulation of cell cycle-related pathways and poor prognosis in CRC patients, indicating its potential as an attractive target in CRC treatment (Yu et al. 2021). However, the non-mitosis role of PLK1 in CRC largely remains unclear. In particular, little is known about the function of PLK1 in the regulation of mitochondrial apoptosis.

In this study, we explored the relationship between PLK1 overexpression and tumor biological behavior in CRC. In addition, we explored the underlying mechanism of PLK1 inhibition-induced apoptosis. Our data suggested that PLK1 inhibition significantly reduced cell viability, migration, and colony formation ability and induced apoptosis of CRC cells, which was triggered by ROS-mediated mitochondrial dysfunction. These data provide new insights into the pathogenesis of CRC and support the potential value of PLK1 as an appealing target for CRC treatment.

Materials and methods

Cell lines and culture

Both normal colon (FHC) and colon cancer (HCT116 and DLD-1) cell lines were purchased from ATCC. FHC and HCT116 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% FBS and 1% penicillin/streptomycin. DLD-1 cells were cultured in RPMI 1640 medium-containing 10% FBS and 1% penicillin/streptomycin. All cultures were maintained at 37 °C with a 5% CO2 atmosphere in a humidified incubator.

Gene expression profiling interactive analysis (GEPIA)

The online database GEPIA (http://gepia.cancer-pku.cn/index.html) was used to analyze the differential expression of PLK1 in CRC tumor and normal tissue datasets. GEPIA is a newly developed interactive web server for analyzing the RNA sequencing expression data of 9,736 tumor and 8,587 normal samples from the TCGA and GTEx projects (Li et al. 2020). Survival curves, including OS and DFS, were obtained based on gene expression with the log-rank test and the Mantel–Cox test via the GEPIA database.

Gene expression profiling interactive analysis (UALCAN)

UALCAN (http://ualcan.path.uab.edu/analysis.html), a comprehensive web resource, provides analyses based on RNA sequence and clinical data relative to 31 cancer types from The Cancer Genome Atlas (TCGA) and Clinical Proteomic Tumor Analysis Consortium (CPTAC) databases (Chandrashekar et al. 2017). The correlation between PLK1 mRNA expression and CRC TNM stages was evaluated using the UALCAN database.

Lentivirus production and transfection

The lentiviral control or PLK1 shRNA plasmid was transfected into HEK293T cells to produce lentiviral particles. Then, HCT116 and DLD-1 cell lines were established with stable knockdown of PLK1 or its scrambled controls. Single colonies were obtained after 2 weeks of selection with 1 μg/mL puromycin. The negative control siRNA and PLK1 siRNA were transiently transfected into HCT116 or DLD-1 cells using Lipofectamine 2000 transfection reagent (Invitrogen, USA) according to the manufacturer's instructions.

Western blot analysis

Total protein was extracted using RIPA lysis buffer, and equal amounts of protein were separated by SDS-PAGE (6–15%) and transferred onto polyvinylidene fluoride (PVDF) membranes, which were blocked with 3% bovine serum albumin (BSA) for 60 min. The membranes were incubated with specific primary antibodies overnight at 4 °C. Specific primary antibodies against PLK1 (#4513) and Ki67 (ab16667) were purchased from Cell Signaling Technology. Antibodies against COX4 (sc-376731), Bcl2 (sc-7382), and Bax (sc-7480) were obtained from Santa Cruz Biotechnology. Antibody against Cytochrome c (AF0146) was obtained from Affinity. The protein levels were normalized to β-actin (EASYBIO).

RNA extraction and RT-qPCR

Total RNA was extracted with TRIzol reagent (Ambion, Lot No. 317110). Two micrograms of RNA was used for reverse transcription to cDNA by reverse transcriptase (YEASEN, catalog No. 11141ES60) following the manufacturer’s instructions. cDNA (500 ng) was used for RT-qPCR with SuperReal PreMix Plus (SYBR Green) reagent (TIANGEN, catalog No. #FP205-02). The reaction parameters were as follows: 95 °C for 15 min, followed by 45 cycles of amplification with three steps: denaturation at 95 °C for 10 s, annealing at 55 °C for 20 s, and extension at 72 °C for 30 s. The primer sequences were as follows:

human β-actin forward CACCATTGGCAATGAGCGGTTC;

human β-actin reverse AGGTCTTTGCGGATGTCCACGT;

human PLK1 forward CACCAGCACGTCGTAGGATTC;

human PLK1 reverse CCGTAGGTAGTATCGGGCCTC.

Cell viability assay

HCT116 or DLD-1 cells were seeded into 96-well plates at a density of 4 × 103 cells/well. After 24 h, cells were treated with the indicated doses of BI6727 (Selleck, S2235) or transiently transfected with PLK1 siRNA. Cell viability was determined by MTT or CCK-8 assay.

Colony formation assay

The effect of PLK1 on the colony formation ability of CRC cells was evaluated by the colony numbers. HCT116 or DLD-1 cells were seeded into 6-well plates at a density of 2–3 × 103 cells/well for 24 h. Then, the cells were treated with the indicated doses of BI6727 for 48 h. After that, the medium was replaced with fresh medium-containing 2% FBS, and the cells were cultured for 14 days with media changes every third day. Treated cells were washed with PBS, fixed with 10% formalin for 10 min and stained with 0.05% crystal violet for 30 min.

Cell migration assay

The bottom chambers were filled with fresh medium-containing 10% FBS. Then, 5–8 × 104 cells/well were seeded into the upper chambers in serum-free medium with or without BI6727. After incubation at 37 °C for 48 h, the cells on the lower surface of the membrane were washed with PBS, fixed with 10% formalin for 10 min and stained with 0.05% crystal violet for 30 min.

Cell apoptosis assay

Apoptosis assays were carried out with an Annexin V-APC/7-AAD apoptosis detection kit (MultiSciences, catalog 70-AP105-100) or Annexin V–FITC/PI apoptosis detection kit (MultiSciences, catalog 70-AP101-100) according to the manufacturer’s protocol. After BI6727 treatment or PLK1 knockdown, HCT116 or DLD-1 cells were collected and resuspended in binding buffer. Sequentially, the cells were labeled and analyzed by flow cytometry (BD LSRFortessa). Apoptosis was quantified as the Annexin V-positive cell numbers.

Intracellular ROS detection

Intracellular ROS production was evaluated using an ROS assay kit (Solarbio, CA1410). Treated HCT116 or DLD-1 cells were collected and co-incubated with DCFH-DA for 30 min at 37 °C. After washing twice with PBS, the cells were immediately quantitated by flow cytometry at an emission wavelength of 525 nm and an excitation wavelength of 488 nm.

Detection of mitochondrial membrane potential (MMP)

The mitochondrial membrane potential (MMP) was determined by the mitochondrial staining kit (JC-1, MultiSciences Biotech, catalog 70-MJ101). HCT116 cells were treated with BI6727 for 24 h or transiently transfected with PLK1 siRNA for 48 h, and then, JC-1 was loaded for 20 min. The emissions at 530 nm and 590 nm were analyzed by flow cytometry (BD LSRFortessa) using an excitation wavelength of 488 nm. The ratio of mean fluorescence intensity (JC-1 aggregates/monomer) was calculated to define MMP levels.

Mitochondrial isolation

Following BI6727 treatment or PLK1 siRNA transfection, HCT116 or DLD-1 cells were collected, and mitochondria were isolated using the Cell Mitochondria Isolation Kit (Beyotime). The efficiency of mitochondrial and cytoplasmic fractionation was confirmed by Western blot analysis against the mitochondrial protein COX4. The levels of Bax and Cytochrome c in the mitochondria and cytoplasm were examined by Western blot analysis.

Immunofluorescence staining

HCT116 cells were plated on the glass coverslips in 24-well cell culture plates overnight with PLK1 knockdown or BI6727 treatment. The cells were fixed with 10% formalin for 10 min, permeabilized with 0.2% Triton X-100 for 10 min, and blocked in 10% goat serum for 1 h. For immunostaining, the cells were incubated with primary antibody overnight at 4 °C and then incubated with secondary antibodies conjugated with Alexa Fluor 488 or Alexa Fluor 594 for 1 h. Images were captured with a confocal laser scanning microscope.

Immunohistochemistry (IHC)

HCT116 xenograft tumor tissues were fixed in 4% paraformaldehyde, embedded in paraffin wax, cut into 5 μm sections, and placed onto glass slides. Next, the expressions of PLK1, Bax, and Ki67 in xenograft tumor tissues were analyzed by IHC.

TUNEL assay

Paraffin-embedded tissues from HCT116 xenograft tumors were cut into 4 μm-thick sections and placed onto glass slides. Apoptotic cells were identified using the TUNEL Assay Apoptosis Detection Kit (FITC) (ABSIN, abs50033) according to the manufacturer's instructions. Representative images were captured with a confocal laser scanning microscope.

Bioluminescence imaging of the intravenous tumor model

The luciferase-labeled HCT116 cells were transiently transfected with small interfering RNA (siRNA) targeting PLK1 or negative control siRNA (siNC). Subsequently, equal numbers of HCT116 cells (5 × 105/100 μl PBS) were injected into BALB/c female mice intravenously. Ten minutes prior to imaging, mice were administered 120 mg/kg D-luciferin (PerkinElmer, catalog 122,799) by intraperitoneal injection. Bioluminescent imaging was captured at the indicated times using the Xenogen IVIS Spectrum System, and the total photon flux of chest regions was quantified.

Xenograft tumor model

Female BALB/c nude mice at 6 to 8 weeks of age were maintained under specific pathogen-free conditions. Equal numbers (3.5 × 106) of HCT116 cells were resuspended in 0.1 mL PBS and then injected subcutaneously into the left and right flanks of mice. When the tumor volumes reached approximately 400 mm3 (volume = length × width2/2), the mice were randomly divided into two groups and treated with BI6727 (10 mg/kg body weight). Tumor volume was monitored every 2 days. After 22 days, tumors were collected. All experiments involving mice were approved by the Animal Care Committee of Nankai University, Tianjin, China.

Statistical analysis

All data are represented as the mean ± SEM. In vitro and vivo studies, statistical analyses were performed using a multiple t test to compare differences among multiple groups. Student’s t test of column analysis was applied to compare differences between two groups. P < 0.05 was considered statistically significant.

Results

Abnormal PLK1 expression was identified in CRC

Overexpression of PLK1 has been demonstrated in a wide range of human malignancies, including ovarian, breast, lung, and colon cancers. In accordance with the previous studies, Gene Expression Profiling Interactive Analysis (GEPIA) (Tang et al. 2017) showed that PLK1 was abnormally expressed in CRC tissues compared with normal tissues (Fig. 1A). Analysis with the UALCAN databases further indicated that the mRNA expression level of PLK1 in colorectal cancer tissues of different TNM stages was higher than that in normal colorectal tissue (Fig. 1B). Moreover, RT-qPCR analysis showed that PLK1 mRNA expression was significantly increased in HCT116 cells compared with the normal colonic epithelial cell line FHC (Fig. 1C). Western blot analysis also demonstrated a consistent trend in which PLK1 protein levels were notably higher in the CRC cell lines than in the FHC cell line (Fig. 1D). In addition, immunohistochemical staining analysis further demonstrated that the expression of PLK1 was higher in CRC patient tissues than in adjacent normal tissues (Fig. 1E). These results indicated that dysfunction of PLK1 signaling pathway might promote tumorigenesis in CRC, and targeting PLK1 signaling could be a potential therapeutic strategy against CRC.

Fig. 1.

Fig. 1

Open in a new tab

Identified abnormal PLK1 accumulation in CRC. A Box plots of PLK1 mRNA levels in 275 CRC samples (red) and 349 normal samples (gray). Database: GEPIA. B Violin plots of PLK1 mRNA expression in different TNM stages by UALCAN database analysis. C Transcription level of PLK1 in two CRC cell lines (HCT116 and DLD-1) and a normal colon epithelial cell line (FHC), determined by RT-qPCR. D Western blot analysis of PLK1 expression in FHC cell line and two CRC cell lines. E H&E staining (upper) and immunohistochemical staining (lower) of PLK1 in tumor tissues and adjacent tissues from colorectal cancer patients and healthy tissues (normal). Upper panel, magnification 200 × , bar = 100 μm; lower panel, magnification 400 × , bar = 50 μm. Representative images of two cases are shown. Student's t test, *P < 0.05, ***P < 0.001

Depletion of PLK1 reduced proliferation and induced apoptotic cell death of CRC cells

To determine the effects of PLK1 on CRC tumor growth, HCT116 and DLD-1 cell lines with stable PLK1 knockdown (shPLK1) or a negative control vector (shNC) were constructed by lentiviral transfection. The knockdown efficiency was evaluated by RT-qPCR and western blot analyses (Fig. 2A and 2B). Colony formation and Transwell assays were performed to assess colony formation ability and migration ability, respectively (Fig. 2C and 2D). Subsequently, HCT116 and DLD-1 cells were transiently transfected with siRNA targeting PLK1 (mixed siPLK1#1 and siPLK1#2) or N.C. Cell apoptosis was assessed using flow cytometry, and cell proliferation was analyzed by the cell counting kit-8 (CCK-8) assay (Fig. 2E and 2F). These results suggested that PLK1 depletion inhibited cell proliferation, colony formation and cell migration, and obviously induced apoptosis of CRC cells compared with the control. To further investigate the impact of PLK1 on CRC cell survival in a preclinical model, luciferase-labeled HCT116 cells were transiently transfected with PLK1 siRNA or control siRNA and then intravenously injected into BALB/c mice. As indicated by bioluminescence intensity, PLK1-depleted cells showed less lung colonization than control siRNA-transfected cells at 6 and 9 h after cell injection (Fig. 2G). These results indicated that depletion of PLK1 impeded tumorigenesis both in vitro and in vivo.

Fig. 2.

Fig. 2

Open in a new tab

Depletion of PLK1 reduced proliferation and induced apoptosis of CRC cells in vitro and in vivo. A, B The knockdown efficiency of PLK1 by specific shRNA in HCT116 and DLD-1 cells was determined by RT-qPCR and Western blot assays, respectively. C Representative images of the colony formation assay and quantification of colony numbers in HCT116 and DLD-1 cells transfected with control or PLK1 shRNA. D Cell migration was analyzed in HCT116 and DLD-1 cells transfected with control or PLK1 shRNA through Transwell assays without Matrigel, and the extent of migration was quantified by relative migrated cell numbers. E The apoptotic cell numbers (Annexin V-positive staining) in HCT116 cells were assessed by flow cytometry after PLK1 knockdown by shRNA or siRNA. F HCT116 and DLD-1 cells were transiently transfected with PLK1 siRNA or control siRNA. CCK-8 assays were performed to evaluate cell viability at 24 h, 48 h, and 72 h post-transfection. G Luciferase-labeled HCT116 cells were transfected with PLK1 siRNA or control siRNA for 48 h, harvested, and intravenously injected into BALB/c mice (n = 5). Bioluminescence intensity was monitored at 0 h, 3 h, 6 h, and 9 h post-injection. Student's t test, *P < 0.05, **P < 0.01, ***P < 0.001

Pharmacological inhibition of PLK1 by BI6727 decreased cell proliferation and triggered apoptosis in vitro

BI6727 (volasertib), a potent small molecular inhibitor of PLK1 that targets the kinase domain, is currently being tested in clinical trials for multiple cancer treatments (Liu 2015). To further characterize the role of PLK1 in the carcinogenesis of CRC, HCT116 and DLD-1 cells were treated with BI6727 at gradient concentrations. The MTT assay showed that BI6727 decreased cell viability in a dose-dependent manner with a half maximal inhibitory concentration (IC50) of 27.13 nM in HCT116 cells and 67.35 nM in DLD-1 cells (Fig. 3B). Furthermore, BI6727 caused a decrease in cell numbers and degeneration of CRC cell morphology (Fig. 3A) and significantly induced CRC cell apoptosis (Fig. 3C). Colony formation assays showed that BI6727 significantly inhibited the colony formation ability of CRC cells in a dose-dependent manner (Fig. 3D). In addition, Transwell assays revealed that CRC cells treated with BI6727 showed decreased migratory ability compared with control cells (Fig. 3E). These results suggested that pharmacological inhibition of PLK1 contributed to decreased proliferation and migration ability and the induction of apoptosis in CRC cells, which were consistent with the effects of knocking down PLK1.

Fig. 3.

Fig. 3

Open in a new tab

Pharmacological inhibition of PLK1 by BI6727 decreased cell proliferation and triggered apoptosis in vitro. DLD-1 and HCT116 cells were treated with BI6727 at the indicated dosage in 1% FBS medium. A The morphological changes of HCT116 and DLD-1 cells were captured after BI6727 treatment for 24 h. B Cell viability was measured by MTT assay, and the half maximal inhibitory concentration (IC50) was calculated after BI6727 treatment for 48 h. C Cell apoptosis was analyzed by flow cytometry in HCT116 and DLD-1 cells treated with BI6727 for 48 h. Apoptotic cells were indicated by Annexin V-positive staining. D HCT116 and DLD-1 cells were treated with BI6727, and colony formation was performed. Colony numbers were quantified. E Cell migration was analyzed in HCT116 cells treated with 20 nM BI6727 and DLD-1 cells treated with 80 nM BI6727 for 48 h through Transwell assays without Matrigel, and the extent of migration was quantified by relative migrated cell numbers. Student's t test, ***P < 0.001

Targeting PLK1 caused apoptotic cell death through downregulation of Bcl2/Bax expression in CRC cells

Our studies have suggested that PLK1 inhibition could markedly induce the apoptosis of CRC cells. The proapoptotic protein Bax and anti-apoptotic protein Bcl2 are two important members of the Bcl2 family involved in apoptosis. Moreover, studies have demonstrated that the Bcl2/Bax ratio is critical for the integrity of mitochondria and caspase-3 activation during apoptosis (Tait and Green 2010; Quan et al. 2020). To determine the mechanism of cell apoptosis induced by PLK1 inhibition, HCT116 and DLD-1 cells were transiently transfected with siRNAs targeting PLK1 (mixed siPLK1#1 and siPLK1#2) or N.C. Western blot analysis showed that PLK1 knockdown significantly enhanced the expressions of apoptosis-related proteins, including cleaved PARP and cleaved caspase-3, and resulted in a strong downregulation of Bcl2, decreasing the Bcl2/Bax ratio (Fig. 4A). A consistent tendency in related proteins was also demonstrated in HCT116 and DLD-1 cells treated with BI6727 (Fig. 4B). Meanwhile, GEPIA survival analysis showed that low Bax expression was associated with poor overall survival (OS) (p < 0.05) in CRC patients (Fig. 4C). High Bcl2 expression was correlated with poor OS in CRC patients, although the difference was not significant (p = 0.5) (Fig. 4D). Furthermore, we analyzed the expression of Bax in CRC patient tissues. Compared with the adjacent tissues, the expression of Bax in CRC tissues was significantly lower, which was associated with poor OS in CRC patients (Fig. 4E). These results demonstrated that PLK1 inhibition prevented anti-apoptotic Bcl2 expression and reduced the Bcl-2/Bax ratio, which induced apoptosis of CRC cells.

Fig. 4.

Fig. 4

Open in a new tab

Targeting PLK1 decreased the Bcl2/Bax ratio, inducing cell apoptosis in CRC. A, B Western blot analysis of the levels of PLK1, proapoptotic Bax, cleaved caspase-3, cleaved PARP, and anti-apoptotic protein Bcl2 in HCT116 and DLD-1 cells transfected with PLK1 siRNA or treated with BI6727. C Bioinformatic analysis of the association between Bax expression and overall survival among CRC patients (P < 0.05, log-rank test). D Correlation analysis of Bcl2 expression and overall survival in CRC patients. E IHC analysis of Bax expression in tissues from healthy (normal) and CRC patients (adjacent and tumor #1, #2). Upper panel, magnification 200 × , bar = 100 μm; lower panel, magnification 400 × , bar = 50 μm

Apoptosis by PLK1 inhibition was triggered by elevated oxidative stress and impeded mitochondrial function in CRC cells

Reactive oxygen species (ROS), a part of normal cell metabolism, have been proven to induce cell apoptosis once the level of ROS exceeds the elimination ability of its own antioxidant defense systems (Cerutti 1994). Flow cytometry analysis-based DCFH-DA showed that targeting PLK1 significantly elevated ROS accumulation in HCT116 and DLD-1 cells (Fig. 5A), which may directly mediate the occurrence of cell apoptosis. Moreover, accumulating evidences have shown that Bcl2 family members play an essential role in the mitochondrial apoptotic pathway by directly controlling the permeability of the outer mitochondrial membrane (Ma et al. 2020). Considering the decreased Bcl2/Bax ratio, we first investigated the change in mitochondrial membrane potential (MMP), which is also a critical indicator of apoptosis. JC-1 staining showed that knocking down or inhibiting PLK1 caused the loss of MMP in HCT116 cells (Fig. 5B). It is well known that Bcl2 downregulation and Bax translocation regulate the permeability of the mitochondrial membrane, the release of Cytochrome c (Cyt-c), and the activation of caspase-3 (Murphy et al. 2000; Narita et al. 1998). To test whether a similar mechanism exists in CRC cells, cytosolic and mitochondrial proteins were separated, and adequate separation of the two compartments was evaluated using Cytochrome c oxidase subunit IV (COX4, mitochondrial marker). Western blot analysis revealed that knocking down or inhibiting PLK1 increased the Bax ratio in mitochondria (normalized to cytoplasm) in HCT116 cells and decreased the Cyt-c ratio in mitochondria in HCT116 and DLD-1 cells (Fig. 5C and 5E), which represented the translocation of Bax from the cytoplasm to mitochondria and the release of Cyt-c from mitochondria to the cytoplasm, respectively. Further immunofluorescence analysis also demonstrated that after knocking down or inhibiting PLK1, Cyt-c expression in mitochondria was decreased in HCT116 cells (Fig. 5D). Taken together, these results indicated that PLK1 inhibition destroyed mitochondrial membrane integrity (including the loss of MMP and Bax translocation), further caused Cyt-c release from mitochondria to the cytoplasm and caspase-3 activation, and finally led to the apoptosis of CRC cells.

Fig. 5.

Fig. 5

Open in a new tab

Apoptosis was triggered by elevated oxidative stress and impaired mitochondrial function by PLK1 inhibition in CRC. HCT116 and DLD-1 cells were transfected with specific siRNA or treated with BI6727. A Cellular ROS was determined by flow cytometry. The relative mean fluorescence intensity (MFI) was quantified to indicate the cellular ROS level. B The mitochondrial membrane potential (MMP) of HCT116 cells labeled with the fluorescent probe JC-1 was measured by flow cytometry. MMP was expressed as the ratio of JC-1 aggregates/monomer (Agg/Mon). C The expression levels of Cyt-c and Bax in the cytosolic and mitochondrial fractions of HCT116 cells were analyzed by Western blot assay. ꞵ-Actin was used as an internal reference in the cytosolic fraction, and COX4 was used as an internal reference in the mitochondrial fraction. D Immunofluorescence was used to detect the cellular localization and expression of Cyt-c in HCT116 cells. DAPI was used for nuclear staining. Scale bar: 10 μm. E Western blot analysis of Cyt-c in the cytosolic and mitochondrial fractions of DLD-1 cells following transfection with control siRNA or PLK1-targeting siRNA. Student's t test, *P < 0.05, **P < 0.01, ***P < 0.001

Antioxidants rescued mitochondrial dysfunction-mediated apoptotic cell death in CRC cells

To determine whether the PLK1 inhibition-caused reduction in Bcl2 expression and mitochondrial dysfunction were related to excessive ROS generation in CRC cells. HCT116 cells were treated with H2O2 and DMTU (N,N'-dimethylthiourea, an effective ROS scavenger). As expected, 10 mM DMTU partially blocked the H2O2-induced accumulation of ROS (Fig. 6A) and cleaved PARP expression, upregulated Bcl2 expression (Fig. 6B), and rescued H2O2-induced apoptosis of HCT116 cells (Fig. 6C). Next, flow cytometry analysis showed that the generation of ROS was partially inhibited by DMTU in BI6727-treated HCT116 cells (Fig. 6D) and accompanied by increased cell viability (Fig. 6E). JC-1 staining showed that DMTU partially protected HCT116 cells from the loss of mitochondrial membrane potential (Fig. 6F). Western blot analysis showed that DMTU upregulated the Bcl2/Bax ratio and decreased the expression of cleaved PARP and the activation of caspase-3 (Fig. 6G). Meanwhile, DMTU also attenuated the release of Cyt-c caused by PLK1 inhibition in HCT116 cells (Fig. 6H). In addition, similar results were also observed in DLD-1 cells. DMTU enhanced cell viability and rescued cell apoptosis induced by H2O2 or BI6727 (Supplementary Fig. 1A, B). These results demonstrated that DMTU might effectively alleviate mitochondrial dysfunction by directly reducing the accumulation of ROS. In summary, these results revealed that PLK1 inhibition increased the accumulation of ROS, thus causing downregulation of the Bcl2/Bax ratio, which was responsible for mitochondrial membrane integrity and subsequent leakage of Cyt-c, and activation of intrinsic apoptosis of CRC cells (Supplementary Fig. 1C).

Fig. 6.

Fig. 6

Open in a new tab

Mitochondrial dysfunction-mediated apoptosis was rescued by antioxidants in HCT-116 cells treated with BI6727. The antioxidant DMTU (10 mM) was added to H2O2-treated HCT116 cells. A Cellular ROS levels were detected by flow cytometry. The relative MFI was quantified to indicate the cellular ROS level. B Western blot analysis of cleaved PARP and Bcl2 expression in HCT116 cells. C The apoptotic cell numbers (Annexin V-positive staining) were assessed by flow cytometry in HCT116 cells treated with or without H2O2 and DMTU. The antioxidant DMTU (10 mM) was added to BI6727-treated HCT116 cells. D Cellular ROS levels were detected by flow cytometry and quantified by relative MFI. (E) Cell viability was measured by MTT assay. F Changes in MMP were measured by flow cytometry and impaired MMP was indicated by the relative JC-1 aggregates/monomer ratio. G Western blot analysis of cleaved caspase-3, cleaved PARP, Bax, and Bcl2 expression in HCT116 cells. H The expression of Cyt-c in cytosolic and mitochondrial fractions was measured and quantified. Student's t test, *P < 0.05, ***P < 0.001

BI6727 suppressed tumor growth and induced apoptosis in xenograft tumor models

To further assess the effects of PLK1 in vivo, we subcutaneously injected equal amounts of HCT116 cells into BALB/c nude mice. After 14 days, the mice were randomized into groups and subjected to intraperitoneal treatment with PBS or BI6727 (10 mg/kg body weight) once every 3 days following the schedule (Fig. 7A). Compared with the control group, we observed that BI6727 treatment significantly diminished tumor sizes (Fig. 7B), including tumor volume and tumor weight (Fig. 7C, D). In addition, H&E staining showed more necrotic areas in HCT116 xenografts treated with BI6727 than in control xenografts (Fig. 7E, left panel). Immunohistochemical staining analysis demonstrated that BI6727 treatment significantly decreased the expressions of PLK1 and Ki67, a cell proliferation marker (Fig. 7E, middle panel). To elucidate whether BI6727 was able to induce cell apoptosis in vivo, TUNEL assay analysis of xenograft tumor sections was performed and showed a significantly higher number of apoptotic cells in the BI6727 treatment group (Fig. 7F). Next, we randomly selected four pairs of tissues for western blot analysis. As expected, the BI6727 treatment group showed increased levels of cleaved PARP and Bax (Fig. 7G), which was also consistent with upregulated Bax expression in IHC staining (Fig. 7E, right panel). These results indicated that BI6727 also induced cell apoptosis and further suppressed the progression of CRC in vivo.

Fig. 7.

Fig. 7

Open in a new tab

BI6727 suppressed tumor growth and induced apoptosis in a xenograft tumor model of HCT116 cells. A BALB/c nude mice were inoculated with HCT116 cells subcutaneously, followed by treatment with BI6727 (10 mg/kg, i.p.) or vehicle after 14 days. B Xenograft tumors were photographed. C Tumor volume was monitored and recorded at the indicated times. D The tumor weight of nude mice was measured. E Representative images of H&E staining of tumor sections (magnification 100 × , bar = 200 μm) and IHC staining of PLK1, Bax, and Ki67 (magnification 400 × , bar = 50 μm) are shown. F TUNEL staining was performed to evaluate apoptotic cells in xenograft tumor tissues. Scale bar: 25 μm. G The expression levels of cleaved PARP and Bax in xenograft tumors were measured by Western blot. Student's t test, *P < 0.05, **P < 0.01

Discussion

CRC is a common malignant tumor of the digestive system with high morbidity and mortality rates (Nasseri and Langenfeld 2017; Marmol et al. 2017). Although a variety of CRC treatments have been applied in the clinic, such as surgery, radiation therapy, systemic chemotherapy, and targeted therapy, the therapeutic efficacy of these approaches is limited, and severe side effects cannot be neglected after long-term observation (Brenner et al. 2014). Accordingly, the identification of new therapeutic targets is critical to improve the survival rate of CRC patients. PLKs are characterized by a highly conserved N-terminal kinase domain (KD) and a noncatalytic C-terminal domain known as the PBD, which directs their subcellular locations and regulates the interaction of proteins. A total of five mammalian PLK family members have been identified: PLK1, PLK2/SNK, PLK3/FNK/PRK/CNK, PLK4/SAK/SZK18, and PLK5 (Raab et al. 2021). Among them, PLK1 is the most investigated member and has been found to be highly expressed in a variety of cancers (Lee et al. 2015). PLK1 is traditionally considered to participate in various mitotic events. Numerous studies have shown that PLK1 can drive the G2/M phase transition by controlling the activity of the CDK1/Cyclin B1 complex (Gavet and Pines 2010; Seki et al. 2008). In addition, PLK1 regulates cytoplasmic separation, mitotic spindle formation, and membrane formation in mitotic telophase by phosphorylating mitotic kinesin-like protein l (MKLP-1) (Liu et al. 2004). Based on a large number of studies, the mechanism of PLK1 is becoming increasingly clear during cell cycle progression. Recently, increasing evidences have shown that PLK1 also controls many nonmitotic events. For instance, X. Ma et al. found that PLK1 phosphorylates glucose-6-phosphate dehydrogenase (G6PD), thereby activating the enzyme and further upregulating the pentose phosphate pathway (PPP) by facilitating the formation of its active dimer (Ma et al. 2017). Inhibition of PLK1 has also been proven to be effective in limiting the progression of various cancers (Jeong et al. 2018; Dufies et al. 2021; Chen et al. 2019). However, as an attractive target of cancer therapeutics, little is known about the nonmitotic functions of PLK1 in CRC. Here, we focused on the effect of PLK1 in inducing endogenous mitochondrial apoptosis through the regulation of mitochondrial function in CRC.

Apoptosis is considered a typical kind of programmed cell death and refers to the spontaneous and orderly death of cells to maintain homeostasis of the internal environment (Pistritto et al. 2016). Apoptosis dysfunction is responsible not only for tumor progression but also for tumor resistance to therapies (Wong 2011). Cell apoptosis is mainly mediated by the exogenous death receptor pathway and endogenous mitochondrial pathway (Fu et al. 2020). Specifically, members of the Bcl2 family, including proapoptotic and anti-apoptotic proteins, are involved in regulating the release of mitochondrial-related apoptotic factors in the mitochondrial pathway (Circu and Aw 2010; Shieh et al. 2010). Bax, a proapoptotic factor, increases the permeability of the mitochondrial membrane by translocating from the cytoplasm to the membrane (Jia et al. 2015). Once Bax translocates to the mitochondrial surface, apoptotic signaling is activated and initiates Cyt-c and apoptosis inducing factor (AIF) release from the mitochondria to the cytosol. Subsequently, Cyt-c binds to Apaf-1 and activates caspase-9. At the same time, activated caspase-9 cleaves the effector caspase-3, which triggers the cleavage of numerous key cellular substrates, such as PARP, and further induces apoptosis (Cory and Adams 2002; Li et al. 1997; Huang et al. 2017). In contrast, the anti-apoptotic protein Bcl2 prevents the caspase cascade, which counteracts Bax and binds to the outer mitochondrial membrane, thereby maintaining mitochondrial membrane integrity and enhancing cell survival (Brenner and Mak 2009; Tsujimoto and Shimizu 2007).

In this study, we confirmed the abnormal expression of PLK1 in CRC through database and IHC analyses of CRC patient tissues. These results indicated that PLK1 upregulation was involved in cancer progression. This is in line with the results of previous studies (Ran et al. 2019). Next, we found that inhibiting PLK1 by RNAi or the small molecule inhibitor BI6727 resulted in reduced cell viability, decreased cell migration and proliferation abilities, and obviously increased the number of apoptotic cells. Next, we further elucidated the underlying mechanism of CRC cell apoptosis induced by PLK1 inhibition. We found that PLK1 inhibition increased the accumulation of intracellular ROS, which might directly lead to the apoptosis of CRC cells. With reference to the results of previous studies, the increased ROS levels may be related to the mitochondrial apoptosis pathway (Liu et al. 2017b; Zhao et al. 2019). The application of the antioxidant DMTU demonstrated that increased ROS levels might lead to mitochondrial dysfunction, including a decreased ratio of Bcl2/Bax, loss of MMP, release of Cyt-c from mitochondria to the cytoplasm, caspase-3 activation, and finally induction of apoptosis of CRC cells. In addition, HCT116 xenograft tumor model was established to evaluate the effects of PLK1 in vivo. As expected, BI6727 significantly inhibited tumor growth compared with the control group. Remarkably, decreased tumor size was strongly related to the induction of cell apoptosis by BI6727 treatment. Collectively, these results demonstrated that inhibiting or silencing PLK1 could elevate intracellular oxidative stress, which resulted in the imbalance of Bcl2 and Bax expression and further destroyed mitochondrial function, thereby activating the mitochondrial apoptosis pathway in CRC. However, how PLK1 mediates the generation of ROS remains unknown. In turn, ROS accumulation may also be the result of mitochondrial dysfunction. Moreover, it is worth noting that Bcl2 protein also plays critical roles in nonapoptotic cellular processes, such as calcium homeostasis (Shalaby et al. 2020) and autophagy (Raab et al. 2021). Whether the decreased Bcl2 expression caused by PLK1 inhibition is associated with other biological functions needs to be further studied in CRC.

In conclusion, these findings indicate that PLK1 promotes the tumorigenesis of CRC by inhibiting ROS-mediated mitochondrial dysfunction. Moreover, the underlying mechanism of PLK1 inhibition-induced apoptosis further enriches our understanding of PLK1 function in CRC development. These findings also provide more evidences to support that BI6727 may be a novel potential therapeutic strategy in the treatment of CRC. As discussed above, the clinical application of novel approaches to directly target the mitochondrial apoptotic pathway may be highly effective in CRC treatment.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (TIF 4314 KB) (4.2MB, tif)

Acknowledgements

We would like to thank Xinying Wu (Animal Center of Nankai University) for technical support of imaging in vivo. This work was supported by the “The Fundamental Research Funds for the Central Universities (Nankai University, #ZB19100128)” to C.L, “Chongqing Science and Technology Bureau of China (#cstc2019jcyj-msxm1819)” and “National Natural Science Foundation of China (#81901427)” to D.S.

Abbreviations

CRC

Colorectal cancer

COAD

Colon adenocarcinoma

HCT116 and DLD-1

Human colorectal cell lines

FHC

Normal colon epithelium cell line

PLK1

Polo-like kinase 1

Bcl2

B-cell lymphoma-2

Bax

Bcl2-associated X protein

Cyt-c

Cytochrome c

cl-cas3

Cleaved caspase-3

cl-PARP

Cleaved PARP

ROS

Reactive oxygen species

H2O2

Hydrogen peroxide

H&E

Hematoxylin and eosin

DAPI

4′,6-Diamidino-2-phenylindole

PBS

Phosphate-buffered saline

PCR

Polymerase chain reaction

FBS

Fetal bovine serum

MTT

Thiazolyl blue

CCK8

Cholecystokinin-8

TUNEL

TdT-mediated dUTP nick end labeling

Author contributions

YF and TL designed, performed, and analyzed in vitro and in vivo experiments. ZL, YL and XH performed PLK1 knockdown experiments in vitro and a xenograft tumor model establish in vivo. XP and ZF performed xenograft tumor collection. QW provided CRC patient-derived tissues. CL, YF, and TL contributed to the study design, implementation, and supervision of the study. YF and CL wrote the manuscript. DS and CL contributed to review the manuscript and supported funding. All authors had full access to the data and approved the final version of the manuscript.

Funding

“The Fundamental Research Funds for the Central Universities (Nankai University, #ZB19100128)” to C.L., “Chongqing Science and Technology Bureau of China (#cstc2019jcyj-msxm1819)” and “National Natural Science Foundation of China (#81901427)” to D.S.

Data availability

All data generated or analyzed during this study are included in this published article and are available from the corresponding author upon reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Conflict of interest

The authors declare that they have no competing interest.

Consent for publication

Not applicable.

Ethics approval

Animal experiments were performed according to the Guidelines on Laboratory Animals of Nankai University and were approved by the Institute Research Ethics Committee at Nankai University (No: 2021-SYDWLL-000462). All relevant human studies were performed in accordance with the Declaration of Helsinki and approved by the Institute Research Ethics Committee at Nankai University (No. NKUIRB2021107).

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Di Shao, Email: di.shao@cgghcc.com.

Chenggang Li, Email: lichenggang@nankai.edu.cn.

References

  1. Brenner D, Mak TW (2009) Mitochondrial cell death effectors. Curr Opin Cell Biol 21(6):871–877 [DOI] [PubMed] [Google Scholar]
  2. Brenner H, Kloor M, Pox CP (2014) Colorectal cancer. Lancet 383(9927):1490–1502 [DOI] [PubMed] [Google Scholar]
  3. Cerutti PA (1994) Oxy-radicals and cancer. Lancet 344(8926):862–863 [DOI] [PubMed] [Google Scholar]
  4. Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce-Rodriguez I, Chakravarthi B, Varambally S (2017) UALCAN: a portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia 19(8):649–658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen HY, Villanueva J (2015) Playing Polo-Like Kinase in NRAS-Mutant Melanoma. J Invest Dermatol 135(10):2352–2355 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen Z, Chai Y, Zhao T, Li P, Zhao L, He F, Lang Y, Qin J, Ju H (2019) Effect of PLK1 inhibition on cisplatin-resistant gastric cancer cells. J Cell Physiol 234(5):5904–5914 [DOI] [PubMed] [Google Scholar]
  7. Circu ML, Aw TY (2008) Glutathione and apoptosis. Free Radic Res 42(8):689–706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Circu ML, Aw TY (2010) Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol Med 48(6):749–762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cory S, Adams JM (2002) The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2(9):647–656 [DOI] [PubMed] [Google Scholar]
  10. de Carcer G, Manning G, Malumbres M (2011) From Plk1 to Plk5: functional evolution of polo-like kinases. Cell Cycle 10(14):2255–2262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dufies M, Verbiest A, Cooley LS, Ndiaye PD, He X, Nottet N, Souleyreau W, Hagege A, Torrino S, Parola J, Giuliano S, Borchiellini D, Schiappa R, Mograbi B, Zucman-Rossi J, Bensalah K, Ravaud A, Auberger P, Bikfalvi A, Chamorey E, Rioux-Leclercq N, Mazure NM, Beuselinck B, Cao Y, Bernhard JC, Ambrosetti D, Pages G (2021) Plk1, upregulated by HIF-2, mediates metastasis and drug resistance of clear cell renal cell carcinoma. Commun Biol 4(1):166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fu Y, Wang Y, Gao X, Li H, Yuan Y (2020) Dynamic expression of HDAC3 in db/db mouse RGCs and its relationship with apoptosis and autophagy. J Diabetes Res 2020:6086780 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fu Z, Wen D (2017) The Emerging Role of Polo-Like Kinase 1 in Epithelial-Mesenchymal Transition and Tumor Metastasis, Cancers (Basel) 9(10) [DOI] [PMC free article] [PubMed]
  14. Gavet O, Pines J (2010) Activation of cyclin B1-Cdk1 synchronizes events in the nucleus and the cytoplasm at mitosis. J Cell Biol 189(2):247–259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Huang F, Zhao S, Yu F, Yang Z, Ding G (2017) Protective Effects and Mechanism of Meretrix meretrix Oligopeptides against Nonalcoholic Fatty Liver Disease, Mar Drugs 15(2) [DOI] [PMC free article] [PubMed]
  16. Jang YJ, Lin CY, Ma S, Erikson RL (2002) Functional studies on the role of the C-terminal domain of mammalian polo-like kinase. Proc Natl Acad Sci USA 99(4):1984–1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jeong SB, Im JH, Yoon JH, Bui QT, Lim SC, Song JM, Shim Y, Yun J, Hong J, Kang KW (2018) Essential role of polo-like kinase 1 (Plk1) oncogene in tumor growth and metastasis of tamoxifen-resistant breast cancer. Mol Cancer Ther 17(4):825–837 [DOI] [PubMed] [Google Scholar]
  18. Jia J, Dai S, Sun X, Sang Y, Xu Z, Zhang J, Cui X, Song J, Guo X (2015) A preliminary study of the effect of ECRG4 overexpression on the proliferation and apoptosis of human laryngeal cancer cells and the underlying mechanisms. Mol Med Rep 12(4):5058–5064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Klauck PJ, Bagby SM, Capasso A, Bradshaw-Pierce EL, Selby HM, Spreafico A, Tentler JJ, Tan AC, Kim J, Arcaroli JJ, Purkey A, Messersmith WA, Kuida K, Eckhardt SG, Pitts TM (2018) Antitumor activity of the polo-like kinase inhibitor, TAK-960, against preclinical models of colorectal cancer. BMC Cancer 18(1):136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lee KS, Burke TR Jr, Park JE, Bang JK, Lee E (2015) Recent advances and new strategies in targeting Plk1 for anticancer therapy. Trends Pharmacol Sci 36(12):858–877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91(4):479–489 [DOI] [PubMed] [Google Scholar]
  22. Li J, Yang Z, Li Y, Xia J, Li D, Li H, Ren M, Liao Y, Yu S, Chen Y, Yang Y, Zhang Y (2016) Cell apoptosis, autophagy and necroptosis in osteosarcoma treatment. Oncotarget 7(28):44763–44778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li CX, Chen J, Xu ZG, Yiu WK, Lin YT (2020) The expression and prognostic value of RNA binding proteins in clear cell renal cell carcinoma. Transl Cancer Res 9(12):7415–7431 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li H, Wang H, Sun Z, Guo Q, Shi H, Jia Y (2017) The clinical and prognostic value of polo-like kinase 1 in lung squamous cell carcinoma patients: immunohistochemical analysis, Biosci Rep 37(4) [DOI] [PMC free article] [PubMed]
  25. Liu X (2015) Targeting polo-like kinases: a promising therapeutic approach for cancer treatment. Transl Oncol 8(3):185–195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu X, Zhou T, Kuriyama R, Erikson RL (2004) Molecular interactions of Polo-like-kinase 1 with the mitotic kinesin-like protein CHO1/MKLP-1. J Cell Sci 117(Pt 15):3233–3246 [DOI] [PubMed] [Google Scholar]
  27. Liu XS, Song B, Elzey BD, Ratliff TL, Konieczny SF, Cheng L, Ahmad N, Liu X (2011) Polo-like kinase 1 facilitates loss of Pten tumor suppressor-induced prostate cancer formation. J Biol Chem 286(41):35795–35800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu F, Liu S, Ai F, Zhang D, Xiao Z, Nie X, Fu Y (2017a) miR-107 promotes proliferation and inhibits apoptosis of colon cancer cells by targeting prostate apoptosis response-4 (Par4). Oncol Res 25(6):967–974 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu M, Gao L, Zhao L, He J, Yuan Q, Zhang P, Zhao Y, Gao X (2017b) Peptide-Au clusters induced tumor cells apoptosis via targeting glutathione peroxidase-1: the molecular dynamics assisted experimental studies. Sci Rep 7(1):131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lopez J, Tait SW (2015) Mitochondrial apoptosis: killing cancer using the enemy within. Br J Cancer 112(6):957–962 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ma K, Chen G, Li W, Kepp O, Zhu Y, Chen Q (2020) Mitophagy, mitochondrial homeostasis, and cell fate, front cell. Dev Biol 8:467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ma X, Wang L, Huang, Li Y, Yang D, Li T, Li F, Sun L, Wei H, He K, Yu F, Zhao D, Hu L, Xing S, Liu Z, Li K, Guo J, Yang Z, Pan X, Li A, Shi Y, Wang J, Gao P, Zhang H (2017) Polo-like kinase 1 coordinates biosynthesis during cell cycle progression by directly activating pentose phosphate pathway, Nat Commun 8(1):1506. [DOI] [PMC free article] [PubMed]
  33. Marmol I, Sanchez-de-Diego C, Pradilla Dieste A, Cerrada E, Rodriguez Yoldi MJ (2017) Colorectal Carcinoma: A General Overview and Future Perspectives in Colorectal Cancer, Int J Mol Sci 18(1) [DOI] [PMC free article] [PubMed]
  34. Murphy KM, Ranganathan V, Farnsworth ML, Kavallaris M, Lock RB (2000) Bcl-2 inhibits Bax translocation from cytosol to mitochondria during drug-induced apoptosis of human tumor cells. Cell Death Differ 7(1):102–111 [DOI] [PubMed] [Google Scholar]
  35. Narita M, Shimizu S, Ito T, Chittenden T, Lutz RJ, Matsuda H, Tsujimoto Y (1998) Bax interacts with the permeability transition pore to induce permeability transition and cytochrome c release in isolated mitochondria. Proc Natl Acad Sci U S A 95(25):14681–14686 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nasseri Y, Langenfeld SJ (2017) Imaging for colorectal cancer. Surg Clin North Am 97(3):503–513 [DOI] [PubMed] [Google Scholar]
  37. Pistritto G, Trisciuoglio D, Ceci C, Garufi A, D’Orazi G (2016) Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging (albany NY) 8(4):603–619 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Quan R, Wei L, Hou L, Wang J, Zhu S, Li Z, Lv M, Liu J (2020) Proteome Analysis in a Mammalian Cell line Reveals that PLK2 is Involved in Avian Metapneumovirus Type C (aMPV/C)-Induced Apoptosis, Viruses 12(4) [DOI] [PMC free article] [PubMed]
  39. Raab CA, Raab M, Becker S, Strebhardt K (2021) Non-mitotic functions of polo-like kinases in cancer cells. Biochim Biophys Acta Rev Cancer 1875(1):188467 [DOI] [PubMed] [Google Scholar]
  40. Ran Z, Chen W, Shang J, Li X, Nie Z, Yang J, Li N (2019) Clinicopathological and prognostic implications of polo-like kinase 1 expression in colorectal cancer: a systematic review and meta-analysis. Gene 721:144097 [DOI] [PubMed] [Google Scholar]
  41. Ruf S, Heberle AM, Langelaar-Makkinje M, Gelino S, Wilkinson D, Gerbeth C, Schwarz JJ, Holzwarth B, Warscheid B, Meisinger C, van Vugt MA, Baumeister R, Hansen M, Thedieck K (2017) PLK1 (polo like kinase 1) inhibits MTOR complex 1 and promotes autophagy. Autophagy 13(3):486–505 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Seki A, Coppinger JA, Jang CY, Yates JR, Fang G (2008) Bora and the kinase Aurora a cooperatively activate the kinase Plk1 and control mitotic entry. Science 320(5883):1655–1658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Shalaby R, Flores-Romero H, Garcia-Saez AJ (2020) The Mysteries around the BCL-2 Family Member BOK, Biomolecules 10(12) [DOI] [PMC free article] [PubMed]
  44. Shieh PC, Chen YO, Kuo DH, Chen FA, Tsai ML, Chang IS, Wu H, Sang S, Ho CT, Pan MH (2010) Induction of apoptosis by [8]-shogaol via reactive oxygen species generation, glutathione depletion, and caspase activation in human leukemia cells. J Agric Food Chem 58(6):3847–3854 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tait SW, Green DR (2010) Mitochondria and cell death: outer membrane permeabilization and beyond. Nat Rev Mol Cell Biol 11(9):621–632 [DOI] [PubMed] [Google Scholar]
  46. Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z (2017) GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res 45(W1):W98–W102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tsujimoto Y, Shimizu S (2007) Role of the mitochondrial membrane permeability transition in cell death. Apoptosis 12(5):835–840 [DOI] [PubMed] [Google Scholar]
  48. van de Weerdt BC, Medema RH (2006) Polo-like kinases: a team in control of the division. Cell Cycle 5(8):853–864 [DOI] [PubMed] [Google Scholar]
  49. Weichert W, Kristiansen G, Winzer KJ, Schmidt M, Gekeler V, Noske A, Muller BM, Niesporek S, Dietel M, Denkert C (2005) Polo-like kinase isoforms in breast cancer: expression patterns and prognostic implications. Virchows Arch 446(4):442–450 [DOI] [PubMed] [Google Scholar]
  50. Wong RS (2011) Apoptosis in cancer: from pathogenesis to treatment. J Exp Clin Cancer Res 30:87 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yim H, Erikson RL (2009) Polo-like kinase 1 depletion induces DNA damage in early S prior to caspase activation. Mol Cell Biol 29(10):2609–2621 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yu C, Gong Y, Zhou H, Wang M, Kong L, Liu J, An T, Zhu H, Li Y (2017) Star-PAP, a poly(A) polymerase, functions as a tumor suppressor in an orthotopic human breast cancer model. Cell Death Dis 8(2):e2582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Yu Z, Deng P, Chen Y, Liu S, Chen J, Yang Z, Chen J, Fan X, Wang P, Cai Z, Wang Y, Hu P, Lin D, Xiao R, Zou Y, Huang Y, Yu Q, Lan P, Tan J, Wu X (2021) Inhibition of the PLK1-Coupled Cell Cycle Machinery Overcomes Resistance to Oxaliplatin in Colorectal Cancer, Adv Sci (Weinh) 8(23): e2100759. [DOI] [PMC free article] [PubMed]
  54. Zhao C, Wang M, Cheng A, Yang Q, Wu Y, Jia R, Zhu D, Chen S, Liu M, Zhao X, Zhang S, Liu Y, Yu Y, Zhang L, Tian B, Rehman MU, Pan L, Chen X (2019) Duck Plague Virus Promotes DEF Cell Apoptosis by Activating Caspases, Increasing Intracellular ROS Levels and Inducing Cell Cycle S-Phase Arrest, Viruses 11(2) [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (TIF 4314 KB) (4.2MB, tif)

Data Availability Statement

All data generated or analyzed during this study are included in this published article and are available from the corresponding author upon reasonable request.

Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES