Saikosaponin A alleviates depressive-like behavior induced by reserpine in mice by regulating gut microflora and inflammatory responses

Menglin Wang; Haojun Li; Wenjing Zhang; Li Zhang; Shun Wang; Miao Jia; Lu Jia; Yu Zhang; Haifei Gao; Xianwu Zhang; Zhaohui Yin

doi:10.1371/journal.pone.0311207

. 2025 Feb 10;20(2):e0311207. doi: 10.1371/journal.pone.0311207

Saikosaponin A alleviates depressive-like behavior induced by reserpine in mice by regulating gut microflora and inflammatory responses

Menglin Wang ^1,^#, Haojun Li ^1,^#, Wenjing Zhang ¹, Li Zhang ¹, Shun Wang ², Miao Jia ¹, Lu Jia ¹, Yu Zhang ¹, Haifei Gao ^1,³, Xianwu Zhang ^1,^*, Zhaohui Yin ^1,^*

Editor: Peng Zhong⁴

PMCID: PMC11809902 PMID: 39928658

Abstract

Saikosaponin A (SSA), a key ingredient of Chaihu-Shugan-San, has been shown to possess anti-inflammatory, antioxidant and antidepressant properties. Therefore, the present study aimed to investigate the potential mechanism of action and the effect of SSA on reserpine-induced depressive-like symptoms in mice. Establishing mouse model of depression using intraperitoneal injection of reserpine (RSP). Forced swimming test, tail suspension test and sucrose preference test were used to assess depression-like behavior in mice. The results showed that mice exposed to RSP not only showed weight loss and depressive behavior, but also elevated levels of IL-1β and TNF-α, as well as upregulated levels of reactive oxygen species (ROS) and lipid peroxides in the hippocampus. Detection of changes in the intestinal flora of mice using 16S rRNA, it was observed that the intestinal flora changed following SSA treatment. Not only was there an increase in the overall abundance of the intestinal microbiota, but there was also a significant down-regulation of the Firmicutes and an up-regulation of the Verrucomicrobia at the phylum level. Furthermore, SSA treatment markedly improved depressive-like behavior induced by RSP, alleviated damage to the hippocampus, elevated levels of monoamine neurotransmitters, suppressed inflammatory factors in the hippocampus, reduced hippocampal oxidative stress, and restored gut microbiota disruption in RSP-induced mice. The findings propose that SSA has the potential to alleviate depressive symptoms in mice by enhancing monoamine neurotransmitter levels, suppressing hippocampal inflammation, and modifying gut microbial composition.

1. Introduction

Depression is a common disorder that involves a variety of related mood disorders, including sadness, loss, frustration and even anger, and these negative emotions last from one to several weeks [1]. Major depression is the third leading global cause of disease burden, according to data published by the World Health Organization, and predicts that it will probably reach the top by 2030 [2]. Affecting over 300 million individuals globally, depression leads to varying degrees of impairment in psychosocial functioning and quality of life, and worse still, long-term severe depression may be associated with suicide attempts [3]. Depression is a public health problem to be addressed, not just a disease.

The precise etiology of depression remains unclear and is often perceived as overly complex. For instance, the monoamine hypothesis has been widely used to explain the classical pathogenesis of depression, and that the repletion of monoamine neurotransmitters plays an essential role in mood regulation [4]. Based on the monoamine hypothesis, a variety of monoamine oxidase inhibitors and selective serotonin reuptake inhibitors have been extensively studied; these drugs can effectively increase levels of monoamines such as 5-hydroxytryptamine (5-HT), dopamine (DA) and norepinephrine (NE), which are significant in improving patients’ quality of life and rebuilding their confidence in life [5,6]. However, there are some pharmacological effects of these drugs that need to further elucidation. Previous studies have shown that oral paroxetine significantly increases 5-HT levels in patients within a week, but in reality patients need to take paroxetine for several weeks or more to achieve a therapeutic effect, which seems to contradict the monoamine hypothesis [7]. In recent years, there has been a growing recognition that the gut microbiota may be a potentially relevant factor in the onset and progression of depression [8]. Some evidence shows that dysfunction of the microbiota-gut-brain axis may play an influential role in the pathogenesis of depression, which involves the enteric nervous system, the immune system, the blood-brain barrier, the hypothalamic-pituitary-adrenal axis, and the central nervous system [9]. This hypothesis has been substantiated by animal experiments, demonstrating that the transplantation of feces obtained from depressed humans or depressive-like mice to healthy mice resulted in a deficit of pleasure and depressive-like symptoms [10]. For individuals suffering from depression, the consumption of probiotics has the potential to restore balance to gut flora fluctuations and modulate the metabolic activity of gut microbes. The production of beneficial metabolites may contribute positively to the reestablishment of homeostatic equilibrium in these patients [11–13]. Additionally, natural compounds hold considerable promise as antidepressants, with complex mechanisms of action that may involve brain function, immunity, the hypothalamic-pituitary-adrenal axis and gut flora [14–16]. Despite significant advances in comprehending depression, there is no single theory or mechanism that entirely elucidates the various facets of this disorder. Such limitations have restricted research into antidepressant medication [17]. Traditional Chinese medicine, which has shown efficacy in the treatment of depression and associated clinical conditions, and explaining the mechanism of action of natural compounds in Chinese medicine may be an acceptable option for understanding the pathogenesis of depression.

Chaihu-Shugan-San is a traditional herbal remedy that previous studies have demonstrated to exhibit antidepressant-like effects in a variety of depression-like animal models [18,19]. Saikosaponin A (SSA), a triterpenoid saponin, is the main ingredient in this formulation and has a wide range of pharmacological activities including anti-inflammatory, antioxidant and anti-malignant effects [20,21]. Previous research has indicated that SSA intervention can suppress the manifestation of apoptotic markers like Bax and Caspase-3, enhance the activity of hippocampal neurons. This ultimately has a positive impact on ameliorating post-stroke depression-like behavior in rats [22]. In addition, Guo performed a proteomic-based evaluation of the antidepressant properties of SSA, which indicated proline transmembrane protein 2 has a crucial role in a rat depression model caused by chronic unpredictable mild stress [23]. The findings have established a significant correlation between SSA and depressive symptoms, suggesting a potential role of SSA in the pathophysiology of depression. Nonetheless, the underlying mechanisms of SSA’s impact on mood disorders require more in-depth investigation to fully elucidate its therapeutic potential and possible side effects.

Reserpine (RSP), an alkaloid extracted from the roots of the serpentine loosestrife plant, possesses antihypertensive properties. It is widely used in the design of animal models of depression and in the screening of potential antidepressants [24,25] Accordingly, our study delved into the molecular underpinnings of SSA’s antidepressant efficacy within the RSP-induced depression-like paradigm in mice, with a particular focus on the modulation of intestinal microbiota by SSA. Our research offers novel insights regarding the antidepressant effect of SSA and provide a basis for further treatment of depression.

2. Materials and methods

2.1. Ethics statement

The present study was conducted under the approval of Institutional Animal Care and Use Committee of Northeast Agricultural University (Heilongjiang province, China) (SYXK (Hei) 2012 – 2067) in accordance with Laboratory Animal-Guideline for ethical review of animal welfare (GB/T 35892 – 2018, National Standards of the People’s Republic of China). Mice are anesthetized with ketamine and then euthanized, with all efforts made to minimize suffering.

2.2. Animal experiments

Six-week-old male C57BL/6 mice were purchased from Changsheng Biotechnology Co. (Liaoning, China). Throughout the experimental period, the temperature in the animal laboratory was maintained at 25 ± 2%, the humidity was set at 45–55%, and the animals were subjected to a 12-hour light-dark cycle. After one week of acclimatization, the mice were allocated randomly into four groups: control group (CG), RSP group, RSP + SSA group, and SSA group. The mice in the RSP group and RSP + SSA group were administered RSP (Yuanye, Shanghai) intraperitoneally at a dose of 0.5 mg/kg from day 1–8, and 0.25 mg/kg for the following week, to induce the depression model. The blank control and SSA groups were given the same amount of solvent injection. On days 1–15, the groups receiving RSP + SSA and SSA were orally dosed with SSA (Yuanye, Shanghai) at a concentration of 50 mg/kg. The blank control and RSP groups were administered the same volume of saline by oral gavage. The experimental protocol and dosing regimen are illustrated in Fig 1A. At the conclusion of the experiment, all mice were anesthetized using isoflurane and subsequently euthanized via cervical dislocation. Blood and tissue samples were collected for use in relevant experiments or stored at −80 °C.

Fig 1 — (A) Experimental flow chart, this chart was created through Microsoft Office PowerPoint and is in the free domain. (B) Changes in body weight of mice in different groups (n = 10). (C) Forced swimming test (n = 3). (D) The tail suspension test (n = 3). (E) Sucrose preference test (n = 3). Data are mean ± SD values. Bars with different lowercase letters indicate significant difference (p < 0.05).

2.3. Body weight changes

All mice were weighed on days 1, 7 and 14 after grouping and were given only water for the first 12 hours of body weight testing.

2.4. Behavioral tests

All behavioral tests in this study were recorded without the recorder being informed of the purpose of the tests.

2.4.1. The forced swimming test (FST).

The forced swimming test was conducted according to a previously established methodology [26]. Prepare a cylindrical container that is 50 cm tall and 22.5 cm in diameter, by adding warm water at a temperature of 25 °C until the water level reaches 37 cm. During the initial 2-minute period when mice were first placed in the bucket, the duration of immobility was not recorded. Subsequently, over the following 4 minutes, the total duration of immobility was recorded when the mice reached a stable, typical immobile posture.

2.4.2. The tail suspension test (TST).

The tail suspension test is conducted concerning the previously established methodology [27]. Briefly, mice were subjected to visual and acoustic isolation and restrained with tape approximately 1 cm from the tail tip, suspended 50 cm above the ground. Notably, only the last 4 minutes of the 6-minute immobility period were recorded for analysis.

2.4.3. The sucrose preference tests (SPT).

Sucrose preference tests were carried out on day 1 and day 15 post-grouping. Prepare two bottles, one with water and the other with 1% sucrose solution, and place them on the cage at the same time. The mice underwent a 3-hour period of fasting and hydration before being allowed to access the bottles freely. The two bottles alternate positions every 8 hours. Sucrose preference was calculated using to the following formula: Sucrose preference = Sucrose intake (mL)/Total fluid intake (mL) x 100%.

2.5. Enzyme-linked immunosorbent assay (ELISA)

Determination of 5-HT, DA, NE, TNF-α, and IL-1β in mice was performed in strict accordance with the guidelines outlined by the manufacturer of the reagents (Nanjing JianCheng Bioengineering Institute, China). Out of these, 5-HT, DA and NE were measured with blood samples and the rest with homogenized hippocampal tissue.

