Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2025 Feb 7;20(2):e0317958. doi: 10.1371/journal.pone.0317958

Highly sensitive molecular assay based on Identical Multi-Repeat Sequence (IMRS) algorithm for the detection of Trichomonas vaginalis infection

Clement Shiluli 1, Shwetha Kamath 2, Bernard N Kanoi 1, Racheal Kimani 1, Bernard Oduor 3, Hussein M Abkallo 3, Michael Maina 1, Harrison Waweru 1, Moses Kamita 1, Nicole Pamme 4, Joshua Dupaty 5, Catherine M Klapperich 5, Srinivasa Raju Lolabattu 2,*, Jesse Gitaka 1,*
Editor: Adriana Calderaro6
PMCID: PMC11805422  PMID: 39919090

Abstract

Introduction

Annually, approximately 174 million people globally are affected by Trichomonas vaginalis (T. vaginalis) infection. Half of these infections occur in resource-limited regions. Untreated T. vaginalis infections are associated with complications such as pelvic inflammatory disease and adverse pregnancy outcomes mostly seen in women. In resource-limited regions, the World Health Organization (WHO) advocates for syndromic case management. However, this can lead to unnecessary treatment. Accurate diagnosis of T. vaginalis is required for effective and prompt treatment. Molecular tests such as Polymerase Chain Reaction (PCR) have the advantage of having a short turn-around time and allow the use of non-invasive specimens such as urine and vaginal swabs. However, these diagnostic techniques have numerous disadvantages such as high infrastructure costs, false negative and positive results, and interstrain variation among others. This study aimed to evaluate the use of identical multi-repeat sequences (IMRS) as amplification primers for developing ultrasensitive diagnostic for T. vaginalis.

Methods

We used genome-mining approaches based on identical multi-repeat sequences (IMRS) algorithm to identify sequences distributed on the T. vaginalis genome to design a primer pair that targets a total of 69 repeat sequences. Genomic T. vaginalis DNA was diluted from 5.8×102 to 5.8×10−4 genome copies/μl and used as a template in the IMRS-based amplification assay. For performance comparison, 18S rRNA PCR assay was employed.

Results

The T. vaginalis -IMRS primers offered a higher test sensitivity of 0.03 fg/μL compared to the 18S rRNA PCR (0.714 pg/μL). The limit of detection for the Isothermal assay was 0.58 genome copies/mL. Using real-time PCR, the analytical sensitivity of the T. vaginalis -IMRS primers was <0.01 pg/μL, equivalent to less than one genome copy/μL.

Conclusion

De novo genome mining of T. vaginalis IMRS as amplification primers serves as a platform for developing ultrasensitive diagnostics for Trichomoniasis and a wide range of infectious pathogens.

Introduction

Trichomonas vaginalis (T. vaginalis) is considered the most common non-viral sexually transmitted infection (STI) [1]. So far, it affects approximately 174 million people globally, with more than half of these cases occurring in resource-limited regions, particularly in Africa, where access to testing laboratories is limited [1]. Most women infected with T. vaginalis present with vaginitis and vaginal discharge [2]. Untreated T. vaginalis infections are commonly associated with complications such as pelvic inflammatory disease (PID), adverse pregnancy outcomes (e.g., premature rupture of membranes, preterm delivery, and low-birthweight infants), prolonged Human Papilloma Virus infection and increased risk of HIV infection, mainly because it increases the shedding of viral proteins in genital tracts [2].

Usually, T. vaginalis proliferation by binary fission occurs on the mucosal surface of the urogenital tract of both males and females; however, females are more susceptible to infection than males [3]. Also, it has been shown that male infertility, epididymitis, and prostatitis are the most severe complications associated with T. vaginalis infection in males [3]. Therefore, accurate laboratory diagnosis of T. vaginalis is imperative in its treatment and control strategies.

The laboratory diagnosis of T. vaginalis in the clinical settings is done using wet-mount microscopy. However, this approach is not practical for screening large populations [3]. Also, since microscopy requires high parasite density at diagnosis, low density infections may be missed. Therefore, molecular techniques such as rRNA-based nucleic acid amplification tests (NAATs) [4] or DNA polymerase chain reaction (PCR) and real-time PCR assays and transcription-mediated amplification-based Aptima® assay [5] and in-pouch culture are a suitable alternative [6]. PCR based techniques detect T. vaginalis via specific gene targets such as the TVK3/7 and 18S rRNA gene [7]. Immunochromatographic methods have also been used to detect T. vaginalis infection [8]. Molecular tests have the advantage of having a short turn-around time and allow the use of non-invasive specimens such as urine and vaginal swabs [8]. However, these diagnostic techniques have numerous disadvantages. These include, high infrastructure costs, time-consuming procedures and labor-intensive protocols, the need to use standardized reagents and consumables, multistep reactions, false negative and positive results, interstrain variation, inefficiency in asymptomatic men or women, low sensitivity and specificity, and the need to use high density levels of the parasite [9]. Also, in resource constrained setups, access to prompt T. vaginalis diagnosis is limited by inadequate laboratory capacity [9]. For this reason, the World Health Organization (WHO) has developed algorithms for syndromic case management [9]. However, this can lead to unnecessary treatment in many cases [9]. Even for symptomatic patients, accurate molecular diagnostic tests can increase the specificity of the syndromic management [9]. A study in South Africa that used NAATs to screen for T. vaginalis infection reported 50% asymptomatic cases in pregnant women visiting antenatal clinics. This points to the need of novel molecular diagnostics to detect asymptomatic T. vaginalis infections [10].

In this study, we demonstrate the unique ability of a highly sensitive molecular assay based on de novo genome mining strategy based on identical multiple repeat sequences (IMRS) [11] in the T. vaginalis genome to generate a primer set targeting numerous sequences. The primers are then used for PCR amplification, this guarantees improved sensitivity and specificity for T. vaginalis detection.

Materials and methods

Mining genomes using the IMRS algorithm

Primers were designed based on Identical Multi-Repeat Sequence (IMRS) genome mining algorithm as previously described [11] between 03/11/2020 and 10/02/2021. The IMRS algorithm is developed by adapting the Java Collection Framework by plugging in the Google Guava software (available at https://github.com/google/guava). The algorithm performs ab initio analysis of the annotated T. vaginalis genome to identify identical repeating oligonucleotide sequences of any given length.

The algorithm fragments the entire genome sequence into overlapping windows of size ‘L’ and enumerates all fragmented L-mer sequences into positional coordinates on the genome. The repeated L-mers are counted with their positions grouped and sorted based on the repeat count.

The hits are screened by computing positional coordinates for pair of repeat sequences that are adjacent to each other on the genome and within an amplifiable region, so that they can serve as a primer pair in amplification reactions. The specificity of lead pairs was evaluated by NIH’s Basic Local Alignment Search Tool (BLAST) and NCBI Primer-BLAST, and the best pair was selected. The selected pair was capable of amplifying sequences from various locations of the T. vaginalis genome to generate amplicons of various lengths. Scaffolds and contigs were used to identify 69 repeats with expected product sizes of 76, 197, 318 and 439 bp on the T. vaginalis genome.

T. vaginalis genomic DNA preparation

Quantitative Genomic DNA from T. vaginalis (ATCC® 30001DQTM) was obtained from the American Type Culture Collection (ATCC) at a concentration of ≥1 x 105 copies/μL. T. vaginalis genomic DNA was diluted in Tris-EDTA buffer (Thermo Fisher Scientific, Waltham, Massachusetts, USA) to concentrations between 5.8×102 and 5.8×10−4 genome copies/μL and used as template for both IMRS and 18S rRNA PCR assays.

18S rRNA PCR assay

The 18S rRNA PCR and IMRS assays were carried out in a reaction mixture containing dNTPs (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (0.2 mM), forward and reverse primers (0.01 mM each), Taq Hot-Start DNA polymerase (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (1.25 U), genomic template DNA (1 μL to a final PCR reaction volume of 25 μL). The cycling parameters were as follows: 95°C for 3 min; 35 cycles of 95°C for 30 s, 68°C for 30 s, 72°C for 30 s and 72°C for 30 s followed by a final hold of 4°C. The negative controls consisted of all the PCR reaction components except template DNA, which was substituted with molecular grade water (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

All PCR products were resolved in 2% agarose gel visualized on a UV Gel illuminator system (Fison Instruments, Glasgow, United Kingdom) under ethidium bromide staining. The negative controls consisted of all the PCR reaction components except template DNA which was substituted with molecular grade water (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

Isothermal IMRS amplification assay

Isothermal (Iso) IMRS amplification assays were performed in a 25 μL reaction mixture consisting of Bst 2.0 polymerase (640 U/mL) (New England Biolabs, Massachusetts, USA), with 1× isothermal amplification buffer, 3.2 μM forward primer, and 1.6 μM reverse primer (Jigsaw Bio solutions, Bengaluru, India) combined with 10 mM dNTPs (Thermo Fisher Scientific, Massachusetts, USA), 0.4 M Betaine (Sigma-Aldrich, Missouri, USA), molecular-grade water and Ficoll (0.4 g/mL) (Sigma-Aldrich, Missouri, USA) and genomic template DNA of 1 μL. Amplification was carried out at 56°C for 40 min. Amplified products were visualized by gel electrophoresis in a 2% gel. The negative controls consisted of all the PCR reaction components except template DNA which was substituted with molecular grade water (Thermo Fisher Scientific, Waltham, Massachusetts, USA).

Lower limit of detection

To assess the lower limit of detection (LLOD) of the T. vaginalis IMRS PCR assay, genomic DNA was diluted 100-fold from 100 pg/μL (5.8×102 copies/μL) to 10−6 pg/μL (<1 copies/μL) and 10-fold from 100 pg/μL (5.8×102 copies/μL) to 10−2 pg/μL (< 1 copies/μL) for the gold standard 18S rRNA PCR assay. Thereafter, 5 replicates of each dilution were used for the assays. Amplification products were visualized on gel after electrophoresis. To determine the LLOD of the T. vaginalis 18S rRNA and IMRS-PCR assays, probit analysis was performed using the ratio of successful reactions to the total number of reactions performed for each assay.

Real-time PCR assay

The Quant Studio 5 Real-Time PCR System, with Quant Studio Design and Analysis Desktop Software v1.5., was used as a reference method for the T. vaginalis 18S rRNA PCR and the T. vaginalis IMRS-PCR assays as well as to determine the sensitivity of the T. vaginalis IMRS and 18S rRNA PCR primers for detecting T. vaginalis DNA. The genomic DNA was serially diluted 10-fold starting concentration of 104 genome copies/μL. The final real-time PCR master mix volume was run 10 μL in triplicate and consisted of the following components: 5 μL SYBR Green qPCR Master Mix (Thermo Fisher, Massachusetts, USA), 1 μL forward and reverse IMRS primer mix (0.01 mM) 2.5 μL template genomic DNA and 1.5 μL molecular grade water. The amplification cycling conditions were 50°C for 2 min; 95°C for 10 min; 40 cycles of 95°C for 15 s and 60°C for 30 s.

Cloning and characterization of T. vaginalis -IMRS amplicons

Gene cloning was performed to confirm the sequences of the amplicons obtained from the T. vaginalis IMRS PCR assay. T. vaginalis gDNA was amplified using Assembly IMRS-F (TTCCGGATGGCTCGAGTTTTTCAGCAAGAT GCTATATCTCATGATCTTAC) and Assembly IMRS-R (AGAATATTGTAGGAGATCTTCTAGAAAGATACTATTTCCCTGCCGTTGGTGT ATGTGCCGGATACCATTGTGTCA) primers. The underlined bold sequences correspond to the IMRS primers for amplifying the T. vaginalis genome, whereas the bold italicised corresponds to sequences in the cloning vector. The resulting amplicons were resolved on 2% agarose to confirm the fragment size and purified using the PureLink™ PCR purification kit (Thermo Fisher). The purified amplicon was then ligated into pJET1.2/ blunt vector (Thermo Fisher) using the NEBuilder® HiFi DNA Assembly kit (NEB) as per the manufacturer’s instructions. The resulting NEBuilder HiFi DNA Assembly product was transformed into NEB 5-alpha Competent E. coli (NEB #C2987, NEB) following the manufacturer’s instructions. Transformed colonies were randomly selected, DNA extracted and Sanger-sequenced using the universal pJET1.2 forward sequencing primer (CGACTCACTATAGGGAGAGCGGC) and pJET1.2 reverse sequencing primer (AAGAACATCGATTTTCCATGGCAG). The resulting nucleotides were trimmed and analysed using SnapGene software (GSL Biotech; available at snapgene.com), aligned to check for similarity or “clonal” differences. BLAST was used to check for similarity with the T. vaginalis genome.

Sensitivity and specificity

The sensitivity of IMRS primers was tested using 17 T. vaginalis–PCR confirmed high vaginal swab negative samples. Written informed consent was obtained from patients attending routine ante natal care enrolled between 08/03/2021 and 31/05/2021. The in silico analysis of specificity was checked in various ways. First, 76bp 197bp, 318bp and 439bp target sequences were searched against the nucleotide database, with the BLAST-search tool being limited to exclude Trichomonas spp. Primers for IMRS PCR were used to conduct in silico PCR using the NCBI primer-BLAST tool and the in silico PCR tool in the UCSC genome browser on 12/04/2024. The minimum perfect match for primers was set to a minimum of 10 perfect nucleotide matches, and the amplification target was set to 4000 bp for in silico PCR using the in silico PCR tool of the UCSC genome browser, while up to 6 mismatches and amplification of up to 4000 bp were allowed for in silico PCR using primer-BLAST.

Copy number of amplification targets

The relationship between the genome size, DNA concentration, and the number of amplification targets was assessed using the mathematical formula for calculating dsDNA copy number (https://www.technologynetworks.com). The genome size for T. vaginalis was obtained from literature, while the genomic DNA concentration was provided by the vendor.

Data analysis

Graphs were plotted with GraphPad Prism version 7.0 (GraphPad Software, San Diego, CA, USA). The mean, and SD values were calculated in Excel 2016. To determine the LLOD of T. vaginalis -IMRS and T. vaginalis -18S rRNA PCR assays (the concentration at which genomic T. vaginalis DNA is detected with 95% confidence), probit regression analyses were performed in Excel 2016. Statistical analyses were performed using a t-test of GraphPad Prism version 7.0. For two-tailed distributions, P < 0.05 was considered significant.

Ethical consideration

This study was reviewed and approved by the Mount Kenya University Ethical Review Committee under reference MKU/ERC/1649.

Results

Location of IMRS primer targets on the T. vaginalis genome

Repeat sequences that could be used as forward and reverse primers for an amplification assay using the IMRS based genome mining algorithm were identified (10). A total of 69 repeat sequences of 76bp, 197bp, 318bp and 439bp were identified, and the targeted regions are shown in Fig 1. These repeats can inter-changeably serve as forward or reverse primers due to their presence in opposite orientations at various loci of the sense and antisense strands as depicted using a circos plot (Fig 1). It was hypothesized that the identified primer pair F 5’- GCTATATCTCATGATCTTAC -3’ and R 5’- ATGTGCCGGATACCATTGTGTCA - 3’ would generate many amplicons, leading to increased analytical sensitivity in PCR assays.

Fig 1. Circos plot displaying the Identical Multi-Repeat Sequence (IMRS) primer target regions on the Trichomonas vaginalis genome.

Fig 1

Open in a new tab

As shown, the primers target a total of 69 repeat sequences on the genome. The red lines show the forward primer targets while the blue lines show the reverse primer targets.

Amplification of sequences on T. vaginalis genome

The sensitivity of the IMRS primers to amplify the targeted regions in the T. vaginalis genome was confirmed by serially diluting genomic DNA. Dilutions were then used as a template for PCR amplification. The IMRS primers could detect T. vaginalis genomic DNA from a concentration less than 1 fg/μL (S1 Fig). The gold standard 18S rRNA primers (S2 Fig) could also detect T. vaginalis genomic DNA down to a concentration of 1 fg/μL.

Isothermal amplification of genomic T. vaginalis DNA

Serially diluted genomic DNA was used to perform Isothermal T. vaginalis -IMRS amplification. The LLOD for the T. vaginalis -Iso-IMRS assay was estimated at 0.0201 pg/μl (Fig 2A). As shown in Fig 2B, the reaction products were visualized on a 2% gel. The Iso- T. vaginalis -IMRS assay successfully amplified T. vaginalis DNA at a concentration of 5.84×102 copies/μL.

Fig 2. Iso-thermal amplification of Trichomonas vaginalis DNA using TV-IMRS primers.

Fig 2

Open in a new tab

Lower limit of detection (LLOD) for the Iso-thermal amplification was calculated using the Probit analysis (A). 2% gel image of amplicons of 100-fold serial dilution of Trichomonas vaginalis DNA template (1, 100bp ladder, 2, 102 pg/μl, 3, 1 pg/μl, 4, 10−2 pg/μl, 5, 10−4 pg/μl, 6, 10−6 pg/μl, 7, 10−8 pg/μl and 8, non-template control). The estimated LLOD for the Isothermal assay was 0.0201 pg/μl.

Gene sequencing of T. vaginalis assembly products

To confirm the exact regions amplified by the T. vaginalis -IMRS primers, we cloned the amplicon into blunt cloning vectors and transformed it into electrocompetent E. coli cells that were then plated onto agar plates. Assembly products were then separated on 2% gel (Fig 3). DNA from transformed E. coli cells was extracted and sequenced. Multiple sequencing alignment confirmed T. vaginalis sequences. These results suggested that the T. vaginalis -IMRS primers were specific for targets within the genome (Fig 4).

Fig 3. 2% gel image showing gene cloning assembly products.

Fig 3

Open in a new tab

As shown, a total of five E. coli competent cells (No. 2–6) were transformed and DNA extracted and sequenced.

Fig 4. Multiple sequencing alignment analysis of five assembly products obtained in Fig 3 using the Trichomonas vaginalis IMRS primers.

Fig 4

Open in a new tab

The numbers correspond to the gel image assembly products in Fig 3.

Lower Limit of Detection (LLOD) calculation

To determine the lowest limit of detection (LLOD) of the IMRS PCR assay relative to the gold standard 18S rRNA PCR, probit statistic was performed using T. vaginalis genomic DNA serially diluted 100-fold and 10-fold and used as a template for the T. vaginalis -IMRS and 18S RNA PCR assays, respectively (Table 1). Fig 5A shows the probit plot for the T. vaginalis -IMRS PCR assay, and Fig 5B shows the probit plot for the gold standard 18S rRNA PCR assay. The LLOD was calculated as the concentration at which T. vaginalis DNA can be detected with 95% confidence. As indicated, the IMRS primers for T. vaginalis had an LLOD = 0.03 fg/μL, Fig 5A. The gold standard primers for T. vaginalis had an LLOD = 0.714 pg/μL, 5B. The probit analysis showed that the T. vaginalis -IMRS PCR assay had increased sensitivity compared to the gold standard 18S rRNA PCR assay.

Table 1. Dilution of DNA template to determine the lower limit of detection of PCR reactions.

IMRS 18S rRNA
Serial dilutions (pg/μl) Replicates (5) Serial dilutions (pg/μl) Replicates (5)
100 5/5 100 5/5
1 5/5 10 4/5
0.01 5/5 1 3/5
0.0001 5/5 0.1 2/5
0.000001 5/5 0.01 2/5
0.00000001 5/5 0.001 2/5
1E-10 0/5 0.0001 1/5
Coefficient -0.4123 Coefficient -7.7857
* P-Value 0.9994 P-Value 0.584
Open in a new tab

IMRS–Identical Multi-Repeat Sequence, 18S rRNA– 18S ribosomal Ribonucleic Acid

*P-Values were estimated using probit analysis

Fig 5. Probit regression analysis to calculate the lower limit of detection for the Trichomonas vaginalis -IMRS primers and the 18S rRNA PCR assay.

Fig 5

Open in a new tab

Lower limit of detection for Trichomonas vaginalis using IMRS primers was 0.03 fg/μl (A) and 18S rRNA PCR primers was 0.714pg/μL (B) respectively.

Minimum concentration detection of T. vaginalis genomic DNA

Real-time PCR assay was also performed using serially diluted genomic T. vaginalis DNA as a template and T. vaginalis -IMRS primers or T. vaginalis -18S rRNA primers. The mean Ct values at each dilution were used to plot amplification bar graphs (Fig 6 for T. vaginalis -IMRS primers and for T. vaginalis -18S rRNA primers). The T. vaginalis -IMRS primers detected genomic DNA to a concentration <0.01 pg/μL, equivalent to less than one genome copy/μL.

Fig 6. Mean Ct values using 10-fold serially diluted genomic Trichomonas vaginalis DNA for the IMRS and 18S rRNA RT-PCR assay, respectively.

Fig 6

Open in a new tab

In total, 8 dilutions were done, and each dilution served as template for the RT-PCR assay. The DNA concentration of the starting DNA template was 100 pg/μL.

Specificity of the T. vaginalis -IMRS primers

The BLAST results indicated no significant similarity between nucleotide sequences on the database, with 76bp, 197bp, 318bp, and 439bp, except for T. vaginalis. Further BLAST analysis with other STI genomes indicated that the sequences were not similar to Chlamydia trachomatis (taxid: 813), Treponema pallidum (taxid: 160) and Neisseria gonorrhoea (taxid: 485). Also, the T. vaginalis -IMRS primers were non-specific to PCR negative samples (S3 Fig).

Discussion

One of the major challenges in eradicating T. vaginalis is the accurate identification of low-density infections. Therefore, highly sensitive, efficient, and reliable molecular diagnostic techniques are urgently needed [12–14]. Once developed, these diagnostic assays will be vital in detecting asymptomatic T. vaginalis cases, therefore controlling the emergence and spread of infections. This is a key priority action for the World Health Organization (WHO) in strengthening efforts to ensure high-quality diagnostics assays for STIs are accessible and available particularly in resource limited countries [15].

This study investigated the sensitivity of the novel T. vaginalis -IMRS PCR assay for detecting genomic T. vaginalis DNA. Compared to the conventional 18S-rRNA PCR assay, the T. vaginalis -IMRS PCR assay detected serially diluted genomic DNA up to a concentration of <1 fg/μL. This demonstrates the potential applicability of the T. vaginalis -IMRS PCR assay in detecting asymptomatic clinical infections. Indeed, numerous studies have reported the occurrence of asymptomatic STI cases [16–18], and routine testing is therefore critical to mitigate their spread and potentially slow the development of antibiotic resistance [19]. Although culture is considered the gold standard technique in diagnosing T. vaginalis, approximately 300 organisms are required for a positive test [20, 21]. For low density infections, the use of PCR is usually recommended. A previous study reported an analytical sensitivity of 10 fg and a detection limit of one whole flagellated cell per 25 μL of PCR mixture using the 18S rDNA PCR assay [20–22].

A study that compared the performance characteristics of microscopy, culture, point-of-care tests, Aptima and Real-time PCR methods for detecting T. vaginalis infection from vaginal swab samples reported poor sensitivity (38%) using microscopy [23]. These tests that identified T. vaginalis in symptomatic women had an average specificity of >98% [24]. In another study, the sensitivity of the Aptima and Real-time PCR was 100% while that of microscopy was 81.8% [25]. Our research, however, reported a higher analytical sensitivity of the T. vaginalis -IMRS PCR assay. This, therefore, demonstrates the increased sensitivity of the novel assay in the detection of T. vaginalis infection. We also determined the minimum concentration at which the T. vaginalis IMRS primers could detect genomic DNA using real-time PCR. Our research reported a Ct value of 32 (Fig 5). This finding is consistent with a previous study that investigated the clinical performance of BD CTGCTV2 (CTGCTV2) assay on the BD COR System (COR) for the detection of T. vaginalis that reported a Ct value of 31 [26]. However, another study reported a weak positive Ct value of >37 in patients who had completed treatment [27]. This highlights the possibility of real-time PCR reporting clinically irrelevant positives [27]. This is usually common with patients with a slow parasite clearance rate where DNA from dead trichomonads could influence the diagnosis of T. vaginalis using real-time PCR [27, 28].

A novel NAAT called loop-mediated isothermal amplification (LAMP) [29] has been established). This assay uses a DNA polymerase with strand displacement activity and a set of four to six primers that amplify nucleic acids under isothermal conditions between 60–65°C; therefore, incubation can be done in a heat block or water bath [30, 31]. This has the advantage of easily being deployed in the field. To date, the application of LAMP assays has been developed for laboratory diagnosis of infectious diseases [24, 32]. The T. vaginalis iso-thermal shares the same principle as the LAMP assay except for the number of primer sets used to amplify the DNA material. We reported an analytical sensitivity of 5.82 × 102 copies/μl. This finding contrasts with what other studies have confirmed. For instance, a detection limit of 100 trichomonads/mL or 1 trichomonad for both spiked genital swab and urine specimens was reported [33]. These discrepancies could be attributed to sample preparation procedures.

This study has some limitations. First, access to vaginal T. vaginalis samples to compare the IMRS tests was limited. Also, the in silico PCR to confirm the analytical specificity was only limited by the genomic data available at primer-BLAST and UCSC genome browser. However, to the best level of our understanding, the study reports the first rapid and accurate IMRS real-time PCR for T. vaginalis, and the findings presented might positively impact the future development of sensitive assays for detecting parasites, particularly T. vaginalis, whose genomes are large, and have many repeating sequences.

Conclusion

The T. vaginalis -IMRS isothermal amplification assay removes the numerous challenges other NAAT assays face. Its performance may be improved by using fluorescent tags to achieve a visual read out signal and used reliably for the detection of T. vaginalis in a simple, sensitive assay format, providing an alternative to more complex molecular tests for diagnosis. Additionally, the assay eliminates challenges associated with conventional molecular tests and provides new opportunities to diagnose T. vaginalis in point of care settings. To accurately interpret amplicons from IMRS PCR assays, qPCR using specific probes can be optimized.

Supporting information

S1 Fig. Image of 10-fold serially diluted (1 and 28, 100bp ladder 2–100, 3–10, 4–1, 5–0.1, 6–0.01, 7–0.01, 8–0.001, 9–0.0001, 10–10−4, 11–10−5, 12, - 10−6, 13–10−7, 14–10−8, 15–10−9, 16–10−10, 17–10−11, 18–10−12, 19–10−13, 20–10−14, 21–10−15, 22–10−16, 23–10−17, 24–10−18, 25 -,10−19 26-10-20 and 27 -Non Template Control (NTC) (pg/μl) genomic Trichomonas vaginalis DNA amplicons resolved on 2% gel using IMRS primers.

(TIF)

pone.0317958.s001.tif (1.2MB, tif)
S2 Fig. Image of 10-fold serially diluted (1, 100bp ladder 2–100, 3–10, 4–1, 5–0.1, 6–0.01, 7–0.01, 8–0.001, 9–0.0001, 10 –Non Template Control (NTC) (pg/μl) genomic Trichomonas vaginalis DNA amplicons resolved on 2% gel using gold standard 18S rRNA PCR primers.

(TIF)

pone.0317958.s002.tif (511.3KB, tif)
S3 Fig. 2% gel image of PCR confirmed Trichomonas vaginalis negative samples numbers 2–10, and 12–19 and 20 Non Template Control (NTC) (pg/μl).

Well number 1 and 11 is 100bp ladder.

(TIFF)

pone.0317958.s003.tiff (857.7KB, tiff)

Data Availability

Some relevant data has been provided via the manuscript and its Supporting Information files. Other data has been deposited in a repository. All raw data has been uploaded on Zenodo https://doi.org/10.5281/zenodo.14589291. All supplementary data has been uploaded on Zenodo https://doi.org/10.5281/zenodo.11176058.

Funding Statement

This research was supported by the Royal Society, Future Leaders African Independent Researchers (FLAIR) Scheme (FLR\R1\201314) to JG.

References

  • 1.Serbanescu M.A., et al., Molecular detection of Trichomonas vaginalis from vaginal swabs collected in Copan Transystem(TM) M40 Amies media using the Hologic Panther test system. Diagn Microbiol Infect Dis, 2024. 108(2): p. 116140. doi: 10.1016/j.diagmicrobio.2023.116140 [DOI] [PubMed] [Google Scholar]
  • 2.Vais RD H.H., Sattarahmady N., Label-free electrochemical DNA biosensing of MR TV 29 18s ribosomal RNA gene of Trichomonas vaginalis by signalization of non-spherical gold nanoparticles. Materials Today Communications., 2023. 34(1;34:105123). [Google Scholar]
  • 3.Usyk M., et al., TRiCit: A High-Throughput Approach to Detect Trichomonas vaginalis from ITS1 Amplicon Sequencing. Int J Mol Sci, 2023. 24(14). doi: 10.3390/ijms241411839 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Garber G.E., The laboratory diagnosis of Trichomonas vaginalis. Can J Infect Dis Med Microbiol, 2005. 16(1): p. 35–8. doi: 10.1155/2005/373920 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Madico G., et al., Diagnosis of Trichomonas vaginalis infection by PCR using vaginal swab samples. J Clin Microbiol, 1998. 36(11): p. 3205–10. doi: 10.1128/JCM.36.11.3205-3210.1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Van Der Pol B., Clinical and Laboratory Testing for Trichomonas vaginalis Infection. J Clin Microbiol, 2016. 54(1): p. 7–12. doi: 10.1128/JCM.02025-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pillay A., Lewis J., and Ballard R.C., Evaluation of Xenostrip-Tv, a rapid diagnostic test for Trichomonas vaginalis infection. J Clin Microbiol, 2004. 42(8): p. 3853–6. doi: 10.1128/JCM.42.8.3853-3856.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hobbs M.M. and Sena A.C., Modern diagnosis of Trichomonas vaginalis infection. Sex Transm Infect, 2013. 89(6): p. 434–8. doi: 10.1136/sextrans-2013-051057 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Peeling R.W., et al., Why do we need quality-assured diagnostic tests for sexually transmitted infections? Nat Rev Microbiol, 2006. 4(12 Suppl): p. S7–19. [DOI] [PubMed] [Google Scholar]
  • 10.Price C.M., et al., Prevalence and Detection of Trichomonas vaginalis in HIV-Infected Pregnant Women. Sex Transm Dis, 2018. 45(5): p. 332–336. doi: 10.1097/OLQ.0000000000000756 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Raju L.S., et al., Genome Mining-Based Identification of Identical Multirepeat Sequences in Plasmodium falciparum Genome for Highly Sensitive Real-Time Quantitative PCR Assay and Its Application in Malaria Diagnosis. J Mol Diagn, 2019. 21(5): p. 824–838. doi: 10.1016/j.jmoldx.2019.04.004 [DOI] [PubMed] [Google Scholar]
  • 12.Fu L., et al., Incidence Trends of Five Common Sexually Transmitted Infections Excluding HIV From 1990 to 2019 at the Global, Regional, and National Levels: Results From the Global Burden of Disease Study 2019. Front Med (Lausanne), 2022. 9: p. 851635. doi: 10.3389/fmed.2022.851635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Torrone E.A., et al., Correction: Prevalence of sexually transmitted infections and bacterial vaginosis among women in sub-Saharan Africa: An individual participant data meta-analysis of 18 HIV prevention studies. PLoS Med, 2018. 15(6): p. e1002608. doi: 10.1371/journal.pmed.1002608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Unemo M., et al., Sexually transmitted infections: challenges ahead. Lancet Infect Dis, 2017. 17(8): p. e235–e279. doi: 10.1016/S1473-3099(17)30310-9 [DOI] [PubMed] [Google Scholar]
  • 15.World Health Organization, Global health sector strategy on sexually transmitted infections 2016–2021: toward ending STIs. In Global health sector strategy on sexually transmitted infections 2016–2021: toward ending STIs, 2016. [Google Scholar]
  • 16.Choudhri Y., et al., Gonorrhea in Canada, 2010–2015. Can Commun Dis Rep, 2018. 44(2): p. 37–42. doi: 10.14745/ccdr.v44i02a01 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kenyon C., et al., Management of asymptomatic sexually transmitted infections in Europe: towards a differentiated, evidence-based approach. Lancet Reg Health Eur, 2023. 34: p. 100743. doi: 10.1016/j.lanepe.2023.100743 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Rieg G., et al., Asymptomatic sexually transmitted infections in HIV-infected men who have sex with men: prevalence, incidence, predictors, and screening strategies. AIDS Patient Care STDS, 2008. 22(12): p. 947–54. doi: 10.1089/apc.2007.0240 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Derbie A., et al., Azithromycin resistant gonococci: a literature review. Antimicrob Resist Infect Control, 2020. 9(1): p. 138. doi: 10.1186/s13756-020-00805-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fouts A.C. and Kraus S.J., Trichomonas vaginalis: reevaluation of its clinical presentation and laboratory diagnosis. J Infect Dis, 1980. 141(2): p. 137–143. doi: 10.1093/infdis/141.2.137 [DOI] [PubMed] [Google Scholar]
  • 21.Mayta H., et al., 18S ribosomal DNA-based PCR for diagnosis of Trichomonas vaginalis. J Clin Microbiol, 2000. 38(7): p. 2683–7. doi: 10.1128/JCM.38.7.2683-2687.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Heine P. and McGregor J.A., Trichomonas vaginalis: a reemerging pathogen. Clin Obstet Gynecol, 1993. 36(1): p. 137–44. doi: 10.1097/00003081-199303000-00019 [DOI] [PubMed] [Google Scholar]
  • 23.Nathan B., et al., Microscopy outperformed in a comparison of five methods for detecting Trichomonas vaginalis in symptomatic women. Int J STD AIDS, 2015. 26(4): p. 251–6. doi: 10.1177/0956462414534833 [DOI] [PubMed] [Google Scholar]
  • 24.Dhama K., et al., Loop-mediated isothermal amplification of DNA (LAMP): a new diagnostic tool lights the world of diagnosis of animal and human pathogens: a review. Pak J Biol Sci, 2014. 17(2): p. 151–66. doi: 10.3923/pjbs.2014.151.166 [DOI] [PubMed] [Google Scholar]
  • 25.Shone J., et al., A Scottish multi-centre service evaluation examining the prevalence and diagnosis of Trichomonas vaginalis in symptomatic women attending sexual health clinics. Int J STD AIDS, 2016. 27(12): p. 1066–1070. doi: 10.1177/0956462415606850 [DOI] [PubMed] [Google Scholar]
  • 26.Taylor S., et al., Validation of a New High-Throughput BD COR System Using the BD CTGCTV2 Assay. J Mol Diagn, 2022. 24(5): p. 485–493. [DOI] [PubMed] [Google Scholar]
  • 27.Schirm J., et al., Trichomonas vaginalis detection using real-time TaqMan PCR. J Microbiol Methods, 2007. 68(2): p. 243–7. doi: 10.1016/j.mimet.2006.08.002 [DOI] [PubMed] [Google Scholar]
  • 28.Lawing L.F., Hedges S.R., and Schwebke J.R., Detection of trichomonosis in vaginal and urine specimens from women by culture and PCR. J Clin Microbiol, 2000. 38(10): p. 3585–8. doi: 10.1128/JCM.38.10.3585-3588.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Notomi T., et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000. 28(12): p. E63. doi: 10.1093/nar/28.12.e63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mori Y. and Notomi T., Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J Infect Chemother, 2009. 15(2): p. 62–9. doi: 10.1007/s10156-009-0669-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tomita N., et al., Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc, 2008. 3(5): p. 877–82. doi: 10.1038/nprot.2008.57 [DOI] [PubMed] [Google Scholar]
  • 32.Wong Y.P., et al., Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms. J Appl Microbiol, 2018. 124(3): p. 626–643. doi: 10.1111/jam.13647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Reyes J.C., Solon J.A., and Rivera W.L., Development of a loop-mediated isothermal amplification assay for detection of Trichomonas vaginalis. Diagn Microbiol Infect Dis, 2014. 79(3): p. 337–41. doi: 10.1016/j.diagmicrobio.2014.03.016 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Adriana Calderaro

19 Nov 2024

PONE-D-24-18894Highly Sensitive Molecular Assay Based on Identical Multi-Repeat Sequence (IMRS) Algorithm for the Detection of Trichomonas vaginalis InfectionPLOS ONE

Dear Dr. Gitaka,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jan 03 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Adriana Calderaro

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1.  Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf  and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

The American Journal Experts (AJE) (https://www.aje.com/) is one such service that has extensive experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. Please note that having the manuscript copyedited by AJE or any other editing services does not guarantee selection for peer review or acceptance for publication.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)”

3. Thank you for stating the following financial disclosure:

“This research was supported by the Royal Society, Future Leaders African Independent Researchers (FLAIR) Scheme (FLR\\R1\\201314) to JG”

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

4. When completing the data availability statement of the submission form, you indicated that you will make your data available on acceptance. We strongly recommend all authors decide on a data sharing plan before acceptance, as the process can be lengthy and hold up publication timelines. Please note that, though access restrictions are acceptable now, your entire data will need to be made freely accessible if your manuscript is accepted for publication. This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If you are unable to adhere to our open data policy, please kindly revise your statement to explain your reasoning and we will seek the editor's input on an exemption. Please be assured that, once you have provided your new statement, the assessment of your exemption will not hold up the peer review process.

5. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

6. Please upload a copy of Supporting Information Figures 1-3 which you refer to in your text on page 20.

7. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.  

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript describes a sensitive isothermal amplification technique targeting repetitive sequences on an important pathogen. However, it should have been tested on more clinical samples including vaginal swabs, genital secretions, urine and should also be evaluated against microscopy and culture. Discussion should include few more studies especially those demonstrating a good sensitivity and specificity. Since authors from a commercial entity , the conflict of interest statement should clearly mention the same.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2025 Feb 7;20(2):e0317958. doi: 10.1371/journal.pone.0317958.r002

Author response to Decision Letter 0

2 Jan 2025

Dear Adriana Calderaro

2nd January 2025.

Ref: Submission of revised research article

On behalf of the authors, I extend my gratitude to the reviewer on the substantial input on our submitted manuscript. Indeed, the revised manuscript has been greatly improved.

We have addressed the comments recommended by the reviewer and academic editor as indicated below;

1. However, it should have been tested on more clinical samples including vaginal swabs, genital secretions, urine and should also be evaluated against microscopy and culture.

We are in agreement with the above comment. Our intention was to validate the assay with more clinical samples. We only had access to 17 clinical samples that were used for assay validation. We have acknowledged that this was a limitation to our study (Line 389) and recommended that further validation with more samples is needed. However, to the best level of our knowledge, our study reports a rapid and accurate IMRS PCR assay for T. vaginalis, and the findings presented might positively impact the future development of sensitive assays for detecting parasites T. vaginalis.

2. Discussion should include few more studies especially those demonstrating a good sensitivity and specificity.

Thanks for the comment. We have included two research articles (reference 23 and 24) that highlights the performance characteristics of five different T. vaginalis diagnostic methods (Line 350 - 355).

3. Since authors from a commercial entity, the conflict of interest statement should clearly mention the same.

Thanks for the suggestion. Our conflict-of-interest statement has been revised accordingly to include authors affiliated to the commercial company (Line 420).

4. Ethics statement.

The ethics statement only appears in the methodology section of the manuscript. Line 264.

5. Financial disclosure statement

Thanks for the suggestion. The financial statement has been revised as suggested (Line 427 - 429).

6. Supporting figures.

Supporting Figures 1 – 3 have been uploaded as suggested. Raw Gel images have also been uploaded and are available on this link https://doi.org/10.5281/zenodo.14589291.

Sincerely,

Clement Shiluli,

Mount Kenya University, Main Campus

Thika, Kenya

Decision Letter 1

Adriana Calderaro

7 Jan 2025

Highly Sensitive Molecular Assay Based on Identical Multi-Repeat Sequence (IMRS) Algorithm for the Detection of Trichomonas vaginalis Infection

PONE-D-24-18894R1

Dear Dr. Gitaka,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Adriana Calderaro

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Thanks to have responded to the reviewers' comments.

Reviewers' comments:

Acceptance letter

Adriana Calderaro

27 Jan 2025

PONE-D-24-18894R1

PLOS ONE

Dear Dr. Gitaka,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

MD, PhD, Full Professor Adriana Calderaro

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Image of 10-fold serially diluted (1 and 28, 100bp ladder 2–100, 3–10, 4–1, 5–0.1, 6–0.01, 7–0.01, 8–0.001, 9–0.0001, 10–10−4, 11–10−5, 12, - 10−6, 13–10−7, 14–10−8, 15–10−9, 16–10−10, 17–10−11, 18–10−12, 19–10−13, 20–10−14, 21–10−15, 22–10−16, 23–10−17, 24–10−18, 25 -,10−19 26-10-20 and 27 -Non Template Control (NTC) (pg/μl) genomic Trichomonas vaginalis DNA amplicons resolved on 2% gel using IMRS primers.

    (TIF)

    pone.0317958.s001.tif (1.2MB, tif)
    S2 Fig. Image of 10-fold serially diluted (1, 100bp ladder 2–100, 3–10, 4–1, 5–0.1, 6–0.01, 7–0.01, 8–0.001, 9–0.0001, 10 –Non Template Control (NTC) (pg/μl) genomic Trichomonas vaginalis DNA amplicons resolved on 2% gel using gold standard 18S rRNA PCR primers.

    (TIF)

    pone.0317958.s002.tif (511.3KB, tif)
    S3 Fig. 2% gel image of PCR confirmed Trichomonas vaginalis negative samples numbers 2–10, and 12–19 and 20 Non Template Control (NTC) (pg/μl).

    Well number 1 and 11 is 100bp ladder.

    (TIFF)

    pone.0317958.s003.tiff (857.7KB, tiff)

    Data Availability Statement

    Some relevant data has been provided via the manuscript and its Supporting Information files. Other data has been deposited in a repository. All raw data has been uploaded on Zenodo https://doi.org/10.5281/zenodo.14589291. All supplementary data has been uploaded on Zenodo https://doi.org/10.5281/zenodo.11176058.

    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES