Supplementation with serine-enriched non-essential amino acids from minimum essential medium promotes blastocyst development of in vitro-fertilized bovine embryos

Abstract

To produce an embryo, a high conception rate must be complied along with four evaluation criteria based on the timing of early cleavage and proper embryo morphology (hereafter, these blastocysts will be referred to as “four-criteria-compliant blastocysts”). Therefore, it is necessary to construct a culture system for high efficiency production of embryos meeting these four criteria. Non-essential amino acids (NEAAs) are widely used for the culture of bovine embryos fertilized in vitro; however, the necessity and optimal concentration of individual NEAA must be verified to produce four-criteria-compliant blastocysts. DNA methylation is a critical event for blastocyst formation in bovines, and serine is a common NEAA that serves as a methyl donor and participates in DNA methylation. Serine is generally added at a concentration of 100 µM in bovine embryo culture medium. However, the rate of formation of four-criteria-compliant blastocysts was significantly improved when 1000 µM of serine was added. Analysis of endogenous serine synthases gene expression in oocytes and embryos revealed that phosphoglycerate dehydrogenase, the rate-limiting enzyme in the serine synthesis pathway, is expressed at the morula stage and beyond. The addition of serine at 1000 µM increased the amount of methyl donors; moreover, the addition of an inhibitor of serine-metabolizing enzymes decreased the number of methyl donors and markedly inhibited blastocyst formation. These results indicate that the addition of serine at an optimal concentration of 1000 µM favors production of four-criteria-compliant blastocysts, and that methyl donor synthesis may be involved in this effect.

In vitro embryo culture (IVC) is an important process for obtaining bovine offspring by transferring embryos produced by in vitro fertilization (IVF). Although researchers have attempted for more than three decades to establish in vitro culture environments, the low conception rate after embryo transfer can be attributed to the lack of an optimized culture environment. The conception rate of embryos produced in vitro is lower than that of embryos produced in vivo [1, 2]. By linking the observation of bovine preimplantation development using a time-lapse incubator with the results of embryo transfer, Sugimura et al. [3] reported that the conception rate of blastocysts derived from IVF exceeded 70%, which met the four criteria regarding developmental speed and morphology and was higher than those that did not meet the four criteria (40%). The four criteria of developmental speed and morphology were as follows: (i) occurrence of the first cleavage at 27 h post insemination (hpi), (ii) no division into three or more blastomeres at 31 hpi, (iii) no cytoplasmic fragmentation at 31 hpi, and (iv) division into six or more cells at 55 hpi [3]. Hereafter, embryos that meet these four criteria and develop into blastocyst stage are referred to as “four-criteria-compliant blastocysts”. To improve the conception rate of bovine embryos by embryo transfer, it is desirable to design an in vitro culture system for creating four-criteria-compliant blastocysts.

Miyashita et al. [4] reported that conditioned medium and their centrifugation sediment of spontaneously immortalized bovine oviductal epithelial cells increased the production efficiency of four-criteria-compliant blastocysts. To the best of our knowledge, this is the first report of a successful increase in the production of four-criteria-compliant blastocysts by modifying an existing culture system. In a report examining the necessity of non-essential amino acids (NEAAs) in IVC medium, the production of four-criteria-compliant blastocysts was increased by not adding alanine, an amino acid commonly used in bovine IVC medium [5]. Through this study, we showed that the presence of alanine does not affect the total formation rate of blastocysts, which combined criteria-compliant and uncompliant blastocysts, but delayed the first cleavage after fertilization. This difference led to reduced formation rate of four-criteria-compliant blastocysts. Amino acids have long been used in the culture of bovine oocytes and preimplantation embryos; however NEAAs are typically supplemented with pre-mixed Minimum Essential Medium (MEM)-NEAA products (Thermo Fisher Scientific, Waltham, MA, USA) [6,7,8]. Although NEAA concentration may be suitable for general cell culture, it may not be optimal for bovine oocytes or preimplantation embryo cultures. The composition of NEAAs in bovine oviductal fluid varies greatly among species [9]. High-quality blastocysts can be obtained efficiently in human IVC when a culture medium that mimics the amino acid composition of oviductal fluid is used [10]. MEM-NEAA contains a uniform concentration of 100 µM for all NEAAs (alanine, asparagine, aspartic acid, glutamic acid, glycine, proline, and serine). The concentration of each NEAA added to bovine embryo culture media should be verified individually. Itami et al. [5] asserted that it is necessary to verify the necessity and optimal concentration of individual NEAAs to improve the efficiency of producing bovine four-criteria-compliant blastocysts. Oviductal fluid of bovine contains 3682 µM of alanine [9], but Itami et al. [5] reported that the development of four-criteria-compliant blastocysts is enhanced when alanine is not added to the embryo culture medium.

Serine, a NEAA, is biosynthesized from 3-phosphoglycerate (3-PG), a metabolic product of glucose [11]. Cellular metabolism uses both endogenously synthesized and exogenously ingested serine [12,13,14,15]. Serine is metabolized by serine hydroxymethyl transferase (SHMT) in the folate cycle, which results in the synthesis of S-adenosylmethionine (SAM), known as the universal methyl group donor to DNA, histones, and proteins [16]. SAM transfers its methyl group to DNA strand during methylation by DNA methyltransferases (DNMT) [17,18,19]. Immunostaining to detect methylated cytosine (5-mC) in bovine preimplantation embryos produced in vitro showed that the fluorescence intensity decreased from the 2-cell to the 6−8-cell stage, but increased at the blastocyst stage [20, 21]. DNA methylation in bovine blastocysts is associated with inner cell mass and trophectoderm (ICM-TE) differentiation and embryo viability [22,23,24], suggesting that a sufficient amount of methyl donor is required to achieve such high levels of methylation. In bovine embryos, the maintenance methyltransferase DNMT1 and de novo methyltransferase DNMT3 are expressed from the 2-cell stage onward [25]. The inhibition of DNMT1 activity strongly inhibits development of bovine embryos from the 8-cell stage to the blastocyst stage [26, 27], suggesting that DNA methylation is essential for bovine embryo development to the blastocyst stage. Elhassan et al. reported that serine is present in bovine oviductal fluid at a concentration of 625 µM [9], but the optimal concentration of serine required during IVC and its effects are unknown.

The study was aimed to investigate the optimal concentration of serine in the embryo culture medium for increasing the production of bovine four-criteria-compliant blastocysts based on previous reports on alanine concentration modification. We also investigated the effects of inhibiting SHMT activity on preimplantation embryo development and SAM levels.

Materials and Methods

All chemicals used in this study were purchased from NACALAI TESQUE, INC. (Kyoto, Japan) unless otherwise indicated.

Collection of ovaries and cumulus cell-oocyte complexes

The ovaries of Holstein and crossbreeding (Holstein and Japanese Black) cows were collected from a local slaughterhouse, transported to the laboratory, washed with saline, and stored at 17°C for no longer than 20 h in Dulbecco’s Phosphate-Buffered Saline (PBS) supplemented with 100 U/ml of penicillin (Meiji Seika Pharma, Tokyo, Japan) and 100 µg/ml of streptomycin sulfate (Meiji Seika Pharma). Cumulus cell-oocyte complexes (COCs) were retrieved from antral follicles (3–6 mm in diameter) using an 18-G needle (Terumo, Tokyo, Japan) connected to a 5-ml syringe (Terumo). Oocytes that contained an even cytoplasm and were enclosed by multiple compact granulosa cell layers were selected and pooled.

In vitro maturation and in vitro fertilization

Medium 199 (Thermo Fisher Scientific) supplemented with 10% (v/v) fetal calf serum was used for in vitro maturation (IVM). COCs were washed thrice with IVM medium and incubated in 600 µl IVM medium covered with paraffin oil in a 4-well culture plate (Thermo Fisher Scientific) at a density of 50–60 COCs per well for 22 h. After IVM, COCs were washed three times and placed into a 50 µl droplet of Brackett and Oliphant’s (BO) medium [28] supplemented with 20 mg/ml of bovine serum albumin (BSA; Merck, Rahway, NJ, USA) and 10 U/ml heparin (Mochida Pharmaceutical, Tokyo Japan) at a density of 20 COCs per drop, and covered with paraffin oil. The frozen sperm sample from Japanese Black bulls was thawed in water at 38°C for 30 sec and centrifuged twice in 9 ml of BO medium supplemented with 3.9 mg/ml caffeine-sodium benzoate (Merck) at 630 × g for 5 min. The pellet was resuspended in the BO medium at a concentration of 10 × 10⁶ spermatozoa/ml. Subsequently, 50 µl of the suspension was added to the droplet containing COCs and covered with paraffin oil. IVF was performed for 6 h. IVM and IVF were performed at 38.5°C in a humidified atmosphere containing 5% CO₂ and 95% air.

In vitro embryo culture and formation of four-criteria-compliant blastocysts

Presumptive zygotes were mechanically and enzymatically denuded of cumulus cells using 0.1% (w/v) hyaluronidase prepared in M2 medium [29] (4.97 g/l HEPES, 0.35 g/l NaHCO₃, 1.0 g/l glucose, and 36 mg/l sodium pyruvate) 6 hpi, and then washed thrice and added to 300 µl of the embryo culture medium, Charles Rosenkrans 1 (CR1) medium supplemented with 0.3% (w/v) fatty acid-free BSA, 1.4 mM MgCl₂-6H₂O, 1 mM L-glutamine, and 2% (v/v) Basal Medium Eagle (BME) amino acid solution (Merck) [30, 31], which was covered by paraffin oil. Cultures were conducted using 20–30 zygotes per drop. The concentrations of NEAAs other than serine were referenced in our previous study showing highly efficient production of four-criteria-compliant blastocysts [5]. Specifically, of the six NEAAs, alanine was not added, and each of asparagine, aspartic acid, glutamic acid, glycine, and proline were added at a concentration of 100 µM. IVC was performed for 192 h at 38.5°C in a humidified atmosphere containinf 5% O₂, 5% CO₂, and 90% N₂. The four-criteria-compliant high-quality embryos were selected as per the criteria mentioned in the Introduction section. There were no significant morphological differences between blastocysts that met these four criteria and those that did not [5].

RNA isolation, reverse transcription, and polymerase chain reaction

RNA was isolated from oocytes and embryos using PicoPure RNA isolation Kit (Thermo Fisher Scientific). RNA samples were reverse-transcribed using ReverTraAce qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). To detect the gene expression of three serine synthase, phosphoglycerate dehydrogenase (PHGDH), phosphoserine aminotransferase 1 (PSAT1), phosphoserine phosphatase (PSPH), the produced complementary DNA were subjected to polymerase chain reaction (PCR), including an initial denaturation at 95°C for 3 min, followed by 45 cycles of 95°C for 20 sec and 59°C for 30 sec. Primer sequences of the three serine synthase and internal control (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta; YWHAZ) are indicated in Table 1. The PCR products were mixed with EZ-Vision one DNA Dye (Avantor, Radnor, PA, USA) as Loading Buffer, subjected to agarose gel electrophoresis, and the bands were photographed.

Table 1. Primer sequences for PCR analysis.

Gene	Accession number		Sequence	Product length
PHGDH	NM_001035017	Forward:	TCCTGGTCATGAATACCCCCA	113 bp
		Reverse:	ATCCTTCATAGATGCCGCCG
PSAT1	NM_001102150	Forward:	GAAAGGGCATAGGTCCGTGG	75 bp
		Reverse:	AGCTTCTGGACGTCTTCGAC
PSPH	NM_001046355	Forward:	CCCCTTGCAGTCGGAACTTA	96 bp
		Reverse:	CTCTTCCCACTTCTTTCCCCG
YWHAZ	NM_174814	Forward:	GCATCCCACAGACTATTTCC	120 bp
		Reverse:	GCAAAGACAATGACAGACCA

Immunofluorescence staining of SAM

The morulae were collected and fixed with 4% (w/v) paraformaldehyde in PBS for 1 h. The fixed embryos were permeabilized using 0.25% (v/v) Triton-PBS for 30 min, followed by blocking using 3% (v/v) FCS-PBS for 1 h. The samples were treated with Rabbit S-Adenosyl Methionine Polyclonal Antibody (MBS2015171: MyBioSource, San Diego, CA, USA) as primary antibody overnight at 4°C. The samples were treated with the secondary antibody Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 555 (A32794: Thermo Fisher Scientific) for 1 h. The samples were mounted onto a glass slide using ProLong Diamond Antifade Mountant with DAPI (Thermo Fisher Scientific), covered with nail polish, and observed under a fluorescence microscope (Eclipse E800; Nikon, Tokyo, Japan). The fluorescence intensity of embryos was measured using ImageJ software (NIH, Bethesda, MD, USA).

Experimental design

Experiment 1: Comparison of development rates of four-criteria-compliant embryos in culture media with various serine concentrations

In the first series of experiments, the development rates of four-criteria-compliant embryos were compared using culture media supplemented with 0, 100, 500, and 1000 µM of serine. The medium with serine at 100 µM, which is a general additive concentration, was considered the control group [7, 8]. Based on the results, we further compared the development rates of four-criteria-compliant embryos using culture media supplemented with 1000 and 2000 µM of serine.

Experiment 2: Detection of the gene expression of serine synthase in oocytes and embryos

To detect the expression of serine synthase related genes (PHGDH, PSAT1, and PSPH), oocytes, at the germinal vesicle stage immediately after collection from ovaries and at the metaphase II (MII) immediately after IVM, were mechanically and enzymatically denuded from cumulus cells using 0.1% hyaluronidase prepared in M2 medium. We also collected presumptive zygotes (1-cell) at 6 hpi, 2-cell at 27 hpi, 8-cell at 55 hpi, 16-cell at 72 hpi, morulae at 144 hpi, and blastocysts on day 8 of culture. The samples were subjected to RNA isolation, reverse transcription, PCR, and electrophoresis.

Experiment 3: Effect of SHMT inhibitor on the development rate of four-criteria-compliant embryos

Based on the results of Experiment 1, in which 1000 µM serine supplementation enhanced the development of four-criteria-compliant embryos, we examined the effects of an SHMT inhibitor (SHIN1; MedChemExpress, Monmouth Junction, NJ, USA) in a medium supplemented with 1000 µM serine on the development of four-criteria-compliant embryos.

Experiment 4: Comparison of the amount of SAM among different concentrations of serine and in the presence of SHIN1

The amount of SAM was compared based on the fluorescence intensity of immunostaining among morulae cultured in media supplemented with serine at concentrations of 100 µM, 1000 µM serine, and 1000 µM serine combined with SHIN1.

Statistical analysis

The development rates of embryos into blastocysts conforming to each criterion were compared between the control and other groups. Dunnett’s test was used to determine statistically significant differences at four different serine concentrations in Experiment 1. The control group contained 100 µM of serine. Student’s t-test was used to compare the rates of four-criteria-compliant blastocyst formation between media supplemented with 100 µM and 1000 µM serine, calculated against the number of embryos achieving the four criteria by 55 hpi. Significant differences in embryonic developmental rates between media supplemented with 1000 µM and 2000 µM serine in Experiment 1 was performed using Student’s t-test. Statistical analysis of the effects of SHIN1 on the development of four-criteria-compliant embryos (Experiment 3) was performed using Student’s t-test. Arcsine transformation was applied to the rates before statistical analysis was conducted. The fluorescence intensity of SAM in morulae was assessed using one-way analysis of variance, followed by Tukey−Kramer test. A P-value of < 0.05 was considered statistically significant. KyPlot 6.0 (KyensLab Inc., Tokyo, Japan) and Microsoft Excel (Microsoft Corporation, Redmond, WA, USA) were used to perform statistical analyses.

Results

Optimal concentration of serine for the formation of four-criteria-compliant blastocyst

Compared with the control (medium supplemented with 100 µM serine), the formation rate of four-criteria-compliant blastocysts was significantly increased in the medium supplemented with 1000 µM serine. However, there were no significant differences in the conformance rate to each criterion among the four and the overall blastocyst formation rate in all cultured samples compared with the control (Fig. 1A). Compared with the control, the medium supplemented with 1000 µM serine did not differ in the conformance rate to the four criteria by 55 hpi, but showed significant improvement in the development rate of embryos into blastocysts among embryos that met the four criteria by 55 hpi (Fig. 1B). Based on these results, we investigated the effect of serine concentrations above 1000 µM on bovine development and found that the addition of 2000 µM of serine markedly reduced the formation rate of four-criteria-compliant blastocysts (Fig. 1C). Moreover, there were no significant differences in the development rate of embryos into blastocysts among the embryos that met the four criteria by 55 hpi (Fig. 1D).

Fig. 1.

Effects of various concentrations of serine on the development of in vitro-fertilized bovine embryos into blastocysts. (A) Comparison of the kinetics of the early cleavage and blastocyst development of embryos in media supplemented with 100, 0, 500, and 1000 µM of serine. The control group contained 100 µM of serine. Embryos were cultured 137 in all experimental groups, individually. At 27 h post-insemination (hpi), the percentages of embryos meeting the criterion (i) are shown. At 31 hpi, the percentages of embryos meeting criteria (i), (ii), and (iii) are shown. At 55 hpi, the percentages of embryos meeting all four criteria are shown. 4CC indicates four-criteria-compliant. The experiments were conducted five times. (B) Comparison of the development rate of the embryos into blastocysts, calculated against the number of embryos achieving the four criteria by 55 hpi after culture in medium supplemented with 100 or 1000 µM serine. (C) Comparison of the kinetics of the early cleavage and blastocyst development of embryos in medium supplemented with 1000 or 2000 µM serine. Embryos were cultured in 101 in all experimental groups, individually. The experiments were conducted four times. (D) Comparison of the development rates of embryos into blastocysts, calculated against the number of embryos achieving the four criteria by 55 hpi after culture in medium supplemented with 1000 or 2000 µM serine. All data are shown as the mean ± standard error of the mean (SEM). Asterisks indicate significant differences, * P < 0.05.

Gene expression of serine synthase in oocytes and embryos

Among the serine synthases, PSAT1 and PSPH were expressed through the oocyte to the blastocyst stage. However, PHGDH, the rate-limiting enzyme in the serine synthesis pathway [32], was not expressed in oocytes and embryos up to the 16-cell embryo stage, and its gene expression was first observed in morulae (Fig. 2).

Fig. 2.

Gel electrophoresis images of PCR products of the genes encoding serine synthases. PHGDH, phosphoglycerate dehydrogenase; PSAT, phosphoserine aminotransferase 1; PSPH, phosphoserine phosphatase; GV, immature oocyte at the germinal vesicle stage; MII, mature oocyte after in vitro maturation; 1C, presumptive zygote; 2C, 2-cell stage; 8C, 8-cell stage; 16C, 16-cell stage; MO, morula; BL, blastocyst stage embryo. Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ) was used as the internal control.

Supplementation with SHIN1 impaired blastocyst formation

Medium supplemented with SHIN1 during the entire period of IVC showed reduction in both the formation rate of four-criteria-compliant blastocysts and total blastocysts, despite supplementation of the medium with 1000 µM serine (Fig. 3A). SHIN1 addition did not significantly affect the conformance rate to the four criteria by 55 hpi, but significantly reduced the blastocyst formation rate, calculated against the number of embryos achieving the four criteria by 55 hpi (Fig. 3B).

Fig. 3.

Effects of SHIN1 on the development of in vitro-fertilized bovine embryos into blastocysts. (A) Comparison of the kinetics of the early cleavage and blastocyst development of embryos in medium supplemented with or without 10 µM SHIN1. Embryos were cultured in 123 and 124 in the two experimental groups, respectively. At 27 h post insemination (hpi), the percentages of embryos that met the criterion (i) are shown. At 31 hpi, the percentages of embryos that met criteria (i), (ii), and (iii) are shown. At 55 hpi, the percentages of embryos that met all four criteria are shown. The experiments were conducted five times. (B) Comparison of the development rates of embryos into the blastocysts, calculated against the number of embryos achieving the four criteria by 55 hpi after culture in the medium supplemented with or without SHIN1. All culture media contained 1000 µM serine. All data are shown as the mean ± SEM. Asterisks indicate significant differences, * P < 0.05.

Effect of serine concentration and SHIN1 on the amount of SAM in morulae

The medium supplemented with 1000 µM serine showed significant increase in the amount of SAM in morulae compared with that supplemented with 100 µM serine. However, SHIN1 addition remarkably reduced the amount of SAM in morulae, despite supplementation of the medium with 1000 µM serine (Fig. 4).

Fig. 4.

Effects of serine concentration and SHIN1 on the amount of SAM in morulae. (A) Representative images of bright field, DAPI, and SAM photographed using a fluorescence microscope. (B) Relative intensity of SAM in morulae cultured in medium supplemented with 100 µM serine (n = 19), 1000 µM serine (n = 25), or 1000 µM serine and 10 µM SHIN1 (n = 20). The experiments were conducted thrice. Different letters (a, b, c) indicate significant differences (Tukey−Kramer test), P < 0.05.

Discussions

Supplementation of IVC medium with 1000 µM serine increased the efficiency of formation of four-criteria-compliant blastocysts compared with the control medium containing serine at a concentration of 100 µM. This result indicates that the addition of 100 µM serine to common bovine IVC medium is insufficient for the formation of highly fertile blastocysts. It is noteworthy that blastocyst formation was significantly reduced when the medium was supplemented with 2000 µM serine. Specifically, serine is suitable for the formation of four-criteria-compliant blastocysts when the medium is supplemented with serine at a concentration 10-fold higher than 100 µM, the final concentration of MEM-NEAA.

Supplementation of the medium with 1000 µM serine did not affect the conformance rate to the four criteria by 55 hpi (6−8-cell stage), but increased the number of embryos that developed into blastocysts among embryos that fulfilled the four criteria by 55 hpi. Furthermore, inhibiting the activity of SHMT, a serine metabolizing enzyme, suppressed the development rate of embryos into blastocysts among the embryos that fulfilled the four criteria by 55 hpi. Thus, serine plays a key role in the development of embryos into blastocysts. The rate-limiting enzyme in serine synthesis is PHGDH [32]; its gene expression in bovine embryos is first observed at the morula stage, indicating that serine synthesis also occurs after the morula stage. It is conceivable that the requirement for serine in bovine embryos increases after the morula stage. The fact that bovine embryos begin to utilize glucose after the 8-cell stage [33, 34] is reasonable for the hypothesis that 3-PG, a metabolite of the glycolytic system, is used for serine synthesis after the morula stage.

Since the supplementation in medium with 1000 µM serine increased the amount of SAM in morulae compared with the medium supplemented with 100 µM serine, it is possible that serine contributes to the increase in SAM levels. The demand for serine in bovine embryos increases after the morula stage, which may be attributed to DNA methylation for blastocyst formation. Serine is involved in SAM synthesis via the one-carbon and methionine cycles and contributes to the donation of methyl groups to DNA [35]. A deficiency in exogenous serine is associated with decreased cellular SAM and DNA methylation levels [35]. Because genes controlling the one-carbon and methionine cycles are ubiquitously expressed in bovine oocytes and embryos [36], the importance of methyl group donation in preimplantation embryogenesis can be inferred. DNMT1 maintains the methylation of template DNA for DNA replication during cell division. In preimplantation embryogenesis, DNMT1 is essential for maintaining DNA methylation; the knockdown of DNMT1 in mouse embryos has been reported to reduce DNA methylation [37]. In bovine embryos, DNMT1 knockdown reduced DNA methylation levels and completely inhibited blastocyst development [26]. DNA methylation levels in bovine embryos decrease from the 2-cell stage to the 6−8-cell stage, then begin to rise, and are the highest in blastocysts [20, 21, 38]. DNA methylation in blastocysts has been implicated in ICM-TE differentiation and subsequent embryonic metabolic activity, cell structure, and viability [22,23,24]. In an experiment in which methionine, a component of SAM, was added to IVC medium, the blastocyst formation rate among those split into two or more cells was higher in the high methionine concentration group than in the low methionine concentration group [39]. This result indicated that the presence of a sufficient number of methyl group donors before blastocyst development is involved in normal differentiation and even normality after embryonic development.

Inhibition of SHMT activity markedly reduced the amount of SAM in morulae (Fig. 4), indicating that the amount of SAM, at least in bovine morulae, depends upon the availability of serine. SHMT converts serine to glycine and tetrahydrofolate to 5, 10-methylenetetrahydrofolate [40], which is followed by SAM synthesis through the folate and methionine cycles [41, 42]. Both SHMT1 and SHMT2 are ubiquitously expressed in bovine eggs and preimplantation embryos [36]. In mice, knockdown of SHMT2 caused a decrease in SAM and DNA methylation levels [43]. The addition of RG108, a specific inhibitor of DNMT activity, markedly reduced embryonic development beyond the 8-cell stage [27]. The use of methionine, an anti-metabolite of methionine, caused a decrease in DNA methylation levels in bovine embryos and developmental arrest after the morula stage [44]. The results of the present study suggest that DNA methylation, which is important for bovine embryogenesis, particularly from the morula stage to the blastocyst stage, depends upon the use of serine. Notably, SHMT2 knockdown in mice reduces the rate of 2-cell formation [43]. This result is different from that observed in bovines, in which late preimplantation development is suppressed by SHMT inhibition, indicating that different animal species have different initiation times to look for the availability of serine and its metabolizing enzymes.

It is appropriate to add serine to the culture medium throughout the entire period of preimplantation embryo culture because the addition of SHIN slightly decreases the rate of embryonic development by 55 hpi, and exogenous serine supports embryonic development through DNA methylation until the morula stage, when de novo serine synthesis occurs in bovine embryos. In fact, in a previous study, cultures in which only serine was not supplemented along with NEAAs showed a slight decrease in the formation rate of four-criteria-compliant embryos by 55 hpi [5]. This is also supported by a previous report of reduced first-division rates in DNMT1 knockdown bovine embryos [37].

The results of the present study are important for developing embryos at appropriate rates and ensuring that their morphology is suitable at all developmental stage; our research will contribute to increasing yields of bovine through IVF and embryo transfer.

Conflict of interests

The authors declare no conflicts of interest associated with this manuscript.