2.6. Histopathological examination

Hematoxylin-eosin (HE) and Fluoro-Jade B (FJB) staining were executed according to previously defined techniques [28,29]. Briefly, the mouse hippocampi were removed meticulously on ice and submerged in 4% tissue fixative. This was then succeeded by dehydration, fixation, sectioning, and staining. Sections are observed through either a light or fluorescence microscope.

2.7. Detection of oxidant status

Measure the levels of lipid peroxidation (LPO) and total ROS in the hippocampus of the mouse according to the instructions provided by the reagent supplier. The hippocampus used for LPO and ROS assays was fresh mouse hippocampal tissue. Enzyme markers or inverted fluorescence microscopy were used to observe the results.

2.8. Real-time PCR (qPCR)

According to the instructions, total RNA was extracted from the mouse hippocampus using Trizol solution (Takala, Dalian, China), followed by the reverse transcription kit (Takala, Dalian, China) to transcribe the RNA into cDNA. Real-time qPCR reactions using a Roche Light Cycler instrument [30]. Results were analyzed with the 2^− ΔΔCT method. With GAPDH as the internal reference, the sequences of the internal reference and the other primers are shown in detail in Table 1.

Table 1. List of primers used in qRT-PCR.

Gene	Primer sequence (5’ − 3’)
GAPDH	Forward	TCGGGCCACGCTAATCTCAT
GAPDH	Reverse	ACGGCCAAATCCGTTCACA
TNF-α	Forward	CCCAAAGGGATGAGAAGTTCC
TNF-α	Reverse	GCTACAGGCTTGTCACTCGAA
IL-1β	Forward	TGCACCAGATGGATGACCAACTGCTTAGC
IL-1β	Reverse	GGCATGGAGCGTTATTGCAACTGTGGTCATGAG
TNFR1	Forward	AAATAGTCCTTCCTACCCCAA
TNFR1	Reverse	CCGAGTAGATCTCAAAGTGAC
NF-κB	Forward	TGCCAAGAGTGATGACGAGGAGAG
NF-κB	Reverse	TGA-GCGTGGAGGTGGATGATGG

Open in a new tab

2.9. Western blot analysis (WB)

Western blotting assays refer to previous description [31]. In short, mouse hippocampal proteins were extracted from the RIPA lysate containing PMSF and their concentration was then measured using the BCA kit (Beyotime, China). The protein samples were treated with SDS buffer and heated in a metal bath at 95 °C for 10 minutes to denature them. The proteins were separated by a 12.5% separating gel and transferred to nitrocellulose membranes. Next, skimmed milk blocking, TBST wash, primary antibody treatment, secondary antibody treatment. Observation of the expression of proteins after treatment of membranes with enhanced chemiluminescence reagents.

2.10. 16S rRNA amplicon sequencing, data processing and analysis

DNA was extracted from mouse feces using the MagPure Stool DNA KF Kit (Magen, China) according to the reagent manufacturer’s instructions. The quantification of DNA was performed using Nanodrop and the quality of the extract was checked by 1.2% agarose gel electrophoresis. PCR amplification was carried out using Pfu high-fidelity DNA polymerase (TransGen Biotech, China) in accordance with the protocol supplied by the reagent manufacturer. Amplified products were purified by adding a specific amount of Vazyme VAHTSTM DNA Clean Beads and were then eluted using an Elution Buffer. The DNA libraries were created employing the TruSeq Nano DNA LT Library Prep Kit and quantified using the Quant-iT PicoGreen dsDNA Assay Kit. Initial screening yielded raw sequence data, which were later classified into libraries and samples, based on Barcode and Index information. The barcode sequences were eliminated from the final samples. Finally, the sequences underwent quality monitoring and sequence splicing as per the Vsearch software. Bioinformatics analysis of the data was conducted via the personal bio-Gene Cloud platform (https://www.genescloud.cn/).

2.11. Statistical analysis

All experiments were carried out at least three times (n = 3), and the simultaneous values are presented as mean ± standard deviation. One-way ANOVA with Duncan’s multiple-range test was used to analyze statistically significant differences between these experimental groups using the Statistical Package for Social Sciences (SPSS, version 24.0).

3. Results

3.1. Effects of SSA on RSP-induced weight changes and behavioral tests

The weights of the mice were monitored on a weekly basis. Fig 1B indicates that no significant differences were observed within any of the groups on the initial day. Persistent weight loss was observed in mice from the RSP group following the reserpine challenge. However, the oral administration of SSA inhibited weight loss and, compared with the RSP group, the RSP + SSA group improved the RSP injection-induced weight loss trend to some extent by day 7 and reversed the downward trend with weight gain by day 14 (p < 0.05)

In this investigation, FST, TST and SPT were employed to assess anhedonia, despondent behavior, and the therapy of these symptoms by SSA in mice. In the FST and TST tests, immobility time was significantly prolonged in RSP-treated mice compared to the CG group, whereas it was shortened after SSA treatment (Fig 1C and D). In the initial SPS tests, all groups of mice displayed a liking for sugar water (Fig 1E). In the subsequent trial, some changes were observed. Specifically, mice in the RSP group increased their consumption of pure water, whilst the preference for sucrose water significantly reduced, in comparison to the RSP + SSA group (p < 0.05). In both the weight change and behavioral test trials, there was no discernible statistical difference between the SSA and CG groups (p > 0.05). The findings indicate that RSP can cause the emergence of depressive-like behaviors in mice, and that SSA treatment may effectively in stalling the exacerbation of these symptoms.

3.2. Effect of SSA on monoamine neurotransmitters in RSP-induced mice

Levels of monoamine neurotransmitters in the body are an important indicator of mood disorders. As illustrated in Fig 2, RSP-induced depressed mice showed a remarkable decrease in blood monoamine neurotransmitters compared to the CG group. Oral administration of SSA was effective in improving DA levels in the blood of the mice (p < 0.05), but they were still lower than in the CG group (p < 0.05). In addition, the modulation of NE levels by SSA showed no significant effects. Surprisingly, SSA-treated 5-HT levels were significantly elevated, with no significant difference compared to the CG group (p > 0.05). Oral administration of SSA alone does not significantly alter monoamine neurotransmitter levels, suggesting that the modulation of these neurotransmitters by SSA is not a direct mechanism of its antidepressant action. However, our results indicate that SSA treatment may partially counteract the RSP-induced reduction in monoamine neurotransmitter levels, offering a potential therapeutic strategy for depression.

3.3. Effects of SSA on RSP-induced damage to the hippocampus

Hippocampal neuronal damage and reduction is a marker of clinical depression. Results from HE showed that RSP treatment resulted in fewer neurons and structural abnormalities in the mouse hippocampus (Fig 3C). FJB staining is utilized to ascertain neuronal degeneration. In this experiment, neuronal cell death in the hippocampus was detected using FJB staining (Fig 3A). The findings indicate a significant increase in the number of positive cells within the hippocampus of mice in the RSP group when compared to the CG group. However, this effect was mitigated effectively in the RSP + SSA group (Fig 3A and B). This indicates that the administration of SSA hinders the degeneration of neurons induced by RSP in the hippocampus.

Fig 3 — (A) FJB staining results, Cell nuclei appear blue, while neuronal cells undergoing degeneration are displayed in green, red circle indicate FJB-positive cells. (B) Proportion of FJB-positive cells in hippocampus (n = 3). (C) HE staining results (n = 3), red arrows indicate reduced neuronal cells in the hippocampus with structural abnormalities.

3.4. Effect of SSA on RSP-induced oxidative stress in the hippocampus

Oxidative stress is a negative impact caused in the body by free radicals that is regarded to be a major factor in hippocampus damage. In this study, we utilized LPO and ROS to evaluate the oxidative stress status of the hippocampus. The levels of ROS in the hippocampus were appreciably higher in the mice that received RSP injections in comparison to those in the CG group (p < 0.05), but the hippocampal ROS levels were appreciably lower in the SSA-treated mice compared to those in the RSP group (p < 0.05). The LPO results suggest that SSA regulated RSP-induced oxidative stress effectively, thereby controlling the LPO concentration in the hippocampus of mice in the RSP + SSA group as compared to the RSP group (p < 0.05). The data indicates that SSA plays an antioxidant role in mitigating RSP-induced hippocampal damage (Fig 4).

Fig 4 — (A) The ROS Fluorescence staining graphs of each group of hippocampal cells under a light microscope (40×). (B) Analysis of DCFH-DA Fluorescent Staining Results. (C) The concentration of lipid peroxides in the mouse hippocampus. Data are mean ± SD values (n = 3). Bars with different lowercase letters indicate significant difference (p < 0.05).

3.5. Effect of SSA on RSP-induced pro-inflammatory factors in the hippocampus of mice

The presence of pro-inflammatory factors such as IL-1β and TNF-α in the brain damages neurons, causing neuroinflammation. As shown in Fig 5C and D, the levels of IL-1β and TNF-α mRNA were markedly increased in the hippocampus of mice in the RSP group compared with the CG group (p < 0.05), and there were no significant changes in the levels of IL-1β and TNF-α in the SSA group (p > 0.05). Notably, while the mRNA level of IL-1β in the RSP + SSA group remained significantly higher than that of the CG group (p < 0.05), TNF-α had decreased to the same level as the CG group (p > 0.05). The ELISA findings were in agreement with the above results that intraperitoneal injection of RSP results in the elevation of pro-inflammatory factors in the hippocampus, however, IL-1β and TNF-α levels in the hippocampus of mice after SSA treatment were significantly regulated, especially TNF-α. These results suggest that SSA is involved in the immune response of the nervous system.

3.6. Effect of SSA on RSP-induced activation of TNFR1/NF-κB signaling pathway in mouse hippocampus

To explore the mechanism of action of SSA in reducing pro-inflammatory factors, we investigated the effect of SSA on the TNFR1/NF-κB pathway. As displayed in Figs 5A, B and 6, the mRNA levels of TNFR1 and NF-κB were significantly increased in the RSP group compared with the CG group (p < 0.05), while the WB results showed that RSP lead to the overexpression of TNFR1 and phosphorylated IκB proteins in the hippocampus of mice (p < 0.05). In contrast, SSA treatment inhibited the TNFR1/NF-κB signaling pathway resulting in a notable reduction in related mRNA and protein expression levels. Meanwhile, there was no significant difference in the mRNA and protein expression levels of TNFR1 and NF-κB in the SSA group compared to the CG group. The findings demonstrate that SSA treatment suppresses the activation of the TNFR1/NF-κB pathway in the hippocampus of mice in the RSP-induced depression model.

Fig 6 — Determination of inflammatory factors (A) IL-1β and (B) TNF-α in the hippocampus by ELISA. The expression of proteins related to the TNFR1/NF-κB signaling pathway in mouse hippocampus was demonstrated in (C) and (D). Data are mean ± SD values (n = 3). Bars with different lowercase letters indicate significant difference (p < 0.05).

3.7. Effect of SSA on the RSP-induced intestinal flora of mice

Previous research indicates that modifying the gut microbiota could be a promising intervention for managing or alleviating depressive symptoms. In this experiment, the overall configuration of the gut microbiome in mouse fecal matter was analyzed by sequencing the 16S rRNA gene. As shown in Fig 7A and B, the Chao1 index and Shannon index showed that the dilution curves of all groups increased sharply and then flattened as the sequencing depth increased, indicating that the 16S rRNA sequencing results of the contents of the mouse small intestine met the expected depth requirements and could be analyzed in the next step. At the gate level, there was no significant variation in the relative abundance of RSP in Firmicutes, Verrucomicrobia, and Actinobacteria when compared to the CG group, except for Bacteroidetes. However, in SSA-treated mice, a different outcome emerged, with Firmicutes being down-regulated and Verrucomicrobia being up-regulated in RSP + SSA as opposed to SSA (Fig 7C–E). The results of Alpha and Bete analyses showed that there was a significant separation of the gut microbiota between the four groups of mice, in addition, the RSP group showed a significant decrease in Chao1, Faith-pd, Shannon and Observed-species indices (Fig 7F and G). As depicted in Fig 7H, the thermogram exhibits that at the genus level, there exists a certain degree of independence in the composition of the gut microbiota of the four groups of mice. The results of the LefSe analysis indicated Actinobacteria and Tenericutes as the dominant bacteria in the gut microbiota of mice in the CG group. Whereas, Synergistetes were found to be dominant in the RSP group, and TM7 in the RSP + SSA group. Moreover, Proteobacteria, Cyanobacteri, and Deferribacteres were identified as the dominant bacteria in the SSA group (Fig 7I). These findings demonstrate that SSA significantly modulated the gut microbiota in RSP-challenged mice, thereby inducing novel and significant shifts in the composition of the pre-existing gut microbiota.

Fig 7 — Rarefaction curves of the gut microbiota in each group were analyzed using (A) Chaos and (B) Shannon indices. Taxonomic analyses of bacteria at the phylum and genus levels in various gut microbiota groups are represented by (C–E). (F) NMSD analysis between different groups. (G) Analysis of alpha diversity between different groups. (H) Thermograms were analyzed between different groups. (I) Analysis of LefSe between different groups. Data are mean ± SD values (n = 5). Bars with different lowercase letters indicate significant difference (p < 0.05).

4. Discussion

Currently, there is insufficient evidence to specify the precise pathogenesis of depression according to scientific research [17]. However, several drugs have been used by researchers to treat various animal models of depression to support their hypothesis [32]. SSA is the active ingredient in Chaihu-Shugan-San, which also has a potential role in the treatment of depression. Current evidence suggests that the antidepressant mechanism of SSA is in accordance with the hippocampal neuronal regeneration disorder hypothesis, whereby enhancement of the state of hippocampal neurons alleviates depressive-like behaviors in animals [22,23,33]. Furthermore, a study has illustrated that SSA may serve as a viable therapeutic option for severe acute pancreatitis (SAP). The intervention of SSA reduced the inflammatory response and oxidative signaling by altering the abundance of intestinal flora in rats [34]. This indicates that there are unexplored mechanisms for treating depression with SSA, particularly in addition to the hippocampal neural deficit hypothesis. Induction using RSP is a viable method of modeling depression and can effectively assess the effects of antidepressants [35]. Here, we investigated the therapeutic effects of SSA in a model of RSP-induced depression. The results showed that SSA could exert antidepressant effects by increasing blood monoamine levels, attenuating hippocampal inflammatory damage and oxidative stress, and altering gut microbiota in mice.

There is strong evidence from numerous studies that a dynamic homeostasis between the gut flora and the host has been shown to exist [36]. Once this balance is upset, the flora can impact the host’s health via many pathways, such as energy absorption, endotoxemia and the cerebral-intestinal axis [37]. Our findings demonstrated that the RSP and SSA treatments changed the intestinal flora of the mice. Notably, in contrast to the CG and RSP groups, the SSA treatment increased the relative abundance of Verrucomicrobia while decreasing the relative abundance of Firmicutes. Aika Kosuge and colleagues discovered an increased abundance of Verrucomicrobia in the gut microbiome of a mouse model with depression induced by chronic social stress, and that reducing Verrucomicrobia led to improved depression symptoms [38]. However, there is some evidence that Verrucomicrobia abundance is negatively associated with inflammatory bowel disease, hypertension, depression, and premature aging [39–41]. Therefore, the mechanisms by which Verrucomicrobia plays a role in different diseases still need to be explored. Here, our results support the beneficial properties of Verrucomicrobia, at least in this study. The study revealed that in RSP-challenged mice, the gut microbiota exhibited a diminished abundance of Verrucomicrobia. In contrast, mice administered with SSA displayed a significant increase in Verrucomicrobia levels, despite RSP exposure. Furthermore, a detailed analysis of Verrucomicrobia species indicated a substantial enrichment of Akkermansia muciniphila in response to SSA treatment. Since Akkermansia muciniphila was discovered and identified in the early 20th century, a large body of literature has shown that its deficiency or reduced abundance is associated with a variety of diseases, including diabetes, obesity, inflammation and depression, and it has been hailed as a paradigm for the next generation of beneficial microbes [42]. Recent research indicates that the provision of Akkermansia muciniphila supplements facilitates the metabolism of host β-alanyl-3-methyl-lhistidine and edaravone, and that the administering of these two metabolites in isolation has a marked effect on the treatment of chronic stress-induced depressive symptoms [43]. Interestingly, it was found that Amuc_1100, an outer membrane protein from Akkermansia muciniphila, could ameliorate chronic unpredictable mild stress-induced anxiety and depression-like behavior in mice [44]. Another study proposes that Akkermansia muciniphila improves symptoms similar to depression in mice by repairing the intestinal barrier and reducing intestinal inflammation [45]. Furthermore, the SSA treatment lowered the abundance of Firmicutes as well as the Firmicutes/Bacteroidetes ratio, which is beneficial for controlling host inflammation [46,47]. Taken together, treatment with SSA alleviates symptoms of depression in mice induced by RSP by altering the composition of the gut microbiota, however, the exact mechanism requires further investigation. It should be noted that the gut flora of humans and mice differ between species, and the effect of SSA on the human gut flora needs to be further investigated.

In recent years, research has increasingly clarified the role of the gut microbiome in the brain-gut axis. The gut microflora is implicated in host metabolism, immune response, and even monoamine neurotransmitter synthesis [12]. The monoamine hypothesis indicates a close connection between depression and monoamine neurotransmitters [48]. However, RSP treatment disrupts the function of vesicular monoamine transporter 2 (VMAT2), thereby inhibiting the reuptake of monoamine neurotransmitters. This inhibition leads to an excessive accumulation of these neurotransmitters in the synaptic cleft. Contrary to expectations, this overaccumulation does not induce hyperexcitability of neural activity. On the contrary, it enhances the exposure of monoamines to monoamine oxidase (MAO) within the synaptic cleft, promoting oxidative catabolism. This process suppresses excitatory stimuli in the brain, potentially triggering the expression of depressive-like behaviors. Common behavioral assays for assessing depression include the FST, TST and SPT. The current experiment utilized immobility time in mice and preference for sucrose water to confirm the establishment of the depression model. The findings revealed a considerable increase in immobilization time and a decrease in desire for sucrose water in the RSP group compared to the CG group, behaviors that were assumed to indicate the mice’s despair and lack of happiness. However, treatment with SSA effectively improved exercise duration, reduced immobility time, increased sucrose water consumption, and inhibited RSP-induced weight loss in mice. Interestingly, treatment with SSA also reversed RSP-induced decreases in 5-HT and DA. These data appear to indicate that SSA treatment may have a beneficial effect on depression-like symptoms in mice by increasing levels of monoamine neurotransmitters. In fact, key players in vesicle fusion and release processes include SNARE and Syt1, proteins associated with the release of neurotransmitters. SNARE proteins are distributed across synaptic vesicles and presynaptic membranes and are involved in the core fusion mechanism [49]. In summary, it is conjectured that that SSA not only plays a role in regulating the gut microbiota, but also affects monoamine transmitter levels in mice, including the regulation of SNARE, Syt1 and Ca²⁺. However, the mechanism by which the microbiota affects monoamine neurotransmitter levels remains to be investigated.

Neuropathophysiology demonstrates that nerve cell damage and atrophy in the hippocampus serve as structural indicators for the onset of depression. In this experiment, the results of histopathological sections showed that RSP-treated hippocampus can reduce the number of neurons, structural abnormalities and cause neuronal degeneration. Furthermore, elevated levels of pro-inflammatory factors IL1-β and TNF-α were observed in the hippocampus, accompanied by an upregulation in LPO concentration and ROS levels. In agreement with previous studies, SSA possessed anti-inflammatory and antioxidant activities [22] that significantly inhibited inflammation and oxidative stress in RSP-challenged mice. As research into inflammation and depression deepens, the cytokine doctrine of depression is becoming more acknowledged. Current evidence indicates that cytokine transduction can initiate numerous biological effects downstream, such as neuroendocrine, oxidative stress systems, and monoaminergic pathways. Subsequent changes in these systems can result in the ‘disease behavior [50]. For a long time, TNF-α has been one of the molecules at the core of the study of the cytokine hypothesis of depression, and it has been consistently reported to be associated with the pathogenesis of depression [51]. A study indicates that TNF-α exerts an impact on the levels of central tryptophan neurotransmitters by modulating glial cell 5-HT receptor activity [52]. This suggests that TNF-α may be implicated in the regulation of monoamine neurotransmitter homeostasis, which is implicated in depressive-like behavior in mice. During the trial, it was noted that TNF-α levels were restored to control levels after SSA treatment. Further investigation was conducted to understand the mechanism of action of SSA on TNF-α, specifically examining the impact of SSA on the TNFR1/NF-κB signaling pathway. The activation of the TNFR1 receptor, which contains a death domain, seems to promote cell death and inflammation. In contrast, TNFR2 receptor activation benefits cell survival and tissue regeneration [53]. Moreover, in neurons, an increase in TNF-α levels can rapidly boost excitatory synaptic strength through TNFR1, cause excessive Ca^2 + influx, leading to excitotoxicity, and ultimately foster neuronal apoptosis [54]. Overall, our findings indicate that SSA has the potential to lessen the release of pro-inflammatory markers, with a particular focus on TNF-α, by inhibiting the activation of the TNFR1/NF-κB signaling pathway, thereby ameliorating RSP-induced neuronal inflammatory injury in the mouse hippocampus. Based on the above results, it can be inferred that SSA may have multi-target effects or can affect changes in monoamine substances and inflammatory factors by mediating gut microbiota, but the specific mechanism needs further research.

In conclusion, this study explores three prevailing hypotheses regarding the pathogenesis of depression: the monoamine hypothesis, the gut-brain axis, and the role of inflammatory factors. Our study shows that SSA effectively ameliorates RSP-induced depressive-like symptoms in mice through several aspects involving monoaminergic transmitters, inflammation, oxidative stress and gut microbiota. Furthermore, our study results not only extend the understanding of SSA for the treatment of RSP-induced depression, but also provide data to support the clinical application of SSA.

Supporting information

S1 Data. All raw data in this study were uploaded in the form of supplementary materials, named as Raw data 1 and Raw data 2-1 and Raw data 2-2.

(ZIP)

pone.0311207.s001.zip^{(272.7MB, zip)}

Acknowledgments

We are grateful to Dr. Zhiyong Wu, Laboratory of Pharmacology and Toxicology, College of Animal Medicine, Northeast Agricultural University, for the support of the experiment.

Abbreviations

SSA: Saikosaponin A
RSP: reserpine
ROS: reactive oxygen species
IL-1β: interleukin-1beta
TNF-α: tumor necrosis factor-α
5-HT: 5-hydroxytryptamine
DA: dopamine
NE: norepinephrine
Bax: BCL2-associated X
CREB: cAMP-response element binding protein
BDNF: brain-derived neurotrophic factor
CG: control group
TST: tail suspension test
SPT: sucrose preference test
ELISA: Enzyme-Linked Immunosorbent Assay
HE: hematoxylin-eosin
FJB: Fluoro-Jade B
LPO: lipid peroxidation
TNFR1: tumor necrosis factor receptor-1
NF-κB: nuclear factor kappa-light-chain-enhancer of activated B cells
SAP: severe acute pancreatitis
SNARE: soluble N-ethylmaleimide-sensitive factor attachment protein receptor
Syt1: synaptotagmin-1

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This project was supported by the funding programs, “Natural Science Foundation of Inner Mongolia, 2024QN08067, and High level Clinical Specialist Construction Project of Public Hospitals in the Capital Region of Inner Mongolia Autonomous Region 2023SGGZ0005. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Kalin NH. Insights into suicide and depression. Am J Psychiatry. 2020;177(10):877–80. doi: 10.1176/appi.ajp.2020.20081207 [DOI] [PubMed] [Google Scholar]
2.McCarron RM, Shapiro B, Rawles J, Luo J. Depression. Ann Intern Med. 2021;174(5):ITC65–80. doi: 10.7326/AITC202105180 [DOI] [PubMed] [Google Scholar]
3.Keller MC, Neale MC, Kendler KS. Association of different adverse life events with distinct patterns of depressive symptoms. Am J Psychiatry. 2007;164(10):1521–9. doi: 10.1176/appi.ajp.2007.06091564 [DOI] [PubMed] [Google Scholar]
4.Tiemeier H. Biological risk factors for late life depression. Eur J Epidemiol. 2003;18(8):745–50. doi: 10.1023/a:1025388203548 [DOI] [PubMed] [Google Scholar]
5.Luo X, Zhu D, Li J, Ren M, Liu Y, Si T, et al. Selection of the optimal dose of sertraline for depression: a dose-response meta-analysis of randomized controlled trials. Psychiatry Res. 2023;327115391. doi: 10.1016/j.psychres.2023.115391 [DOI] [PubMed] [Google Scholar]
6.Davey CG, Chanen AM, Hetrick SE, Cotton SM, Ratheesh A, Amminger GP, et al. The addition of fluoxetine to cognitive behavioural therapy for youth depression (YoDA-C): a randomised, double-blind, placebo-controlled, multicentre clinical trial. Lancet Psychiatry. 2019;6(9):735–44. doi: 10.1016/S2215-0366(19)30215-9 [DOI] [PubMed] [Google Scholar]
7.Kalin NH. New insights into major depression and the treatment of bipolar depression. Am J Psychiatry. 2021;178(12):1071–4. doi: 10.1176/appi.ajp.2021.21101042 [DOI] [PubMed] [Google Scholar]
8.Chudzik A, Orzyłowska A, Rola R, Stanisz GJ. Probiotics, prebiotics and postbiotics on mitigation of depression symptoms: modulation of the brain-gut-microbiome axis. Biomolecules. 2021;11(7):1000. doi: 10.3390/biom11071000 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Park C, Brietzke E, Rosenblat JD, Musial N, Zuckerman H, Ragguett RM, et al. Probiotics for the treatment of depressive symptoms: An anti-inflammatory mechanism? Brain Behav Immun. 2018;73:115–24. doi: 10.1016/j.bbi.2018.07.006 [DOI] [PubMed] [Google Scholar]
10.Socała K, Doboszewska U, Szopa A, Serefko A, Włodarczyk M, Zielińska A, et al. The role of microbiota-gut-brain axis in neuropsychiatric and neurological disorders. Pharmacol Res. 2021;172:105840. doi: 10.1016/j.phrs.2021.105840 [DOI] [PubMed] [Google Scholar]
11.Hughes R. Intestinal flora and nutrition. Ind Med Gaz. 1944;79(8):396–7. [PMC free article] [PubMed] [Google Scholar]
12.Zorkina YA, Syunyakov TS, Abramova OV, Yunes RA, Averina OV, Kovtun AS, et al. Effects of diet on the gut microbiome in patients with depression. Zh Nevrol Psikhiatr Im S S Korsakova. 2022;122(1. Vyp. 2):59–64. doi: 10.17116/jnevro202212201259 [DOI] [PubMed] [Google Scholar]
13.Zhao H, Jin K, Jiang C, Pan F, Wu J, Luan H, et al. A pilot exploration of multi-omics research of gut microbiome in major depressive disorders. Transl Psychiatry. 2022;12(1):8. doi: 10.1038/s41398-021-01769-x [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Fusar-Poli L, Vozza L, Gabbiadini A, Vanella A, Concas I, Tinacci S, et al. Curcumin for depression: a meta-analysis. Crit Rev Food Sci Nutr. 2020;60(15):2643–53. doi: 10.1080/10408398.2019.1653260 [DOI] [PubMed] [Google Scholar]
15.Han X, Xu T, Fang Q, Zhang H, Yue L, Hu G, et al. Quercetin hinders microglial activation to alleviate neurotoxicity via the interplay between NLRP3 inflammasome and mitophagy. Redox Biol. 2021;44:102010. doi: 10.1016/j.redox.2021.102010 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Guo LT, Wang SQ, Su J, Xu LX, Ji ZY, Zhang RY, et al. Baicalin ameliorates neuroinflammation-induced depressive-like behavior through inhibition of toll-like receptor 4 expression via the PI3K/AKT/FoxO1 pathway. J Neuroinflammation. 2019;16(1):95. doi: 10.1186/s12974-019-1474-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Nestler EJ, Hyman SE. Animal models of neuropsychiatric disorders. Nat Neurosci. 2010;13(10):1161–9. doi: 10.1038/nn.2647 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Liu Q, Sun NN, Wu ZZ, Fan DH, Cao MQ. Chaihu-Shugan-San exerts an antidepressive effect by downregulating miR-124 and releasing inhibition of the MAPK14 and Gria3 signaling pathways. Neural Regen Res. 2018;13(5):837–45. doi: 10.4103/1673-5374.232478 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Li W, Zhou R, Zheng J, Sun B, Jin X, Hong M, et al. Chaihu-Shugan-San ameliorates tumor growth in prostate cancer promoted by depression via modulating sphingolipid and glycerinphospholipid metabolism. Front Pharmacol. 2022;13:1011450. doi: 10.3389/fphar.2022.1011450 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Lu CN, Yuan ZG, Zhang XL, Yan R, Zhao YQ, Liao M, et al. Saikosaponin a and its epimer saikosaponin d exhibit anti-inflammatory activity by suppressing activation of NF-κB signaling pathway. Int Immunopharmacol. 2012;14(1):121–6. doi: 10.1016/j.intimp.2012.06.010 [DOI] [PubMed] [Google Scholar]
21.Peng D, Chen Y, Sun Y, Zhang Z, Cui N, Zhang W, et al. Saikosaponin A and its epimers alleviate LPS-induced acute lung injury in mice. Molecules. 2023;28(3):967. doi: 10.3390/molecules28030967 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Wang AR, Mi LF, Zhang ZL, Hu MZ, Zhao ZY, Liu B, et al. Saikosaponin A improved depression-like behavior and inhibited hippocampal neuronal apoptosis after cerebral ischemia through p-CREB/BDNF pathway. Behav Brain Res. 2021;403:113138. doi: 10.1016/j.bbr.2021.113138 [DOI] [PubMed] [Google Scholar]
23.Guo J, Zhang F, Gao J, Guan X, Liu B, Wang X, et al. Proteomics-based screening of the target proteins associated with antidepressant-like effect and mechanism of Saikosaponin A. J Cell Mol Med. 2020;24(1):174–88. doi: 10.1111/jcmm.14695 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Li Y, Yin Q, Li Q, Huo AR, Shen TT, Cao JQ, et al. Botulinum neurotoxin A ameliorates depressive-like behavior in a reserpine-induced Parkinson’s disease mouse model via suppressing hippocampal microglial engulfment and neuroinflammation. Acta Pharmacol Sin. 2023;44(7):1322–36. doi: 10.1038/s41401-023-01058-x [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Abdel-Rasoul AA, Saleh NA, Hosny EN, El-Gizawy MM, Ibrahim EA. Cardamom oil ameliorates behavioral and neuropathological disorders in a rat model of depression induced by reserpine. J Ethnopharmacol. 2023;308:116254. doi: 10.1016/j.jep.2023.116254 [DOI] [PubMed] [Google Scholar]
26.Porsolt RD, Anton G, Blavet N, Jalfre M. Behavioural despair in rats: a new model sensitive to antidepressant treatments. Eur J Pharmacol. 1978;47(4):379–91. doi: 10.1016/0014-2999(78)90118-8 [DOI] [PubMed] [Google Scholar]
27.Park BK, Kim NS, Kim YR, Yang C, Jung IC, Jang IS, et al. Antidepressant and anti-neuroinflammatory effects of bangpungtongsung-san. Front Pharmacol. 2020;11:958. doi: 10.3389/fphar.2020.00958 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Rehman SU, Ikram M, Ullah N, Alam SI, Park HY, Badshah H, et al. Neurological enhancement effects of melatonin against brain injury-induced oxidative stress, neuroinflammation, and neurodegeneration via AMPK/CREB signaling. Cells. 2019;8(7):760. doi: 10.3390/cells8070760 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Guo Y, Miao Y, Chen H, Wang K, Wang S, Wang R, et al. Revealing the mechanism: the influence of Baicalin on M1/M2 and Th1/Th2 imbalances in mycoplasma gallisepticum infection. Poult Sci. 2024;103(10):104145. doi: 10.1016/j.psj.2024.104145 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Wang S, Guo L, Gu F, Bao J, Guo Y, Zhang Y, et al. Quercetin restores respiratory mucosal barrier dysfunction in mycoplasma gallisepticum-infected chicks by enhancing Th2 immune response. Phytomedicine. 2024;133:155953. doi: 10.1016/j.phymed.2024.155953 [DOI] [PubMed] [Google Scholar]
31.Wang S, Jin X, Chen H, Han M, Bao J, Niu D, et al. Quercetin alleviates mycoplasma gallisepticum-induced inflammatory damage and oxidative stress through inhibition of TLR2/MyD88/NF-κB pathway in vivo and in vitro. Microb Pathog. 2023;176:106006. doi: 10.1016/j.micpath.2023.106006 [DOI] [PubMed] [Google Scholar]
32.Marwaha S, Palmer E, Suppes T, Cons E, Young AH, Upthegrove R. Novel and emerging treatments for major depression. Lancet. 2023;401(10371):141–53. doi: 10.1016/S0140-6736(22)02080-3 [DOI] [PubMed] [Google Scholar]
33.Chen XQ, Chen SJ, Liang WN, Wang M, Li CF, Wang SS, et al. Saikosaponin A attenuates perimenopausal depression-like symptoms by chronic unpredictable mild stress. Neurosci Lett. 2018;662:283–9. doi: 10.1016/j.neulet.2017.09.046 [DOI] [PubMed] [Google Scholar]
34.Li J, Han J, Lv J, Wang S, Qu L, Jiang Y. Saikosaponin A-induced gut microbiota changes attenuate severe acute pancreatitis through the activation of Keap1/Nrf2-ARE antioxidant signaling. Oxid Med Cell Longev. 2020;2020:9217219. doi: 10.1155/2020/9217219 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Antkiewicz-Michaluk L, Wąsik A, Możdżeń E, Romańska I, Michaluk J. Antidepressant-like effect of tetrahydroisoquinoline amines in the animal model of depressive disorder induced by repeated administration of a low dose of reserpine: behavioral and neurochemical studies in the rat. Neurotox Res. 2014;26(1):85–98. doi: 10.1007/s12640-013-9454-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Haahtela T, Holgate S, Pawankar R, Akdis CA, Benjaponpitak S, Caraballo L, et al. The biodiversity hypothesis and allergic disease: world allergy organization position statement. World Allergy Organ J. 2013;6(1):3. doi: 10.1186/1939-4551-6-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Sorboni SG, Moghaddam HS, Jafarzadeh-Esfehani R, Soleimanpour S. A comprehensive review on the role of the gut microbiome in human neurological disorders. Clin Microbiol Rev. 2022;35(1):e0033820. doi: 10.1128/CMR.00338-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Kosuge A, Kunisawa K, Arai S, Sugawara Y, Shinohara K, Iida T, et al. Heat-sterilized Bifidobacterium breve prevents depression-like behavior and interleukin-1β expression in mice exposed to chronic social defeat stress. Brain Behav Immun. 2021;96:200–11. doi: 10.1016/j.bbi.2021.05.028 [DOI] [PubMed] [Google Scholar]
39.Bárcena C, Valdés-Mas R, Mayoral P, Garabaya C, Durand S, Rodríguez F, et al. Healthspan and lifespan extension by fecal microbiota transplantation into progeroid mice. Nat Med. 2019;25(8):1234–42. doi: 10.1038/s41591-019-0504-5 [DOI] [PubMed] [Google Scholar]
40.Li J, Zhao F, Wang Y, Chen J, Tao J, Tian G, et al. Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome. 2017;5(1):14. doi: 10.1186/s40168-016-0222-x [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Wang L, Tang L, Feng Y, Zhao S, Han M, Zhang C, et al. A purified membrane protein from Akkermansia muciniphila or the pasteurised bacterium blunts colitis associated tumourigenesis by modulation of CD8+ T cells in mice. Gut. 2020;69(11):1988–97. doi: 10.1136/gutjnl-2019-320105 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Cani PD, Depommier C, Derrien M, Everard A, de Vos WM. Akkermansia muciniphila: paradigm for next-generation beneficial microorganisms. Nat Rev Gastroenterol Hepatol. 2022;19(10):625–37. doi: 10.1038/s41575-022-00631-9 [DOI] [PubMed] [Google Scholar]
43.Ding Y, Bu F, Chen T, Shi G, Yuan X, Feng Z, et al. A next-generation probiotic: Akkermansia muciniphila ameliorates chronic stress-induced depressive-like behavior in mice by regulating gut microbiota and metabolites. Appl Microbiol Biotechnol. 2021;105(21–22):8411–26. doi: 10.1007/s00253-021-11622-2 [DOI] [PubMed] [Google Scholar]
44.Cheng R, Zhu H, Sun Y, Hang T, Zhang M. The modified outer membrane protein Amuc_1100 of Akkermansia muciniphila improves chronic stress-induced anxiety and depression-like behavior in mice. Food Funct. 2022;13(20):10748–58. doi: 10.1039/d2fo01198k [DOI] [PubMed] [Google Scholar]
45.Chen T, Wang R, Duan Z, Yuan X, Ding Y, Feng Z, et al. Akkermansia muciniphila protects against psychological disorder-induced gut microbiota-mediated colonic mucosal barrier damage and aggravation of colitis. Front Cell Infect Microbiol. 2021;11:723856. doi: 10.3389/fcimb.2021.723856 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Wang J, Ishfaq M, Li J. Baicalin ameliorates mycoplasma gallisepticum-induced inflammatory injury in the chicken lung through regulating the intestinal microbiota and phenylalanine metabolism. Food Funct. 2021;12(9):4092–104. doi: 10.1039/d1fo00055a [DOI] [PubMed] [Google Scholar]
47.Verdam FJ, Fuentes S, de Jonge C, Zoetendal EG, Erbil R, Greve JW, et al. Human intestinal microbiota composition is associated with local and systemic inflammation in obesity. Obesity (Silver Spring). 2013;21(12):E607–15. doi: 10.1002/oby.20466 [DOI] [PubMed] [Google Scholar]
48.Spellman T, Liston C. Toward circuit mechanisms of pathophysiology in depression. Am J Psychiatry. 2020;177(5):381–90. doi: 10.1176/appi.ajp.2020.20030280 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Südhof TC, Rothman JE. Membrane fusion: grappling with SNARE and SM proteins. Science. 2009;323(5913):474–7. doi: 10.1126/science.1161748 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Suneson K, Lindahl J, Chamli Hårsmar S, Söderberg G, Lindqvist D. Inflammatory depression-mechanisms and non-pharmacological interventions. Int J Mol Sci. 2021;22(4):1640. doi: 10.3390/ijms22041640 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Krishnadas R, Cavanagh J. Depression: an inflammatory illness? J Neurol Neurosurg Psychiatry. 2012;83(5):495–502. doi: 10.1136/jnnp-2011-301779 [DOI] [PubMed] [Google Scholar]
52.Malynn S, Campos-Torres A, Moynagh P, Haase J. The pro-inflammatory cytokine TNF-α regulates the activity and expression of the serotonin transporter (SERT) in astrocytes. Neurochem Res. 2013;38(4):694–704. doi: 10.1007/s11064-012-0967-y [DOI] [PubMed] [Google Scholar]
53.Aggarwal BB, Gupta SC, Kim JH. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood. 2012;119(3):651–65. doi: 10.1182/blood-2011-04-325225 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Clark IA, Vissel B. Excess cerebral TNF causing glutamate excitotoxicity rationalizes treatment of neurodegenerative diseases and neurogenic pain by anti-TNF agents. J Neuroinflammation. 2016;13(1):236. doi: 10.1186/s12974-016-0708-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. 2025 Feb 10;20(2):e0311207. doi: 10.1371/journal.pone.0311207.r001

Author response to Decision Letter 0

18 May 2024

PLoS One. doi: 10.1371/journal.pone.0311207.r002

Decision Letter 0

Peng Zhong

17 Jul 2024

PONE-D-24-20060Saikosaponin A alleviates depressive-like behaviour induced by reserpine in mice by regulating gut microflora and inflammatory responsesPLOS ONE

Dear Dr. Yin,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

For Lab, Study and Registered Report Protocols: These article types are not expected to include results but may include pilot data.

==============================

Please submit your revised manuscript by Aug 30 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Peng Zhong, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ"

3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering

Please state what role the funders took in the study. If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.""

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "This work was supported by the the Natural Science Foundation of Inner Mongolia (2021M508068) and High level Clinical Specialist Construction Project of Public Hospitals in the Capital Region of Inner Mongolia Autonomous Region (2023SGGZ0005)."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

6. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

7. Regarding blot/gel data: PLOS ONE now requires that submissions reporting blots or gels include original, uncropped blot/gel image data as a supplement or in a public repository. This is in addition to complying with our image preparation guidelines described at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements. These requirements apply both to the main figures and to cropped blot/gel images included in Supporting Information. If the manuscript is positively reviewed, we will ask the authors to provide any missing raw image data for blot/gel results when they submit their first revision. As part of your review, please ensure that figures reporting blot or gel images comply with the journal’s image preparation guidelines and that the original data are provided following the journal’s request. If you have any questions or concerns about blot/gel figures or data for this submission, please email us at plosone@plos.org before issuing a decision letter.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. The overall English writing is not very standard; the author should revise it to make the English writing more standard.

2. The authors also write carelessly, with many typos in the manuscript, which could have been easily avoided if they had double-checked the manuscript before submitting it.

3. What is the sex of the mice? Are they all male or female? The authors should indicate this in the main text or materials and methods.

4. Line 68: “hydroxytryptamine(5-HT)” should be “hydroxytryptamine (5-HT)” with a space before the parenthesis. The same applies to the entire manuscript.

5. Line 221: “statis-tically” should be “statistically.”

6. Line 236: What does “CG” mean? Does it mean “control group”? The author should write the full name when using the abbreviation for the first time. The same applies to “HE,” “FJB,” etc.

7. Figure 1: What is the meaning of letters “a,” “b,” “c,” “d”? The authors write: “Bars with different lowercase letters indicate significant difference (p < 0.05).” But which groups were compared to get the significant differences? The authors should clearly write this in the figure legends or indicate it in the figures. The same applies to all the figures.

8. Line 258: Another section “3.2”? This should be section “3.3”, as there is already a “3.2.”

9. Line 259: Grammar/typo: “Hippocampal neuronal damage and reduction as a marker of clinical depression.” Maybe the authors mean “Hippocampal neuronal damage and reduction is a marker of clinical depression.”?

10. Line 266: Typo: “RSP+SSA group This indicates that” should be “RSP+SSA group. This indicates that.”

11. For Figure 3, the authors should quantify the number of positive cells in the hippocampus before claiming that “The findings indicate a significant increase in the number of positive cells within the hippocampus of mice in the RSP group when compared to the CG group” (Line 263-265). The same applies to Figure 3B. The author should quantify the HE staining results to show that there are “reduced neuronal cells in the hippocampus with structural abnormalities.” The same applies to Figure 4.

12. Figure 4A: The staining in Figure 4A is too faint to see. The author should quantify the signal to show the differences.

Reviewer #2: With this manuscript titled “Saikosaponin A alleviates depressive-like behaviour induced by reserpine in mice by regulating gut microflora and inflammatory responses” the authors found SSA effectively ameliorates RSP-induced depressive-like symptoms in mice through several aspects involving monoaminergic transmitters, inflammation, oxidative stress and gut microbiota.

The manuscript is pleasant to read. But I still have some concerns that need to be addressed.

Comments:

1) Since the current study was only done in male mice, author should discussion the limitation of sex difference effect of SSA.

2) Page 2, line 119. How many mice were used in the study? I noted some group have N=10 mice, but other groups have N=3 mice. Total mice?

3) It’s not clear to reader that Solvent is the vehicle for RSP or not.

4) Page 7, line 122, administration of RSP is ip or po?

5) Figure 1. Groups with N=3 mice are smaller N number for the behavior assay; it will be good include p and F value for each figure from One-way ANOVA test.

6) Any acute effect of SSA on Day 1 treatment compared to 14 days SSA treatment effect? Any dose-dependent manner of SSA in low, middle and high dose?

7) Any PK profile and half-life data of SSA?

8) It’s not clear to the reader that the behavior tests were conducted at dark or light phase. As the rodent is notational animals, the phenotype of behavior will be difference between dark and light phase. Authors should consider and discuss it.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 Feb 10;20(2):e0311207. doi: 10.1371/journal.pone.0311207.r003

Author response to Decision Letter 0

29 Aug 2024

Dear Editors and Reviewers,

We would like to express our gratitude for your valuable feedback on our manuscript. Your insights are invaluable in helping us to enhance and refine the manuscript. In light of the comments you have highlighted, we conducted a discussion and subsequent revision of the manuscript. Here, we resubmit the revised manuscript " Saikosaponin A alleviates depressive-like behavior induced by reserpine in mice by regulating gut microflora and inflammatory responses", (NO. PONE-D-24-20060). I would like to extend my gratitude once more to the editors of the journal “PLOS ONE” and the invited reviewers for your invaluable time and effort in the review process of this manuscript.

In light of the valuable feedback provided by the esteemed editors and reviewers, the manuscript has been meticulously revised. The comments that we responded to are presented below. The comments made by editors or reviewers are indicated in red, while our proposed revisions are indicated in blue. It is our sincere hope that you will be gratified by the results of our modification programme. It is our sincere hope that you will be satisfied with the revised manuscript.

Editorial requirements

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Dear Editors,

Thank you for your advice. Based on the link you provided, we have made changes to the manuscript. We hope that the revised manuscript meets the requirements of the journal.

Dear Editors,

Thank you for your valuable advice. Upon your request, we have registered the ORCID iD. Sincere wishes.

Dear Editors,

Thanks for the friendly advice. This part of the information has been included in the latest manuscript to ensure that animal welfare is safeguarded. Thanks again for the advice.

4. Thank you for stating the following financial disclosure: "This work was supported by the the Natural Science Foundation of Inner Mongolia (2021M508068) and High level Clinical Specialist Construction Project of Public Hospitals in the Capital Region of Inner Mongolia Autonomous Region (2023SGGZ0005)." Please state what role the funders took in the study. If the funders had no role, please state: ""The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."" If this statement is not correct you must amend it as needed Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

Dear Editors,

Thank you for your advice. In the cover letter we make a detailed presentation. We hope our answer satisfies you.

Author Contributions

Conceptualization: Xianwu Zhang, Zhaohui Yin and Menglin Wang.

Data curation: Menglin Wang, Haojun Li, Haifei Gao, Shun Wang, Yu Zhang.

Formal analysis: Menglin Wang, Wenjing Zhang, Miao Jia, Haifei Gao, Xianwu Zhang

Funding acquisition: Menglin Wang, Zhaohui Yin.

Investigation: Wenjing Zhang, Li Zhang, Miao Jia.

Methodology: Menglin Wang, Haojun Li, Shun Wang, Lu Jia, Yu Zhang.

Supervision: Haifei Gao, Yu Zhang.

Validation: Menglin Wang, Haojun Li, Li Zhang, Haifei Gao, Lu Jia.

Writing – original draft: Menglin Wang, Haojun Li, Li Zhang.

Writing – review & editing: Xianwu Zhang, Zhaohui Yin, Menglin Wang.

Both grant recipients participated in the experiment.

This work was supported by the Natural Science Foundation of Inner Mongolia (2024QN08067) and High level Clinical Specialist Construction Project of Public Hospitals in the Capital Region of Inner Mongolia Autonomous Region (2023SGGZ0005). Both grant recipients participated in the experiment.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This work was supported by the the Natural Science Foundation of Inner Mongolia (2021M508068) and High level Clinical Specialist Construction Project of Public Hospitals in the Capital Region of Inner Mongolia Autonomous Region (2023SGGZ0005)." We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "This work was supported by the the Natural Science Foundation of Inner Mongolia (2021M508068) and High level Clinical Specialist Construction Project of Public Hospitals in the Capital Region of Inner Mongolia Autonomous Region (2023SGGZ0005)."

Dear Editors,

Thank you for your advice. In response to your suggestion, we have removed this information from the acknowledgements section of the manuscript. Meanwhile we have updated our funding information.

Dear Editors,

Thank you for your advice. In the latest manuscript, we have made changes accordingly. Thanks again for the advice.

2.1 Ethics statement

The present study was conducted under the approval of Institutional Animal Care and Use Committee of Northeast Agricultural University (Heilongjiang province, China) (SYXK (Hei) 2012–2067) in accordance with Laboratory Animal-Guideline for ethical review of animal welfare (GB/T 35892–2018, National Standards of the People's Republic of China). Mice are anesthetized with ketamine and then euthanized, with all efforts made to minimize suffering.

Dear Editors,

Thank you for your advice. In the latest manuscript, our internal reference and the target protein are located on different membranes. Due to the proximity between the target protein and the internal reference, we conducted the experiments separately. The internal reference (GAPDH) and target proteins in our Western blot (WB) analyses are derived from the same batch of samples. To guarantee the precision of the experimental results, the WB experiments were conducted at least three times for each protein. We have uploaded the original Western Blot images of the respective experiment. We sincerely hope our response meets your satisfaction. Please accept this expression of sincerest gratitude for your invaluable counsel. Thanks again for the advice.

Reviewer #1:

1. The overall English writing is not very standard; the author should revise it to make the English writing more standard.

Dear Reviewers and Editors,

Thank you for your precious comments. In order to improve manuscript writing problems, we revised the manuscript to improve its readability. In addition, we invited the language editor to revise the language and style of the manuscript. We appreciate your meaningful input and sincerely hope our response meets with your approval.

2. The authors also write carelessly, with many typos in the manuscript, which could have been easily avoided if they had double-checked the manuscript before submitting it.

Dear Reviewers and Editors,

Thank you for taking the time to provide us with your feedback. We apologize for our carelessness. We have rechecked the manuscript several times and have corrected possible typos in the article. We hope our response meets with your approval. Thank you once more for your invaluable counsel.

3. What is the sex of the mice? Are they all male or female? The authors should indicate this in the main text or materials and methods.

Dear Reviewers and Editors,

We would like to express our gratitude for your valuable suggestions, which will undoubtedly contribute to the enhancement of the quality of our manuscripts. The sex of the mice (male) has been indicated in the manuscript Materials and Methods. We would like to thank you for your worthy suggestion.

4. Line 68: “hydroxytryptamine(5-HT)” should be “hydroxytryptamine (5-HT)” with a space before the parenthesis. The same applies to the entire manuscript.

Dear Reviewers and Editors,

The expression of gratitude is extended for the invaluable feedback provided. Such errors in the manuscript have been corrected in their entirety. We would like to express our gratitude once more for your endeavors to enhance the calibre of our manuscript.

5. 5. Line 221: “statis-tically” should be “statistically.”

Dear Reviewers and Editors,

We are grateful for your professional review work on our article. We've corrected the error. Please accept this expression of sincerest gratitude for your invaluable counsel.

Dear Reviewers and Editors,

Thank you for pointing out this issue in the manuscript. The abbreviation CG means control group. We've rechecked the manuscript to make sure all the abbreviations have full names. In addition, we have collated all the abbreviations in the manuscripts. Thank you once again.

SSA, Saikosaponin A; RSP, Reserpine; ROS, Reactive oxygen species; IL-1β, Interleukin-1beta; TNF-α, Tumor Necrosis Factor-α; 5-HT, 5-hydroxytryptamine; DA, Dopamine; NE, Norepinephrine; Bax, BCL2-Associated X; CREB, cAMP-response element binding protein; BDNF, Brain-derived neurotrophic factor; CG, Control group; TST, Tail Suspension Test; SPT, Sucrose Preference Test; ELISA, Enzyme-Linked Immunosorbent Assay; HE, Hematoxylin-eosin; FJB, Fluoro-Jade B; LPO, Lipid peroxidation; TNFR1, Tumor necrosis factor receptor-1; NF-κB, Nuclear Factor kappa-light-chain-enhancer of activated B cells; SAP, Severe acute pancreatitis; SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptor; Syt1, synaptotagmin-1;

Dear Reviewers and Editors,

We gratefully appreciate for your valuable suggestion. Data were analyzed by one-way ANOVA (Duncan's test) using SPSS (version 24.0). It was considered significant at P < 0.05. The a, b, c markers that appear in the figures are considered "significance markers." In our experiment, when the CG group is labeled as 'a' and the RSP group as 'b' or 'c', the distinct lowercase letter designations indicate a significant difference between the CG and RSP groups (P < 0.05). In contrast, when the CG group was labeled a and the RSP group was labeled a or ab there was no significant difference between the CG and RSP groups at this point (P > 0.05). Similarly, in the case of comparisons such as CG or RSP groups with other groups, simply observe the lowercase letters that are marked. Similar, only lowercase letters need to be observed to determine the difference between groups. We hope the revised manuscript meets your expectations. Your constructive comments are much appreciated.

8. Line 258: Another section “3.2”? This should be section “3.3”, as there is already a “3.2.”.

Dear Reviewers and Editors,

Thank you for the kind reminder, we have made the change. Thank you for your worthy suggestion.

Dear Reviewers and Editors,

Thank you for your nice suggestion and advice. With reference to your comments, the modifications have made our expression more precise. We sincerely hope that you are satisfied with the new changes.

10. Line 266: Typo: “RSP+SSA group This indicates that” should be “RSP+SSA group. This indicates that.”

Dear Reviewers and Editors,

Thank you for your careful review and constructive suggestions regarding our manuscript. We revised the manuscript by adding a period after RSP + SSA group. We apologize for our carelessness. Thank you once again for your valuable advice.

Dear Reviewers and Editors,

Thank you for your comments and providing good suggestions for our manuscript. We have visualized the proportion of FJB-positive cells in the hippocampus. In addition, in the HE section we have indicated the location of the lesion. The hippocampal cells at the lesion were abnormally arranged and reduced in number. In contrast, the hippocampal cells of the other groups of mice possessed a normal structure and the cells were tightly arranged. Visualization of ROS fluorescence intensity in the hippocampus is shown in Figure 4B. We hope will meet with your approval.

12. Figure 4A: The staining in Figure 4A is too faint to see. The author should quantify the signal to show the differences.

Dear Reviewers and Editors,

PLoS One. doi: 10.1371/journal.pone.0311207.r004

Decision Letter 1

Peng Zhong

16 Sep 2024

Saikosaponin A alleviates depressive-like behavior induced by reserpine in mice by regulating gut microflora and inflammatory responses

PONE-D-24-20060R1

Dear Dr. Yin,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Peng Zhong, Ph.D.

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: (No Response)

Reviewer #2: The revised version of manuscript is better than previous version. For one of my questions, the author should clarify the behavior tests were done in light or dark phase as rodent is nocturnal animals.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0311207.r005

Acceptance letter

Peng Zhong

PONE-D-24-20060R1

PLOS ONE

Dear Dr. Yin,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Peng Zhong

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Data. All raw data in this study were uploaded in the form of supplementary materials, named as Raw data 1 and Raw data 2-1 and Raw data 2-2.

(ZIP)

pone.0311207.s001.zip^{(272.7MB, zip)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting information files.

[pone.0311207.ref001] 1.Kalin NH. Insights into suicide and depression. Am J Psychiatry. 2020;177(10):877–80. doi: 10.1176/appi.ajp.2020.20081207 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref002] 2.McCarron RM, Shapiro B, Rawles J, Luo J. Depression. Ann Intern Med. 2021;174(5):ITC65–80. doi: 10.7326/AITC202105180 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref003] 3.Keller MC, Neale MC, Kendler KS. Association of different adverse life events with distinct patterns of depressive symptoms. Am J Psychiatry. 2007;164(10):1521–9. doi: 10.1176/appi.ajp.2007.06091564 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref004] 4.Tiemeier H. Biological risk factors for late life depression. Eur J Epidemiol. 2003;18(8):745–50. doi: 10.1023/a:1025388203548 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref005] 5.Luo X, Zhu D, Li J, Ren M, Liu Y, Si T, et al. Selection of the optimal dose of sertraline for depression: a dose-response meta-analysis of randomized controlled trials. Psychiatry Res. 2023;327115391. doi: 10.1016/j.psychres.2023.115391 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref006] 6.Davey CG, Chanen AM, Hetrick SE, Cotton SM, Ratheesh A, Amminger GP, et al. The addition of fluoxetine to cognitive behavioural therapy for youth depression (YoDA-C): a randomised, double-blind, placebo-controlled, multicentre clinical trial. Lancet Psychiatry. 2019;6(9):735–44. doi: 10.1016/S2215-0366(19)30215-9 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref007] 7.Kalin NH. New insights into major depression and the treatment of bipolar depression. Am J Psychiatry. 2021;178(12):1071–4. doi: 10.1176/appi.ajp.2021.21101042 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref008] 8.Chudzik A, Orzyłowska A, Rola R, Stanisz GJ. Probiotics, prebiotics and postbiotics on mitigation of depression symptoms: modulation of the brain-gut-microbiome axis. Biomolecules. 2021;11(7):1000. doi: 10.3390/biom11071000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref009] 9.Park C, Brietzke E, Rosenblat JD, Musial N, Zuckerman H, Ragguett RM, et al. Probiotics for the treatment of depressive symptoms: An anti-inflammatory mechanism? Brain Behav Immun. 2018;73:115–24. doi: 10.1016/j.bbi.2018.07.006 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref010] 10.Socała K, Doboszewska U, Szopa A, Serefko A, Włodarczyk M, Zielińska A, et al. The role of microbiota-gut-brain axis in neuropsychiatric and neurological disorders. Pharmacol Res. 2021;172:105840. doi: 10.1016/j.phrs.2021.105840 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref011] 11.Hughes R. Intestinal flora and nutrition. Ind Med Gaz. 1944;79(8):396–7. [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref012] 12.Zorkina YA, Syunyakov TS, Abramova OV, Yunes RA, Averina OV, Kovtun AS, et al. Effects of diet on the gut microbiome in patients with depression. Zh Nevrol Psikhiatr Im S S Korsakova. 2022;122(1. Vyp. 2):59–64. doi: 10.17116/jnevro202212201259 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref013] 13.Zhao H, Jin K, Jiang C, Pan F, Wu J, Luan H, et al. A pilot exploration of multi-omics research of gut microbiome in major depressive disorders. Transl Psychiatry. 2022;12(1):8. doi: 10.1038/s41398-021-01769-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref014] 14.Fusar-Poli L, Vozza L, Gabbiadini A, Vanella A, Concas I, Tinacci S, et al. Curcumin for depression: a meta-analysis. Crit Rev Food Sci Nutr. 2020;60(15):2643–53. doi: 10.1080/10408398.2019.1653260 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref015] 15.Han X, Xu T, Fang Q, Zhang H, Yue L, Hu G, et al. Quercetin hinders microglial activation to alleviate neurotoxicity via the interplay between NLRP3 inflammasome and mitophagy. Redox Biol. 2021;44:102010. doi: 10.1016/j.redox.2021.102010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref016] 16.Guo LT, Wang SQ, Su J, Xu LX, Ji ZY, Zhang RY, et al. Baicalin ameliorates neuroinflammation-induced depressive-like behavior through inhibition of toll-like receptor 4 expression via the PI3K/AKT/FoxO1 pathway. J Neuroinflammation. 2019;16(1):95. doi: 10.1186/s12974-019-1474-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref017] 17.Nestler EJ, Hyman SE. Animal models of neuropsychiatric disorders. Nat Neurosci. 2010;13(10):1161–9. doi: 10.1038/nn.2647 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref018] 18.Liu Q, Sun NN, Wu ZZ, Fan DH, Cao MQ. Chaihu-Shugan-San exerts an antidepressive effect by downregulating miR-124 and releasing inhibition of the MAPK14 and Gria3 signaling pathways. Neural Regen Res. 2018;13(5):837–45. doi: 10.4103/1673-5374.232478 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref019] 19.Li W, Zhou R, Zheng J, Sun B, Jin X, Hong M, et al. Chaihu-Shugan-San ameliorates tumor growth in prostate cancer promoted by depression via modulating sphingolipid and glycerinphospholipid metabolism. Front Pharmacol. 2022;13:1011450. doi: 10.3389/fphar.2022.1011450 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref020] 20.Lu CN, Yuan ZG, Zhang XL, Yan R, Zhao YQ, Liao M, et al. Saikosaponin a and its epimer saikosaponin d exhibit anti-inflammatory activity by suppressing activation of NF-κB signaling pathway. Int Immunopharmacol. 2012;14(1):121–6. doi: 10.1016/j.intimp.2012.06.010 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref021] 21.Peng D, Chen Y, Sun Y, Zhang Z, Cui N, Zhang W, et al. Saikosaponin A and its epimers alleviate LPS-induced acute lung injury in mice. Molecules. 2023;28(3):967. doi: 10.3390/molecules28030967 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref022] 22.Wang AR, Mi LF, Zhang ZL, Hu MZ, Zhao ZY, Liu B, et al. Saikosaponin A improved depression-like behavior and inhibited hippocampal neuronal apoptosis after cerebral ischemia through p-CREB/BDNF pathway. Behav Brain Res. 2021;403:113138. doi: 10.1016/j.bbr.2021.113138 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref023] 23.Guo J, Zhang F, Gao J, Guan X, Liu B, Wang X, et al. Proteomics-based screening of the target proteins associated with antidepressant-like effect and mechanism of Saikosaponin A. J Cell Mol Med. 2020;24(1):174–88. doi: 10.1111/jcmm.14695 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref024] 24.Li Y, Yin Q, Li Q, Huo AR, Shen TT, Cao JQ, et al. Botulinum neurotoxin A ameliorates depressive-like behavior in a reserpine-induced Parkinson’s disease mouse model via suppressing hippocampal microglial engulfment and neuroinflammation. Acta Pharmacol Sin. 2023;44(7):1322–36. doi: 10.1038/s41401-023-01058-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref025] 25.Abdel-Rasoul AA, Saleh NA, Hosny EN, El-Gizawy MM, Ibrahim EA. Cardamom oil ameliorates behavioral and neuropathological disorders in a rat model of depression induced by reserpine. J Ethnopharmacol. 2023;308:116254. doi: 10.1016/j.jep.2023.116254 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref026] 26.Porsolt RD, Anton G, Blavet N, Jalfre M. Behavioural despair in rats: a new model sensitive to antidepressant treatments. Eur J Pharmacol. 1978;47(4):379–91. doi: 10.1016/0014-2999(78)90118-8 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref027] 27.Park BK, Kim NS, Kim YR, Yang C, Jung IC, Jang IS, et al. Antidepressant and anti-neuroinflammatory effects of bangpungtongsung-san. Front Pharmacol. 2020;11:958. doi: 10.3389/fphar.2020.00958 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref028] 28.Rehman SU, Ikram M, Ullah N, Alam SI, Park HY, Badshah H, et al. Neurological enhancement effects of melatonin against brain injury-induced oxidative stress, neuroinflammation, and neurodegeneration via AMPK/CREB signaling. Cells. 2019;8(7):760. doi: 10.3390/cells8070760 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref029] 29.Guo Y, Miao Y, Chen H, Wang K, Wang S, Wang R, et al. Revealing the mechanism: the influence of Baicalin on M1/M2 and Th1/Th2 imbalances in mycoplasma gallisepticum infection. Poult Sci. 2024;103(10):104145. doi: 10.1016/j.psj.2024.104145 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref030] 30.Wang S, Guo L, Gu F, Bao J, Guo Y, Zhang Y, et al. Quercetin restores respiratory mucosal barrier dysfunction in mycoplasma gallisepticum-infected chicks by enhancing Th2 immune response. Phytomedicine. 2024;133:155953. doi: 10.1016/j.phymed.2024.155953 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref031] 31.Wang S, Jin X, Chen H, Han M, Bao J, Niu D, et al. Quercetin alleviates mycoplasma gallisepticum-induced inflammatory damage and oxidative stress through inhibition of TLR2/MyD88/NF-κB pathway in vivo and in vitro. Microb Pathog. 2023;176:106006. doi: 10.1016/j.micpath.2023.106006 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref032] 32.Marwaha S, Palmer E, Suppes T, Cons E, Young AH, Upthegrove R. Novel and emerging treatments for major depression. Lancet. 2023;401(10371):141–53. doi: 10.1016/S0140-6736(22)02080-3 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref033] 33.Chen XQ, Chen SJ, Liang WN, Wang M, Li CF, Wang SS, et al. Saikosaponin A attenuates perimenopausal depression-like symptoms by chronic unpredictable mild stress. Neurosci Lett. 2018;662:283–9. doi: 10.1016/j.neulet.2017.09.046 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref034] 34.Li J, Han J, Lv J, Wang S, Qu L, Jiang Y. Saikosaponin A-induced gut microbiota changes attenuate severe acute pancreatitis through the activation of Keap1/Nrf2-ARE antioxidant signaling. Oxid Med Cell Longev. 2020;2020:9217219. doi: 10.1155/2020/9217219 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref035] 35.Antkiewicz-Michaluk L, Wąsik A, Możdżeń E, Romańska I, Michaluk J. Antidepressant-like effect of tetrahydroisoquinoline amines in the animal model of depressive disorder induced by repeated administration of a low dose of reserpine: behavioral and neurochemical studies in the rat. Neurotox Res. 2014;26(1):85–98. doi: 10.1007/s12640-013-9454-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref036] 36.Haahtela T, Holgate S, Pawankar R, Akdis CA, Benjaponpitak S, Caraballo L, et al. The biodiversity hypothesis and allergic disease: world allergy organization position statement. World Allergy Organ J. 2013;6(1):3. doi: 10.1186/1939-4551-6-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref037] 37.Sorboni SG, Moghaddam HS, Jafarzadeh-Esfehani R, Soleimanpour S. A comprehensive review on the role of the gut microbiome in human neurological disorders. Clin Microbiol Rev. 2022;35(1):e0033820. doi: 10.1128/CMR.00338-20 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref038] 38.Kosuge A, Kunisawa K, Arai S, Sugawara Y, Shinohara K, Iida T, et al. Heat-sterilized Bifidobacterium breve prevents depression-like behavior and interleukin-1β expression in mice exposed to chronic social defeat stress. Brain Behav Immun. 2021;96:200–11. doi: 10.1016/j.bbi.2021.05.028 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref039] 39.Bárcena C, Valdés-Mas R, Mayoral P, Garabaya C, Durand S, Rodríguez F, et al. Healthspan and lifespan extension by fecal microbiota transplantation into progeroid mice. Nat Med. 2019;25(8):1234–42. doi: 10.1038/s41591-019-0504-5 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref040] 40.Li J, Zhao F, Wang Y, Chen J, Tao J, Tian G, et al. Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome. 2017;5(1):14. doi: 10.1186/s40168-016-0222-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref041] 41.Wang L, Tang L, Feng Y, Zhao S, Han M, Zhang C, et al. A purified membrane protein from Akkermansia muciniphila or the pasteurised bacterium blunts colitis associated tumourigenesis by modulation of CD8+ T cells in mice. Gut. 2020;69(11):1988–97. doi: 10.1136/gutjnl-2019-320105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref042] 42.Cani PD, Depommier C, Derrien M, Everard A, de Vos WM. Akkermansia muciniphila: paradigm for next-generation beneficial microorganisms. Nat Rev Gastroenterol Hepatol. 2022;19(10):625–37. doi: 10.1038/s41575-022-00631-9 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref043] 43.Ding Y, Bu F, Chen T, Shi G, Yuan X, Feng Z, et al. A next-generation probiotic: Akkermansia muciniphila ameliorates chronic stress-induced depressive-like behavior in mice by regulating gut microbiota and metabolites. Appl Microbiol Biotechnol. 2021;105(21–22):8411–26. doi: 10.1007/s00253-021-11622-2 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref044] 44.Cheng R, Zhu H, Sun Y, Hang T, Zhang M. The modified outer membrane protein Amuc_1100 of Akkermansia muciniphila improves chronic stress-induced anxiety and depression-like behavior in mice. Food Funct. 2022;13(20):10748–58. doi: 10.1039/d2fo01198k [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref045] 45.Chen T, Wang R, Duan Z, Yuan X, Ding Y, Feng Z, et al. Akkermansia muciniphila protects against psychological disorder-induced gut microbiota-mediated colonic mucosal barrier damage and aggravation of colitis. Front Cell Infect Microbiol. 2021;11:723856. doi: 10.3389/fcimb.2021.723856 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref046] 46.Wang J, Ishfaq M, Li J. Baicalin ameliorates mycoplasma gallisepticum-induced inflammatory injury in the chicken lung through regulating the intestinal microbiota and phenylalanine metabolism. Food Funct. 2021;12(9):4092–104. doi: 10.1039/d1fo00055a [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref047] 47.Verdam FJ, Fuentes S, de Jonge C, Zoetendal EG, Erbil R, Greve JW, et al. Human intestinal microbiota composition is associated with local and systemic inflammation in obesity. Obesity (Silver Spring). 2013;21(12):E607–15. doi: 10.1002/oby.20466 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref048] 48.Spellman T, Liston C. Toward circuit mechanisms of pathophysiology in depression. Am J Psychiatry. 2020;177(5):381–90. doi: 10.1176/appi.ajp.2020.20030280 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref049] 49.Südhof TC, Rothman JE. Membrane fusion: grappling with SNARE and SM proteins. Science. 2009;323(5913):474–7. doi: 10.1126/science.1161748 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref050] 50.Suneson K, Lindahl J, Chamli Hårsmar S, Söderberg G, Lindqvist D. Inflammatory depression-mechanisms and non-pharmacological interventions. Int J Mol Sci. 2021;22(4):1640. doi: 10.3390/ijms22041640 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref051] 51.Krishnadas R, Cavanagh J. Depression: an inflammatory illness? J Neurol Neurosurg Psychiatry. 2012;83(5):495–502. doi: 10.1136/jnnp-2011-301779 [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref052] 52.Malynn S, Campos-Torres A, Moynagh P, Haase J. The pro-inflammatory cytokine TNF-α regulates the activity and expression of the serotonin transporter (SERT) in astrocytes. Neurochem Res. 2013;38(4):694–704. doi: 10.1007/s11064-012-0967-y [DOI] [PubMed] [Google Scholar]

[pone.0311207.ref053] 53.Aggarwal BB, Gupta SC, Kim JH. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood. 2012;119(3):651–65. doi: 10.1182/blood-2011-04-325225 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0311207.ref054] 54.Clark IA, Vissel B. Excess cerebral TNF causing glutamate excitotoxicity rationalizes treatment of neurodegenerative diseases and neurogenic pain by anti-TNF agents. J Neuroinflammation. 2016;13(1):236. doi: 10.1186/s12974-016-0708-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Saikosaponin A alleviates depressive-like behavior induced by reserpine in mice by regulating gut microflora and inflammatory responses

Menglin Wang

Haojun Li

Wenjing Zhang

Li Zhang

Shun Wang

Miao Jia

Lu Jia

Yu Zhang

Haifei Gao

Xianwu Zhang

Zhaohui Yin

Roles

Abstract

1. Introduction

2. Materials and methods

2.1. Ethics statement

2.2. Animal experiments

Fig 1. Effects of SSA on the development and depressive-like behavior of RSP-induced depression in mice.

2.3. Body weight changes

2.4. Behavioral tests

2.4.1. The forced swimming test (FST).

2.4.2. The tail suspension test (TST).

2.4.3. The sucrose preference tests (SPT).

2.5. Enzyme-linked immunosorbent assay (ELISA)

2.6. Histopathological examination

2.7. Detection of oxidant status

2.8. Real-time PCR (qPCR)

Table 1. List of primers used in qRT-PCR.

2.9. Western blot analysis (WB)

2.10. 16S rRNA amplicon sequencing, data processing and analysis

2.11. Statistical analysis

3. Results

3.1. Effects of SSA on RSP-induced weight changes and behavioral tests

3.2. Effect of SSA on monoamine neurotransmitters in RSP-induced mice

Fig 2. Effect of SSA on monoamine neurotransmitters in RSP-induced depression in mice.

3.3. Effects of SSA on RSP-induced damage to the hippocampus

Fig 3. Effects of SSA on RSP-induced damage to the hippocampus.

3.4. Effect of SSA on RSP-induced oxidative stress in the hippocampus

Fig 4. Effect of SSA on RSP-induced oxidative stress in mouse hippocampus.

3.5. Effect of SSA on RSP-induced pro-inflammatory factors in the hippocampus of mice

Fig 5. Effect of SSA on mRNA expression of TNFR1/NF-κB signaling pathway-related indicators in the hippocampus of RSP-induced depressed mice.

3.6. Effect of SSA on RSP-induced activation of TNFR1/NF-κB signaling pathway in mouse hippocampus

Fig 6. Effects of SSA on TNFR1/NF-κB protein expression and TNF-α and IL-1β concentrations in the hippocampus of RSP-induced depressed mice.

3.7. Effect of SSA on the RSP-induced intestinal flora of mice

Fig 7. Effect of SSA on the gut flora of RSP-induced depressed mice.

4. Discussion

Supporting information

Acknowledgments

Abbreviations

Data Availability

Funding Statement

References

Author response to Decision Letter 0

Decision Letter 0

Peng Zhong

Roles

Author response to Decision Letter 0

Decision Letter 1

Peng Zhong

Roles

Acceptance letter

Peng Zhong

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases