Abstract
Background
Human umbilical cord mesenchymal stem cells (hUC-MSCs) have great potential for treating autoimmune diseases for their immunomodulatory and tissue-regenerative abilities; however, their therapeutic role in neuromyelitis optica spectrum disorder (NMOSD) remains uncertain.
Methods
106 hUC-MSCs prepared in 200 μl PBS were intravenously administered to a systemic NMOSD model on day 10 and day 14 after immunization. Then, disease progression, immune responses, and blood–brain barrier integrity were evaluated. Additionally, we tested the effects of hUC-MSCs on astrocyte viability and apoptosis using an aquaporin 4 (AQP4) IgG and complement-induced cytotoxicity model in vitro.
Results
hUC-MSCs alleviated NMOSD progression in vivo with improved motor function, reduced inflammatory infiltration, myelin loss, and preservation of astrocytes and neurons. hUC-MSC treatment did not affect autoimmune reactions in the spleen, however, decreased cytokine release in the spinal cord and mitigated blood–brain barrier disruption. Furthermore, in vitro studies revealed that co-culture with hUC-MSCs significantly restored astrocyte viability and reduced apoptosis in AQP4 IgG and complement-mediated damage.
Conclusion
Our results revealed that hUC-MSCs displayed therapeutic efficacy in NMOSD and showed potential in attenuating blood–brain barrier disruption, as well as AQP4 IgG and complement-induced astrocyte apoptosis.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13287-025-04187-8.
Keywords: Aquaporin 4, Astrocyte, Mesenchymal stem cells, Neuromyelitis optica spectrum disorder, Umbilical cord
Background
Neuromyelitis optica spectrum disorder (NMOSD) is a chronic, severe, autoimmune demyelinating disease of the central nervous system (CNS) that primarily affects the spinal cord and optic nerves [1, 2]. It is characterized by recurrent optic neuritis and longitudinally extensive transverse myelitis [1, 2]. NMOSD is a rare disease with a global incidence of approximately 0.039–0.73/100,000 and is more prevalent in young and middle-aged females, with a male-to-female incidence ratio of about 1:9 [3, 4]. Although the incidence of NMOSD is low, it is associated with high relapse rates and disability. Disease relapse leads to aggravated neurological dysfunction and decreased quality of life, which imposes a heavy burden on both the individual and society [1].
In most cases, NMOSD is caused by autoantibodies targeting the aquaporin 4 water channel (AQP4), which is mainly expressed on astrocytes in the CNS [1]. Due to impaired immune tolerance, AQP4 is recognized as a foreign antigen, and naïve B cells are abnormally activated, transforming into plasma cells and secreting AQP4 IgG [2]. AQP4 IgG enters the CNS and binds to the AQP4 antigen on the surface of astrocytes, leading to antibody- and complement-dependent cytotoxicity [2]. Simultaneously, the inflammatory process also damages surrounding oligodendrocytes and neurons, leading to demyelination and axonal damage [5, 6].
NMOSD therapy includes acute treatment and prevention of long-term relapse. Long-term relapse prevention is important in NMOSD treatment to decrease the relapse rate and inhibit aggravation of neurological dysfunction [7]. Most drugs, such as azathioprine and mycophenolate work by suppressing the immune response. There are also an increasing number of monoclonal drugs targeting B cells, complement activation pathway, IL-6 pathway, et al. [7]. Despite the wide variety of drugs used to prevent recurrence, some patients experience relapse, leading to severe functional disabilities. Moreover, most current drugs are immunosuppressive, which may cause side effects, such as infection [8]. Therefore, it is important to explore novel drugs for the treatment of NMOSD patients.
Mesenchymal stem cells (MSCs) are stem cells derived from the mesoderm with self-renewal capacity and multipotency. MSCs are widely distributed and can be found in the umbilical cord, bone marrow, and adipose tissue, et al. [9–11]. In recent years, MSCs have been increasingly explored for the treatment of autoimmune diseases because of their low immunogenicity, anti-inflammatory and anti-apoptotic features, and their safety and efficacy have been explored in basic research and clinical studies of autoimmune diseases, such as systemic lupus erythematosus, type I diabetes, and multiple sclerosis [12–14]. Human umbilical cord mesenchymal stem cells (hUC-MSCs) are promising for clinical applications owing to the following advantages: (1) wide range of sources and easy access, (2) weaker immunogenicity; (3) stronger immunomodulatory effects and (4) stronger proliferation ability [15–17]. Two pilot, observational clinical studies have explored the safety and efficacy of administering bone marrow MSCs or hUC-MSCs in NMOSD patients and showed potential therapeutic effects [18, 19]. However, evidence regarding the efficacy and mechanism of hUC-MSC therapy in NMOSD animal model remains insufficient.
In this study, we aimed to investigate the therapeutic effects of hUC-MSCs in a systemic NMOSD mouse model. We successfully established an NMOSD mouse model and first applied hUC-MSCs therapy in this model. Our results demonstrated that hUC-MSCs significantly alleviated motor disorders and pathological manifestations as well as decreasing spinal cord inflammatory cell infiltration and blood–brain barrier (BBB) disruption. Additionally, our study revealed that hUC-MSCs inhibited AQP4 IgG- and complement-induced astrocyte apoptosis for the first time. Collectively, our study highlights that hUC-MSC treatment may be an effective therapy for NMOSD.
Methods
Animals
In this study, 8–10 weeks-old female C57BL/6 mice were purchased from Charles River and housed in the animal facilities of Shanghai Model Organisms. All mice were housed in a temperature- and humidity-controlled room and were kept in regular cages under a 12/12 h light/dark cycle. All mice were fed with standard food and water. No sample size calculation was performed; sample sizes were chosen based on previous in vivo experiments done in the laboratory to allow for statistical power. Mice were allocated to groups randomly using a random number generator. The order of treatments and measurements for each mouse were randomly assigned. A total of 65 C57BL/6 mice were used. 12 C57BL/6 mice were used for the purpose of establishing the NMOSD mice model (EAE: n = 6; NMOSD: n = 6) and 53 C57BL/6 mice were used for the purpose of assessing the therapeutic effects of hUC-MSCs (CFA + PTX: n = 12, NMOSD + PBS: n = 18; NMOSD + MSC: n = 23). All animals were used in the analysis. During the outcome evaluation and data analysis stage, the group allocation was made known. All procedures have been approved by the ethics committee of Shanghai Model Organisms (IACUC 2024-0021-1). The work has been reported in line with the ARRIVE guidelines 2.0.
Extraction of human IgG
In this study, the plasma exchange fluid of an NMOSD patient and the plasma of a healthy donor were collected. The patient was in the acute phase of an attack and received double-filtration plasmapheresis. A total of 200 ml plasma exchange fluid was collected. The informed consents were obtained. The plasma exchange fluid and the plasma were diluted 1:10 and 1:6 respectively with 1 × Melon Gel Purification Buffer (Thermo Fisher, USA). IgG was extracted using IgG purification kit (Thermo Fisher, USA) according to instructions. The concentration of IgG from plasma exchange fluid of NMOSD patients or plasma of healthy donors was quantified using BCA Protein Assay Kits (Thermo Fisher, USA) and the concentration is 9–10 mg/ml. The tilter of AQP4 IgG is 1:1000 using cell-based indirect immunofluorescence assays in Simplegen institution. Then purified IgG was inactivated at 56 °C. Finally, IgG was filtered with 0.22 μm sterile filters and stored at −80 °C. The extracted antibody was used within 1 year after extraction.
hUC-MSCs acquisition and characterization
hUC-MSCs were purchased from Guangzhou SALIAI Stem cell Science and Technology Co.Ltd. The processes including isolation, culture, identification, quality control, and storage of hUC-MSCs were strictly conformed to standard operating procedures. P6 hUC-MSCs were used for in vivo and in vitro studies. All hUC-MSCs used in this study were from one healthy donor. The characterization of hUC-MSCs was assessed by flow cytometer. Briefly, P6 hUC-MSCs were collected and labeled with the following antibodies: FITC-anti-HLA-DR, -anti-CD45, -anti-CD73, -anti-CD34, APC-anti-CD90, -anti-CD19, -anti-CD105, -anti-CD11b (Biolegend, USA, 1:400) at 4 °C for 30 min. After two washing steps, cells were acquired with a flow cytometer (BD FACS CELESTA, USA) and analyzed with Flowjo 10 software.
Construction of EAE/NMOSD model and MSC treatment
NMOSD mice model was constructed by continuous intraperitoneal injection of AQP4 IgG into EAE mice. For EAE model, 0.3 mg/ml MOG35–55 (GL Biochem, China) was emulsified in Complete Freund’s Adjuvant (CFA) containing 8 mg/ml H37Ra Mycobacterium tuberculosis (BD DIFCO, USA). Mice were anesthetized by intraperitoneal injection of 2.5% Avertin (Meilunbio, China). Then 200 μl emulsion was injected subcutaneously at two sites in the right and left flank at once. 200 ng pertussis toxin (PTX) (Sigma-Aldrich, USA) in 100ul PBS was injected intraperitoneally at day 0 and day 2. For NMOSD model, EAE mice were intraperitoneally injected with 400 μl AQP IgG from day 7 to day 18. On day 10 and day 14, 106 hUC-MSCs prepared in 200 μl PBS were injected into NMOSD mice intravenously. Control mice received 200 μl PBS. Animals’ clinical scores were assigned as follows: 0 = normal; 0.5 = partial tail paralysis; 1 = entire tail paralysis; 1.5 = entire tail paralysis with unsteady gait; 2 = partial paralysis in hind limbs with the body below the abdomen powerless to land; 2.5 = entire paralysis in one hind limb; 3 = entire paralysis in one hind limb with partial paralysis in another hind limb; 3.5 = entire paralysis in two hind limbs; 4 = entire paralysis in two hind limbs with one forelimb paralysis; 4.5 = entire paralysis in four limbs; 5 = death. On day 19, mice were anesthetized with Avertin and euthanized by cardiac perfusion with PBS. Pathological tissues were obtained for HE staining, LFB staining, immunofluorescence staining and TUNEL staining after PBS and 4% paraformaldehyde perfusion. Spinal cord for protein and RNA extraction was obtained after PBS perfusion.
HE staining and LFB staining
Paraffin sections (2 μm) of lumbar spinal cord was used for HE and LFB staining according to instructions respectively. Briefly, after being dewaxed and rehydrated, the sections were sequentially placed in eosin solution and hematoxylin solution for HE staining, and were incubated in LFB solution at 56 °C overnight and then hydrolyzed for LFB staining. The complete spinal cord was scanned using high throughput digital slice scanning system (Hamamatsu, Japan) and images were obtained under 5× magnification using NDP.view2 software. For HE staining, the level of inflammatory infiltration was assessed as follows: 0: no inflammatory infiltration; 1: only a slight infiltration of inflammatory cells around the blood vessels or spinal cord capsule; 2: small amount of inflammatory cell infiltration in the spinal cord parenchyma; 3: moderate infiltration of inflammatory cells in the spinal cord parenchyma; 4: large infiltration of inflammatory cells in the spinal cord parenchyma. For LFB staining, the area of demyelinating area and white matter were measured using Image J software.
Immunofluorescence staining
After being dewaxed and rehydrated, the sections of lumbar spinal cord were incubated with Tris-EDTA antigen retrieval solution (Solarbio, China) for 30 min at 100 °C and naturally cooled to room temperature. Then, sections were blocked with QuickBlock™ Blocking Buffer (Beyotime, China), incubated with primary antibody overnight at 4 °C and secondary antibody for 2 h at room temperature. Cell nuclei were stained with DAPI (Beyotime, China). The following primary antibodies were used: rabbit anti-AQP4 (1:800, Sigma-Aldrich, USA, MABN2527); mouse anti-glial fibrillary acidic protein (GFAP) (1:400, Cell Signaling Technology, USA, 3670 T); rabbit anti-myelin basic protein (MBP) (1:200, Abcam, USA, ab7349); rabbit anti-NeuN (1:400, Abcam, USA, ab177487). The following fluorescent secondary antibodies were used: goat anti-mouse 488 (1:1000, Beyotime, China); goat anti-rabbit 488 (1:1000, Beyotime, China); goat anti-rabbit 555 (1:1000, Thermo Fisher, USA). Sections were observed by fluorescence microscope (Olympus, USA). The loss area of AQP4, GFAP, MBP and the number of NeuN+ cells were measured using Image J software.
TUNEL staining
After being dewaxed and rehydrated, the sections of lumbar spinal cord were incubated with 20 μg/ml proteinase K (Beyotime, China). TUNEL working solution was prepared according to instructions (Beyotime, China). Then, sections were incubated with working solution for 1 h at 37 °C. Cell nuclei were stained with DAPI (Beyotime, China). Sections were observed by fluorescence microscope (Olympus, USA). The number of TUNEL+ cells were counted using Image J software.
Magnetic Resonance Imaging (MRI) scanning
MRI scanning was conducted on day 19 after modeling. Mice were anesthetized using isoflurane (RWD, China) during MRI. MRI scanning of spinal cord and optic nerves were performed with a 7-T small-animal MRI instrument (BioSpec70/20USR, Bruker, Biospin, Ettlingen, Germany). T2-weighted images were acquired.
Quantitative real time-PCR
Total RNA was extracted with Trizol (Abconal, China) according to instructions from spinal cord and spleen cells. Reverse transcription was conducted using Hiscript III RT Supermix for PCR (Vazyme, China) and real-time PCR was performed using qPCR SYBR Master Mix (Vazyme, China) according to instructions. GAPDH served as an internal reference. Relative expression of genes was calculated as 2−ΔΔCt. Primer sequences are listed in Table 1.
Table 1.
Primer sequences used in the experiment
| Gene | Forward sequence (5′–3′) | Reverse sequence (5′–3′) |
|---|---|---|
| Gapdh | ggttgtctcctgcgacttca | tggtccagggtttcttactcc |
| Il-6 | taccacttcacaagtcggaggc | ctgcaagtgcatcatcgttgttc |
| Ifn-γ | tcatggctgtttctggctgt | tccttttgccagttcctcca |
| Il-17a | tttaactcccttggcgcaaaa | ctttccctccgcattgacac |
| Il-10 | gctcttactgactggcatgag | cgcagctctaggagcatgtg |
Western blotting
The total protein content of spinal cord tissues was isolated using radioimmunoprecipitation assay lysis buffer and then qualified using a BCA kit (Thermo Fisher, USA). Equal amounts of protein were loaded onto SDS–polyacrylamide gel and then transferred to polyvinylidene difluoride membranes membranes. Membranes were blocked with blocking solution (Epizyme Biotech, China) and incubated with primary antibody (Occludin, 1:2500, abmart, China, T55997; GAPDH, 1:10,000, abcam, USA, ab8245) overnight at 4 °C, followed by a 1 h incubation of secondary antibody. An enhanced chemiluminescence kit (Epizyme Biotech, China) was used to detect the protein signals. Protein was quantified using Image J software.
Astrocytes isolation and culture
Astrocytes were generated from the cerebral cortex of 1-day-old mice. A total of 20–30 mice were used for the experiment. Briefly, cerebral hemispheres were isolated, cut into pieces and incubated in 0.125% trypsin–EDTA at 37 °C for 15 min. Mixed cortical glial cells were passed through a 70-um cell strainer, and then centrifuged and resuspended in Dulbecco's Modified Eagle Medium containing 4.5 g/L D-Glucose, 4 mM L-Glutamine,10% FBS and 1% penicillin/streptomycin. Cells grown at 37 °C in a 5% CO2 incubator. After confluence, cells were purified by shaking in a rotator at 260 rpm for 5 h. P1 astrocytes were used for the study. Cell purity was identified by GFAP immunofluorescence staining and GFAP + cells > 90% (Additional file 1: Figure S1).
Complement-dependent cytotoxicity and hUC-MSC coculture
Astrocytes were exposed to 10% healthy control or AQP4 IgG for 1 h at 4 °C [20]. Then, 2% human complement (Innovative Research, USA) was added and cells were incubated at 37 °C for 18 h for the CCK8 test. Astrocytes were seeded to the lower chamber of the transwell on the day before coculture. When astrocytes were exposed to AQP4 IgG and complement, hUC-MSCs were cocultured with astrocytes for 48 h.
CCK8
The culture medium was replaced with fresh Dulbecco's Modified Eagle Medium containing 10% CCK8 (Dojindo, Japan) and cells were incubated at 37 °C for 2–4 h. Absorbance was read at 450 nm with a Microplate Reader. Cell viability was calculated as follows: test group—blank group/control group—blank group.
Annexin V/PI staining
Cells were harvested with accutase, collected into the centrifugation tube and washed with PBS. Cells were stained with the annexin V/PI detection kit (Multi Sciences, China) according to instructions. Data were acquired with flow cytometry (BD FACS CELESTA, USA) and were analyzed using Flowjo 10 software.
Statistical analysis
Statistical analysis was performed with GraphPad Prism 9 software. The results are expressed as mean ± SEM. For two-group comparison, t-test was used for normally distributed data and nonparametric test was used for non-normally distributed data. For multiple comparisons, ANOVA (one-way) was performed. p < 0.05 was considered statistically significant.
Results
Establishment of NMOSD mouse model
Plasma exchange is an effective treatment for the acute phase of NMOSD, and high titers of AQP4 antibodies can be found in plasma exchange fluids. AQP4 IgG was extracted from plasma exchange fluids of an NMOSD patient. Then, we established the NMOSD model by continuous injection of AQP4 IgG intraperitoneally into EAE mice (Fig. 1A). Both EAE and NMOSD mice showed typical motor dysfunction, and no significant differences in clinical scores were observed between the two groups (Fig. 1B). The mice were sacrificed on day 19. As indicated by the white arrow, the immunofluorescence result showed a prominent loss of AQP4 and GFAP expression in NMOSD mice compared to that in EAE mice, which is a characteristic pathological feature of NMOSD (Fig. 1C). Therefore, the NMOSD mice model was successfully established.
Fig. 1.
Establishment of NMOSD model. (A) Schematic diagram and experimental procedures for NMOSD model. (B) Clinical scores of EAE and NMOSD mice (n = 3 in each group). (C) Immunofluorescence of AQP4 (red) and GFAP (green) in the spinal cord from EAE and NMOSD mice. Cell nuclei are labeled by DAPI staining (blue). Scale bar 200 μm. White arrow: loss area of AQP4 and GFAP. (data = mean ± SEM, ns represents no significant difference between the two groups)
hUC-MSC treatment ameliorates the disease progression in NMOSD mice
The characterization of hUC-MSCs was assessed by flow cytometer (Additional file 1: Figure S2). 106 P6 hUC-MSCs were prepared in PBS and injected into the tail vein on day 10 and 14 after NMOSD induction. Clinical signs of the disease were monitored daily. We found that the incidence was 100% in PBS-treated mice but only 50% in MSC-treated mice. MSC-treated NMOSD mice showed a significant improvement in clinical scores (Fig. 2A). To investigate the effects of hUC-MSCs on demyelination and inflammation in the spinal cord of NMOSD mice, the mice were sacrificed on day 19. HE staining showed that MSC-treated mice had fewer infiltrating inflammatory cells in the lumbar spinal cord and the inflammation score was lower than that of PBS-treated mice (Fig. 2B, E). In addition, LFB and MBP immunofluorescence were conducted to examine changes in demyelination. As shown in Fig. 2C, D, both LFB and immunofluorescence of MBP showed improved myelin loss in MSC-treated mice. Furthermore, the area of myelin loss in the spinal cord of MSC-treated mice was significantly reduced (Fig. 2F, G). On day 19, a 7.0-T small-animal MRI was performed to examine optic neuritis and myelitis. MRI revealed longitudinally high signals on T2WI in the spinal cord of NMOSD mice, whereas the lesion was unclear in MSC-treated mice (Fig. 3A). Moreover, high signals were observed in the optic nerves of NMOSD mice and the signal intensity of the lesions was attenuated in MSC-treated mice (Fig. 3B). Collectively, these findings showed that hUC-MSC treatment ameliorated disease progression in NMOSD mice.
Fig. 2.
Effects of hUC-MSCs on clinical score and pathological manifestations of NMOSD mice. (A) Clinical scores of NMOSD mice with PBS or hUC-MSC treatment (NMOSD + PBS, n = 5; NMOSD + MSC, n = 8). (B) HE staining images of the lumbar spinal cord from NMOSD mice with PBS or hUC-MSC treatment. Scale bar 100 μm. (C) LFB staining images of the lumbar spinal cord from NMOSD mice with PBS or hUC-MSC treatment. Scale bar 100 μm. (D) Immunofluorescence images of MBP (green) in lumbar spinal cord from NMOSD mice with PBS or hUC-MSC treatment. Cell nuclei are labeled by DAPI staining (blue). Scale bar 200 μm. (E) The statistical analysis of inflammation scores for HE staining (NMOSD + PBS, n = 4; NMOSD + MSC, n = 5). (F, G) The statistical analysis of myelin loss area for LFB staining and MBP IF staining (NMOSD + PBS, n = 4; NMOSD + MSC, n = 5). (data = mean ± SEM, *represents a significant difference, *p < 0.05, **p < 0.01, ****p < 0.0001)
Fig. 3.

Effects of hUC-MSCs on MRI presentation of NMOSD mice. (A) MRI presentation of the spinal cord of healthy mice and NMOSD mice with PBS or hUC-MSC. (B) MRI presentation of the optic nerves of healthy mice and NMOSD mice with PBS or hUC-MSC
hUC-MSC treatment attenuates astrocyte and neuron injury in NMOSD mice
Astrocyte impairment is the core pathological feature of NMOSD. Compared to healthy mice, immunofluorescence revealed a marked decrease in AQP4 and GFAP levels in lumbar spinal cord of NMOSD mice as indicated by the white arrow. However, a significant reduction of AQP4 and GFAP loss was observed in MSC-treated NMOSD mice (Fig. 4A, B, p = 0.03). We performed immunofluorescence staining for NeuN to assess the level of neuron loss in NMOSD mice. We found that the number of NeuN+ cells was significantly lower in NMOSD mice than that in healthy mice, whereas the number of NeuN+ cells was elevated in MSC-treated NMOSD mice (Fig. 4C, D). These results showed that hUC-MSCs attenuated astrocyte and neuron injury in NMOSD mice.
Fig. 4.
Effects of hUC-MSCs on astrocytes and neurons in NMOSD mice. (A) Immunofluorescence images of AQP4 (red) and GFAP (green) in the lumbar spinal cord from healthy mice and NMOSD mice with PBS or hUC-MSC treatment. Cell nuclei are labeled by DAPI staining (blue). White arrow: loss area of AQP4 and GFAP. (B) The statistical analysis of AQP4 and GFAP loss area (NMOSD + PBS, n = 4; NMOSD + MSC, n = 5). (C) Immunofluorescence images of NeuN (green) in the lumbar spinal cord from healthy mice and NMOSD mice with PBS or hUC-MSC treatment. Cell nuclei are labeled by DAPI staining (blue). (D) The statistical analysis of the number of NeuN + cells per gray matter area (CFA + PTX, n = 3; NMOSD + PBS, n = 4; NMOSD + MSC, n = 5). Scale bar 200 μm. (data = mean ± SEM, *represents a significant difference, *p < 0.05, **p < 0.01)
hUC-MSC treatment inhibits central inflammatory infiltration and protects the blood–brain barrier
The immunomodulatory property is a function feature of MSCs. Thus, we examined the expression levels of inflammatory cytokines in the spleen cells using qRT-PCR. The expression levels of Il-6, Ifn-γ, Il-17a, and Il-10 were significantly increased in the spleen cells of NMOSD mice compared with healthy mice. However, the levels of these inflammatory cytokines in MSC-treated NMOSD mice were not different from those in PBS-treated NMOSD mice, suggesting that hUC-MSC treatment did not attenuate the inflammatory process in the spleen (Fig. 5A–D). We extracted RNA from mouse spinal cord tissues and measured the expression levels of inflammatory cytokines using qRT-PCR. Results showed that the expression levels of Il-6, Ifn-γ, Il-17a, and Il-10 in the spinal cord of NMOSD mice were increased compared with healthy mice, whereas the expression levels of Il-6, Ifn-γ, and Il-17a in MSC-treated NMOSD mice were significantly decreased compared with PBS-treated NMOSD mice (Fig. 5E–H). These results indicated that hUC-MSCs may inhibit the infiltration of peripheral inflammatory cells into the spinal cord, thereby reducing central inflammation and exerting therapeutic effects. The BBB plays a crucial role in inhibiting central inflammatory infiltration. We further examined the expression levels of the BBB permeability indicator: occludin using western blotting. The result showed that the expression level of occludin in the spinal cords of MSC-treated NMOSD mice was significantly higher than that in PBS-treated NMOSD mice, indicating that hUC-MSCs play a role in protecting the BBB (Fig. 5I, J). Overall, these data showed that hUC-MSCs did not inhibit the peripheral inflammatory process, but reduced CNS inflammation and attenuated the blood–brain barrier disruption.
Fig. 5.
The effects of hUC-MSC on the inflammatory process and blood–brain barrier. (A–D) The mRNA expression levels of Il-6, Ifn-γ, Il-17a and Il-10 in the spleen cells of mice. (CFA + PTX, n = 3; NMOSD + PBS, n = 5; NMOSD + MSC, n = 5) (E–F) The mRNA expression levels of Il-6, Ifn-γ, Il-17a and Il-10 in the spinal cord of mice. (CFA + PTX, n = 3; NMOSD + PBS, n = 5; NMOSD + MSC, n = 5) (I–J) Western blot analysis of blood–brain barrier in the spinal cord of mice. (CFA + PTX, n = 3; NMOSD + PBS, n = 4; NMOSD + MSC, n = 5). Full-length blots are presented in Additional file 2. (data = mean ± SEM, ns represents no statistical difference, *represents a significant difference, *p < 0.05, **p < 0.01)
hUC-MSC treatment inhibits AQP4 IgG-induced astrocyte apoptosis
In-vivo study showed that hUC-MSC treatment mitigated astrocyte damage in NMOSD mice. We further investigated whether hUC-MSCs protected against AQP4 IgG-induced astrocyte injury in vitro. Consistent with previous findings [20, 21], we found that AQP4 IgG significantly reduced astrocyte viability only in the presence of complement (Fig. 6A). Primary astrocytes were co-cultured with hUC-MSCs for 48 h in a transwell system. The CCK8 assay revealed that hUC-MSC co-culture significantly enhanced the viability of astrocytes (Fig. 6B). In addition, the level of cell death and apoptosis were investigated by annexin V/PI staining. Compared to healthy control IgG, AQP4 IgG induced a large amount of cell apoptosis after 48 h of incubation, whereas no significant difference was observed in the proportion of cell death (Fig. 6C–E). Co-culture with hUC-MSCs significantly reduced the apoptosis level of astrocytes (Fig. 6C, E). We further performed TUNEL staining on mouse spinal cord slices to detect the level of apoptosis in vivo. The results showed that TUNEL + apoptotic cells in the spinal cord were significantly reduced in MSC-treated NMOSD mice compared with PBS-treated NMOSD mice, which is consistent with the results of the in vitro studies (Fig. 6F, G). Overall, these results indicate that hUC-MSCs suppressed AQP4 IgG and complement-induced apoptosis in vitro and inhibited apoptosis in the spinal cord of NMOSD mice in vivo.
Fig. 6.
Analysis of the impact of hUC-MSCs on astrocyte apoptosis. (A) Evaluation of AQP4 IgG on the astrocyte viability with or without complement by CCK 8. HC IgG: healthy control IgG; C: complement. (B) Effects of hUC-MSC co-culture on astrocyte viability. (C–E) Effects of hUC-MSC coculture on dead cells and apoptosis cells of astrocytes measured by flow cytometer. (F) Fluorescence images of TUNEL (red) in the lumbar spinal cord from healthy mice and NMOSD mice with PBS or hUC-MSC treatment. Cell nuclei are labeled by DAPI staining (blue). Scale bar 200 μm. (G) The statistical analysis of TUNEL + apoptosis cells per spinal area (NMOSD + PBS, n = 4; NMOSD + MSC, n = 5). (data = mean ± SEM, ns represents no statistical difference, *represents a significant difference, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)
Discussion
NMOSD is characterized by a high relapse rate and prevalence of disability. Generic oral immunosuppressants and monoclonal antibodies that target B cells, the IL-6 pathway, or the complement activation pathway are the major long-term relapse prevention treatments. However, some patients still can’t benefit from these treatments and experience relapse, resulting in severe disability. Several studies have shown that MSCs exhibit therapeutic potential in various autoimmune diseases, such as multiple sclerosis, systemic lupus erythematosus, and rheumatoid arthritis [12, 14, 22]. Besides, several clinical studies applied bone marrow MSCs or hUC-MSCs in the treatment of NMOSD patients and showed potential therapeutic effects [18, 19]. Previous studies reported the therapeutic effects of hUC-MSC transplantation in animal models of multiple sclerosis: EAE [23, 24]. However, there is relatively little research on the role of hUC-MSCs in the disease course in animal models of NMOSD.
It is reported that hUC-MSCs ameliorated motor dysfunction in an NMOSD animal model via passive transfer of AQP4 IgG to mice with BBB damage induced by CFA and PTX [25]. In our study, we constructed an NMOSD mouse model by continuous intraperitoneal injection of AQP4 IgG based on EAE. Although it cannot completely mimic the production of AQP4 IgG, it can partially simulate AQP4 IgG-mediated astrocyte injury, and mice have typical motor dysfunction, which makes it easy to observe the therapeutic effects of hUC-MSCs. Similar to previous findings, hUC-MSCs significantly reduced the incidence and improved motor dysfunction in NMOSD mice [25]. In addition, 7.0 T MRI was performed to obtain a three-dimensional view of the overall lesion. We observed that NMOSD mice exhibited long-segment myelitis and optic neuritis, whereas hUC-MSC-treated NMOSD mice showed a significant reduction in both myelitis and optic neuritis, further providing strong evidence for the therapeutic effect of hUC-MSCs on NMOSD.
Immunomodulatory function is a property of MSCs. In an in vivo study of experimental autoimmune cholangitis treated with hUC-MSCs, significant down-regulation of serum levels of IFN-γ and IL-17A was observed [26]. In vitro, hUC-MSCs reduced the expression of pro-inflammatory cytokines, such as IFN-γ and IL-6 in activated T-lymphocytes [27]. These findings demonstrated the immunomodulatory potential of hUC-MSCs. However, we found that hUC-MSC treatment did not affect the inflammatory response in the spleen by examining the levels of cytokine expression, which is unexpected. Previous studies have shown that the immunoregulatory function of MSCs is affected by their inflammatory environment [28, 29], [30]. For example, IFN-γ enhanced the immunoregulatory function of MSCs by promoting the secretion of indoleamine-2,3-dioxygenase [28, 29], whereas transforming growth factor-β could inhibit the secretion of inducible nitric oxide synthase and weaken the immunoregulatory potential of MSCs [30]. Therefore, we hypothesized that the immunoregulatory capacity of hUC-MSCs is diminished in the inflammatory environment of the NMOSD mouse model and thus failed to modulate peripheral immune responses. However, the factors that influence the immunomodulatory capacity of hUC-MSCs remain unclear and require further investigation.
Although hUC-MSCs did not affect peripheral inflammatory responses in NMOSD mice, we observed reduced infiltrated inflammatory cells and decreased inflammatory factor expression in the spinal cord of MSC-treated mice. These results indicate that hUC-MSCs inhibit inflammatory infiltration in the spinal cord of NMOSD mice. The BBB plays a key role in this process and we found that the level of BBB disruption was significantly reduced in the spinal cord of MSC-treated NMOSD mice, indicating the protective role of hUC-MSCs in the BBB. This result is consistent with previous studies showing that hUC-MSCs protect the BBB in other disease models, such as spinal cord injury and EAE [31–33]. hUC-MSCs have been reported to increase the expression of tight junction proteins and decrease the expression of matrix metalloproteinases, which have a destructive effect on the BBB [31–33]. Collectively, the protective effect of hUC-MSCs on the BBB effectively inhibits the infiltration of inflammatory factors from the periphery into the spinal cord, thus reducing the level of inflammation and damage to CNS-resident cells.
Another property of MSCs is their capacity for tissue repair. AQP4 IgG-induced astrocyte injury is a core pathological feature of NMOSD. Therefore, we investigated the role of hUC-MSCs in this process. We found that AQP4 IgG induced astrocyte cytotoxicity in a complement-dependent manner, which is consistent with previous studies [20, 34]. Furthermore, in vitro hUC-MSC co-culture significantly promoted astrocyte survival and reduced apoptosis. Treatment with hUC-MSCs also suppressed apoptosis in the spinal cords of NMOSD mice in vivo. These results indicated that hUC-MSCs played a protective role in the process of AQP4 IgG- and complement-induced astrocyte injury and showed anti-apoptotic effects. Previous studies have mostly focused on the protective role of MSCs in promoting oligodendrocyte and neuron differentiation as well as suppressing oligodendrocyte and neuron apoptosis [24, 35–38], while their effects on astrocyte apoptosis are less explored. BM-MSCs have been reported to inhibit astrocyte apoptosis in a glyoxylate stripping model in vitro [39], which is consistent with our results. Collectively, hUC-MSCs showed anti-apoptotic effects and great potential for the treatment of NMOSD.
Collectively, our study first applied hUC-MSCs therapy in this NMOSD animal model and showed therapeutic effects of hUC-MSCs on NMOSD. Besides, our study indicated that hUC-MSCs suppressed AQP4 IgG- and complement- induced astrocytes apoptosis for the first time. However, this study has some limitations. The mechanisms underlying the anti-apoptotic effects of hUC-MSCs on astrocytes need further exploration. The NMOSD model that we used is a passive immune model. The model also cannot mimic the production of anti-AQP4 antibodies by plasma cells in patients with NMOSD. Whether hUC-MSCs inhibit plasma cell differentiation and antibody production in NMOSD should be further explored using an active immune model.
Conclusion
In summary, we found that hUC-MSCs significantly attenuated motor dysfunction and pathological and imaging manifestations in an animal model of NMOSD. Meanwhile, we revealed that hUC-MSCs did not attenuate peripheral inflammation, but significantly attenuated inflammatory infiltration and BBB disruption in the spinal cord. Furthermore, hUC-MSCs were found to have a protective effect against AQP4 IgG- and complement-mediated astrocyte injury and inhibited apoptosis. Collectively, our study provides further evidence for the therapeutic application of hUC-MSCs in NMOSD, and reveals, for the first time, their protective effects against AQP4 IgG- and complement-induced astrocyte apoptosis.
Supplementary Information
Acknowledgements
The authors declare that they have not use AI-generated work in this manuscript.
Abbreviations
- NMOSD
Neuromyelitis optica spectrum disorder
- CNS
Central nervous system
- AQP4
Aquaporin 4
- MSCs
Mesenchymal stem cells
- hUC-MSCs
Human umbilical cord mesenchymal stem cells
- EAE
Experimental autoimmune encephalomyelitis
- BBB
Blood-brain barrier
- CFA
Complete Freund’s adjuvant
- PTX
Pertussis toxin
- GFAP
Glial fibrillary acidic protein
- MBP
Myelin basic protein
- MRI
Magnetic resonance imaging
Author contributions
CRX: Methodology, Investigation, Writing-original draft; HJY: Methodology, Investigation; XZP: Writing-original draft, investigation; XYY: Methodology; JD, XYW, YC: Investigation; YTG: Conceptualization, Review and editing, Supervision, Project administration, Funding acquisition. All authors read and approved the final manuscript.
Funding
This study was supported by New Quality Clinical Specialties of High-end Medical Disciplinary Construction in Pudong New Area (No. 2024-PWXZ-16), Interdisciplinary Program of Shanghai Jiao Tong University (No. YG2023LC04) , Innovative Research Team of High-Level Local Universities in Shanghai (No. SHSMU-ZDCX20211901).
Availability of data and materials
All additional files are included in the manuscript.
Declarations
Ethics approval and consent to participate
For animal experiments, (1) Title of the approved project: Therapeutic effect and mechanism of hUC-MSCs on a mouse model of NMOSD; (2) Name of the institutional approval committee or unit: Ethics committee of Shanghai Model Organisms; (3) Approval number: IACUC 2024-0021-1; (4) Date of approval: August, 2024. For human material, (1) Title of the approved project: Prospective multicenter randomized controlled trial of hUC-MSCs for the treatment of NMOSD; (2) Name of the institutional approval committee or unit: Ethics committee of Renji Hospital, Shanghai Jiaotong University School of Medicine; (3) Approval number: 2016-071k; (4) Date of approval: March, 2020. The patients and human donors provided written informed consent for participation in the study and the use of samples.
Consent for publication
Not applicable.
Competing interests
Not applicable.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Chunran Xue, Haojun Yu and Xuzhong Pei have contributed equally to this work and share the first authorship.
References
- 1.Jarius S, Paul F, Weinshenker BG, Levy M, Kim HJ, Wildemann B. Neuromyelitis optica. Nat Rev Dis Primers. 2020;6(1):85. 10.1038/s41572-020-0214-9. [DOI] [PubMed] [Google Scholar]
- 2.Carnero Contentti E, Correale J. Neuromyelitis optica spectrum disorders: from pathophysiology to therapeutic strategies. J Neuroinflamm. 2021;18(1):208. 10.1186/s12974-021-02249-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Papp V, Magyari M, Aktas O, Berger T, Broadley SA, Cabre P, et al. Worldwide incidence and prevalence of neuromyelitis optica: a systematic review. Neurology. 2021;96(2):59–77. 10.1212/wnl.0000000000011153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wingerchuk DM, Lennon VA, Lucchinetti CF, Pittock SJ, Weinshenker BG. The spectrum of neuromyelitis optica. Lancet Neurol. 2007;6(9):805–15. 10.1016/s1474-4422(07)70216-8. [DOI] [PubMed] [Google Scholar]
- 5.Duan T, Smith AJ, Verkman AS. Complement-dependent bystander injury to neurons in AQP4-IgG seropositive neuromyelitis optica. J Neuroinflamm. 2018;15(1):294. 10.1186/s12974-018-1333-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tradtrantip L, Yao X, Su T, Smith AJ, Verkman AS. Bystander mechanism for complement-initiated early oligodendrocyte injury in neuromyelitis optica. Acta Neuropathol. 2017;134(1):35–44. 10.1007/s00401-017-1734-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Pittock SJ, Zekeridou A, Weinshenker BG. Hope for patients with neuromyelitis optica spectrum disorders—From mechanisms to trials. Nat Rev Neurol. 2021;17(12):759–73. 10.1038/s41582-021-00568-8. [DOI] [PubMed] [Google Scholar]
- 8.Giglhuber K, Berthele A. Adverse events in NMOSD therapy. Int J Mol Sci. 2022;23(8):4154. 10.3390/ijms23084154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li J, Curley JL, Floyd ZE, Wu X, Halvorsen YDC, Gimble JM. Isolation of human adipose-derived stem cells from lipoaspirates. Methods Mol Biol. 2018;1773:155–65. 10.1007/978-1-4939-7799-4_13. [DOI] [PubMed] [Google Scholar]
- 10.Beeravolu N, McKee C, Alamri A, Mikhael S, Brown C, Perez-Cruet M, et al. Isolation and characterization of mesenchymal stromal cells from human umbilical cord and fetal placenta. J Vis Exp. 2017;3(122):55224. 10.3791/55224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chu DT, Phuong TNT, Tien NLB, Tran DK, Thanh VV, Quang TL, et al. An update on the progress of isolation, culture, storage, and clinical application of human bone marrow mesenchymal stem/stromal cells. Int J Mol Sci. 2020;21(3):708. 10.3390/ijms21030708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kamen DL, Wallace C, Li Z, Wyatt M, Paulos C, Wei C, et al. Safety, immunological effects and clinical response in a phase I trial of umbilical cord mesenchymal stromal cells in patients with treatment refractory SLE. Lupus Sci Med. 2022;9(1): e000704. 10.1136/lupus-2022-000704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Izadi M, Sadr Hashemi Nejad A, Moazenchi M, Masoumi S, Rabbani A, Kompani F, et al. Mesenchymal stem cell transplantation in newly diagnosed type-1 diabetes patients: a phase I/II randomized placebo-controlled clinical trial. Stem Cell Res Ther. 2022;13(1):264. 10.1186/s13287-022-02941-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Petrou P, Kassis I, Levin N, Paul F, Backner Y, Benoliel T, et al. Beneficial effects of autologous mesenchymal stem cell transplantation in active progressive multiple sclerosis. Brain. 2020;143(12):3574–88. 10.1093/brain/awaa333. [DOI] [PubMed] [Google Scholar]
- 15.Deuse T, Stubbendorff M, Tang-Quan K, Phillips N, Kay MA, Eiermann T, et al. Immunogenicity and immunomodulatory properties of umbilical cord lining mesenchymal stem cells. Cell Transplant. 2011;20(5):655–67. 10.3727/096368910x536473. [DOI] [PubMed] [Google Scholar]
- 16.Li X, Bai J, Ji X, Li R, Xuan Y, Wang Y. Comprehensive characterization of four different populations of human mesenchymal stem cells as regards their immune properties, proliferation and differentiation. Int J Mol Med. 2014;34(3):695–704. 10.3892/ijmm.2014.1821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zhu SF, Zhong ZN, Fu XF, Peng DX, Lu GH, Li WH, et al. Comparison of cell proliferation, apoptosis, cellular morphology and ultrastructure between human umbilical cord and placenta-derived mesenchymal stem cells. Neurosci Lett. 2013;541:77–82. 10.1016/j.neulet.2013.03.018. [DOI] [PubMed] [Google Scholar]
- 18.Fu Y, Yan Y, Qi Y, Yang L, Li T, Zhang N, et al. Impact of autologous mesenchymal stem cell infusion on neuromyelitis optica spectrum disorder: a pilot, 2-year observational study. CNS Neurosci Ther. 2016;22(8):677–85. 10.1111/cns.12559. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lu Z, Ye D, Qian L, Zhu L, Wang C, Guan D, et al. Human umbilical cord mesenchymal stem cell therapy on neuromyelitis optica. Curr Neurovasc Res. 2012;9(4):250–5. 10.2174/156720212803530708. [DOI] [PubMed] [Google Scholar]
- 20.Haruki H, Sano Y, Shimizu F, Omoto M, Tasaki A, Oishi M, et al. NMO sera down-regulate AQP4 in human astrocyte and induce cytotoxicity independent of complement. J Neurol Sci. 2013;331(1–2):136–44. 10.1016/j.jns.2013.05.035. [DOI] [PubMed] [Google Scholar]
- 21.Sabater L, Giralt A, Boronat A, Hankiewicz K, Blanco Y, Llufriu S, et al. Cytotoxic effect of neuromyelitis optica antibody (NMO-IgG) to astrocytes: an in vitro study. J Neuroimmunol. 2009;215(1–2):31–5. 10.1016/j.jneuroim.2009.07.014. [DOI] [PubMed] [Google Scholar]
- 22.Wang L, Huang S, Li S, Li M, Shi J, Bai W, et al. Efficacy and safety of umbilical cord mesenchymal stem cell therapy for rheumatoid arthritis patients: a prospective phase I/II study. Drug Des Devel Ther. 2019;13:4331–40. 10.2147/dddt.S225613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ahmadifard R, Jafarzadeh A, Mahmoodi M, Nemati M, Rahmani M, Khorramdelazad H, et al. Interferon-γ-treated mesenchymal stem cells modulate the T cell-related chemokines and chemokine receptors in an animal model of experimental autoimmune encephalomyelitis. Drug Res. 2023;73(4):213–23. 10.1055/a-1995-6365. [DOI] [PubMed] [Google Scholar]
- 24.Zhang JM, Wang H, Fan YY, Yang FH. Effect of mesenchymal stem cells transplantation on the changes of oligodendrocyte lineage in rat brain with experimental autoimmune encephalomyelitis. Brain Behav. 2021;11(2): e01999. 10.1002/brb3.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xu H, Jiang W, Li X, Jiang J, Afridi SK, Deng L, et al. hUC-MSCs-derived MFGE8 ameliorates locomotor dysfunction via inhibition of ITGB3/NF-κB signaling in an NMO mouse model. NPJ Regen Med. 2024;9(1):4. 10.1038/s41536-024-00349-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Fan J, Tang X, Wang Q, Zhang Z, Wu S, Li W, et al. Mesenchymal stem cells alleviate experimental autoimmune cholangitis through immunosuppression and cytoprotective function mediated by galectin-9. Stem Cell Res Ther. 2018;9(1):237. 10.1186/s13287-018-0979-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lotfinejad P, Shamsasenjan K, Baradaran B, Safarzadeh E, Kazemi T, Movassaghpour AA. Immunomodulatory effect of human umbilical cord blood-derived mesenchymal stem cells on activated T-lymphocyte. Iran J Allergy Asthma Immunol. 2021;20(6):711–20. 10.18502/ijaai.v20i6.8022. [DOI] [PubMed] [Google Scholar]
- 28.Ling X, Wang T, Han C, Wang P, Liu X, Zheng C, et al. IFN-γ-primed hUCMSCs significantly reduced inflammation via the Foxp3/ROR-γt/STAT3 signaling pathway in an animal model of multiple sclerosis. Front Immunol. 2022;13: 835345. 10.3389/fimmu.2022.835345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Zhou X, Liu X, Liu L, Han C, Xie Z, Liu X, et al. Transplantation of IFN-γ primed hUCMSCs significantly improved outcomes of experimental autoimmune encephalomyelitis in a mouse model. Neurochem Res. 2020;45(7):1510–7. 10.1007/s11064-020-03009-y. [DOI] [PubMed] [Google Scholar]
- 30.Xu C, Yu P, Han X, Du L, Gan J, Wang Y, et al. TGF-β promotes immune responses in the presence of mesenchymal stem cells. J Immunol. 2014;192(1):103–9. 10.4049/jimmunol.1302164. [DOI] [PubMed] [Google Scholar]
- 31.Zhang L, Wang X, Lu X, Ma Y, Xin X, Xu X, et al. Tetramethylpyrazine enhanced the therapeutic effects of human umbilical cord mesenchymal stem cells in experimental autoimmune encephalomyelitis mice through Nrf2/HO-1 signaling pathway. Stem Cell Res Ther. 2020;11(1):186. 10.1186/s13287-020-01700-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Xue C, Ma X, Guan X, Feng H, Zheng M, Yang X. Small extracellular vesicles derived from umbilical cord mesenchymal stem cells repair blood-spinal cord barrier disruption after spinal cord injury through down-regulation of Endothelin-1 in rats. PeerJ. 2023;11: e16311. 10.7717/peerj.16311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yang J, Li H, Ran M, Yang S, Ma K, Zhang C, et al. Transplantation of umbilical cord-derived mesenchymal stem cells attenuates surgical wound-induced blood–brain barrier dysfunction in mice. Stem Cells Int. 2023;2023:8667045. 10.1155/2023/8667045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kinoshita M, Nakatsuji Y, Moriya M, Okuno T, Kumanogoh A, Nakano M, et al. Astrocytic necrosis is induced by anti-aquaporin-4 antibody-positive serum. NeuroReport. 2009;20(5):508–12. 10.1097/wnr.0b013e32832776f4. [DOI] [PubMed] [Google Scholar]
- 35.Vaes JEG, van Kammen CM, Trayford C, van der Toorn A, Ruhwedel T, Benders M, et al. Intranasal mesenchymal stem cell therapy to boost myelination after encephalopathy of prematurity. Glia. 2021;69(3):655–80. 10.1002/glia.23919. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Oppliger B, Joerger-Messerli MS, Simillion C, Mueller M, Surbek DV, Schoeberlein A. Mesenchymal stromal cells from umbilical cord Wharton’s jelly trigger oligodendroglial differentiation in neural progenitor cells through cell-to-cell contact. Cytotherapy. 2017;19(7):829–38. 10.1016/j.jcyt.2017.03.075. [DOI] [PubMed] [Google Scholar]
- 37.Bai L, Lennon DP, Caplan AI, DeChant A, Hecker J, Kranso J, et al. Hepatocyte growth factor mediates mesenchymal stem cell–induced recovery in multiple sclerosis models. Nat Neurosci. 2012;15(6):862–70. 10.1038/nn.3109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Giacoppo S, Thangavelu SR, Diomede F, Bramanti P, Conti P, Trubiani O, et al. Anti-inflammatory effects of hypoxia-preconditioned human periodontal ligament cell secretome in an experimental model of multiple sclerosis: a key role of IL-37. Faseb j. 2017;31(12):5592–608. 10.1096/fj.201700524R. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Huang W, Lv B, Zeng H, Shi D, Liu Y, Chen F, et al. Paracrine factors secreted by MSCs promote astrocyte survival associated with GFAP downregulation after ischemic stroke via p38 MAPK and JNK. J Cell Physiol. 2015;230(10):2461–75. 10.1002/jcp.24981. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All additional files are included in the manuscript.





