Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2024 Dec 17;49(3):288–302. doi: 10.1002/cbin.12266

Wilms' tumor 1‐associated protein aggravates ischemic stroke by promoting M1 polarization of microglia by enhancing PTGS2 mRNA stability in an m6A‐dependent manner

Haijing Sui 1,2, Chang Liu 3, Zhenyu Sun 1,2, Hongjie Xi 1,2,✉
PMCID: PMC11811743  PMID: 39687949

Abstract

Mounting evidence indicates the involvement of N6‐methyladenosine (m6A) alterations in diverse neurological disorders and the activation of microglia. However, the role of m6A methyltransferase Wilms' tumor 1‐associated protein (WTAP) in regulating microglial polarization during ischemic stroke (IS) remains unknown. We performed bioinformatics analysis to identify m6A‐related differentially expressed genes in IS and validated these genes in a mouse middle cerebral artery occlusion model and a BV2 cell oxygen‐glucose deprivation/reperfusion model. We found that microglial m6A modification was increased, and that WTAP was the most significantly differentially expressed m6A regulator during IS. High expression of WTAP is closely correlated with microglia‐mediated neuroinflammation in IS. Mechanistically, WTAP promoted m6A modification, which promoted prostaglandin endoperoxide synthase‐2 (PTGS2) by enhancing its mRNA stability. WTAP promoted M1 microglial polarization by elevating PTGS2 expression via m6A modification of PTGS2 mRNA in the oxygen‐glucose deprivation/reperfusion model. In conclusion, WTAP is a crucial posttranscriptional regulator that contributes to post‐IS neuroinflammation. WTAP knockdown confers cerebral protection by shifting the microglial phenotype from M1 to M2, primarily by reducing PTGS2 mRNA stability in an m6A‐dependent manner.

Keywords: ischemic stroke, microglial polarization, N6‐methyladenosine, neuroinflammation, PTGS2, WTAP

1. INTRODUCTION

Stroke is the primary cause of mortality and morbidity among neurological disorders worldwide, with 87% of stroke cases linked to ischemic stroke (IS) (Virani et al., 2020). Although endovascular reperfusion therapy is the most efficacious treatment approach (Fisher & Savitz, 2022), it can exacerbate tissue damage, leading to conditions such as edema or hemorrhage, collectively referred to as cerebral ischemia and reperfusion injury (CIRI). Consequently, the prognosis of IS patients remains unoptimistic.

Neuroinflammation is a predominant contributor to the cerebral damage observed in IS (Jurcau & Simion, 2021). Microglia, which serve as resident immune cells, initiate inflammatory and immune responses. Activated microglia promptly mobilize to the injury site, playing a pivotal role in neuroinflammatory cascades following IS (Calis et al., 2020). Microglia act as double‐edged swords, exhibiting two polarizations in IS: pro‐inflammatory M1‐like phenotypes and anti‐inflammatory M2‐like phenotypes (Hu et al., 2015). Consequently, the regulation of microglial polarization, particularly the promotion of M2‐like phenotype transformation, has emerged as a potentially effective strategy against IS.

N6‐methyladenosine (m6A), which is recognized as the predominant mRNA modification in eukaryotic organisms (Dominissini et al., 2012), plays a pivotal role in governing mRNA metabolism, including splicing, export, translation, and stability (Lan et al., 2022). The dynamic and reversible process of m6A modification occurs internally in RNA and is facilitated by a “writer” system comprising methyltransferase‐like 3 (METTL3), METTL14, and Wilms' tumor 1‐associated protein (WTAP). This process is counteracted by “erasers,” such as fat‐mass and obesity‐associated protein (FTO) and α‐ketoglutarate‐dependent dioxygenase alkB homolog 5 (ALKBH5). The functional execution is carried out by “readers,” including the HNRNP family proteins and YTH domain‐containing family (YTHDF1‐3 and YTHDC1‐2) (Liu et al., 2024; Liu et al., 2019). Research indicates a close association between m6A RNA modifications and the onset and advancement of neurological conditions, such as depressive disorders, epilepsy, multiple sclerosis, Parkinson's disease, and Alzheimer's disease (You et al., 2022; Zhang, Ding, et al., 2023). A recent study highlighted that stroke induces alterations in the cerebral m6A epitranscriptome, potentially resulting in functional consequences in post‐stroke pathophysiology (Chokkalla et al., 2019). An examination of rats experiencing CIRI revealed that genes exhibiting differential expression, coupled with hypermethylated m6A modifications, play a role in inflammation‐related pathways (Yi et al., 2021). Furthermore, another study reported that depleting METTL14 mitigates brain injury induced by middle cerebral artery occlusion (MCAO) by shifting microglia/macrophage polarization from M1 to M2 in microglia (Li, Su, et al., 2023). Nevertheless, the exact mechanism underlying the effects of m6A modification on microglia‐mediated neuroinflammation remains unclear.

WTAP is a pivotal component of the classical m6A methyltransferase complex that is responsible for stabilizing METTL3 and METTL14 (Chen et al., 2019). It plays a vital role in initiating and guiding the localization of nuclear speckles to activate m6A methylation. Notably, the reduction in WTAP expression resulted in a more pronounced decrease in m6A peaks than the knockdown of either METTL3 or METTL14 (Chang et al., 2022). Previous studies have confirmed the role of WTAP in cerebrovascular diseases and its concentration is diminished in lesions related to brain arteriovenous malformations. This reduction in WTAP expression inhibits the formation of new blood vessels by endothelial cells by modulating desmoplakin expression via m6A modifications (Wang et al., 2020). However, the role of WTAP in IS remains unclear.

This study investigated the potential association between m6A modifications and microglia‐mediated neuroinflammation in IS. Our study highlighted the upregulation of WTAP in IS, explored the role of WTAP in regulating microglia‐mediated inflammation in an m6A‐dependent manner, and elucidated the underlying molecular mechanisms using both in vitro and in vivo models. The results not only confirm the crucial function of WTAP in neuroinflammation induced by IS but also provide insight into a novel therapeutic target based on m6A modification to inhibit the inflammatory response against IS.

2. MATERIALS AND METHODS

2.1. Animals and MCAO model

Male C57BL/6 mice (22–25 g; 8–10 weeks old) were obtained from the Animal Experimental Center of the Second Affiliated Hospital of Harbin Medical University (Harbin, China). The mice were housed in a facility free from pathogens and under controlled environmental conditions, following a 12‐h light‐dark cycle, with unrestricted access to water and food. All animal experiments adhered to the directives of the National Institutes of Health and were approved by the Institutional Animal Care and Use Committee of Harbin Medical University (approval number: YTJSDW2023‐133). The murine MCAO model was established as described previously (Longa et al., 1989). The mice underwent sevoflurane inhalation anesthesia (5% induction and 2% maintenance with spontaneous respiration in 50% O2; Baxter), and a neck incision was made to expose the left common carotid artery along with the internal and external carotid arteries through surgical means. A nylon monofilament coated with silicone rubber (602256PK10, Doccol Corporation) was introduced through an incision in the left external carotid artery. Subsequently, guided through the bifurcation into the internal carotid artery, the monofilament was advanced by approximately 11 mm to induce 90‐min occlusion of the middle cerebral artery, followed by a 24‐h reperfusion period. Mice in the sham‐operated group underwent a matching surgical process, excluding the embolization stage.

2.2. Staining with 2,3,5‐triphenyltetrazolium chloride (TTC) and measurement of infarct volume

The brain was harvested 24 h after MCAO. Subsequently, the brain was quickly excised, snap‐frozen for 10 min, and cut into 1 mm coronal slices. The sections were placed in a petri dish and incubated for 20 min at 37°C with a 2% TTC (T8170, Solarbio, China) solution in phosphate buffered saline. Subsequently, the coronal slices were left in 4% paraformaldehyde (PFA) at 4°C overnight (ON) and photographed. The healthy brain tissue exhibited a red stain, whereas the infarcted area was identified by a pale gray color. Every phase of capturing, processing, and evaluating images was conducted in a blinded manner. ImageJ software was used to analyze the scanned images. The infarct volume was calculated as a percentage of the cerebral infarction volume relative to the prosencephalon volume.

2.3. Neurobehavior analysis

After MCAO induction, neurobehavioral assessments were conducted using a double‐blind approach. Neurological deficits were evaluated using the modified neurological severity score (mNSS). The mNSS assesses motor function, sensory perception, reflexes, and balance. The mNSS ranges from 0 to 18, where 0 signifies a normal score and 18 denotes maximum deficit. When evaluating the extent of injury, one point is allocated for the inability to execute a test or the absence of a tested reflex. These scores classify neurological impairment into three levels of damage: mild (scores 1–6), moderate (scores 7–12), and severe (scores 13–18).

2.4. Tissue collection, hematoxylin and eosin (H&E) staining, and immunohistochemistry

After intraperitoneal administration of 400 mg/kg chloral hydrate, the mice were euthanized. Brain tissue specimens were stabilized with 4% PFA. After 2 days' fixing, the brain tissue was embedded in paraffin, sectioned into 4 μm thick slices, and then dewaxed routinely. The slices were stained with H&E (G1120, Solarbio, China) for 5 min and sealed with a cover glass. The sections were analyzed under a light microscope to examine pathological features (morphology, infiltration of inflammatory cells, cell edema, and necrosis) of the cerebral cortex. Immunohistochemistry was conducted after dewaxing, endogenous peroxidase inactivation, antigen retrieval, and blocking the sections with 5% BSA at 37°C for 30 min. Subsequently, the sections were left to incubate ON at 4°C with the WTAP antibody (DF3282, Affinity, China), followed by exposure to an anti‐rabbit secondary antibody (ab6721, Abcam, UK) at 37°C for 30 min. Samples were developed using diaminobenzidine for 15 min at 37°C, and the sections were examined under a light microscope. Finally, the specimens were analyzed using ImageJ software and histochemistry scores were obtained.

2.5. Cell culture and establishment of the oxygen‐glucose deprivation/reperfusion (OGD/R) model

The BV2 microglial cell line was obtained from Procell Life Science & Technology Co., Ltd. (CL‐0493, Procell, China) and cultured in DMEM supplemented with 10% FBS. To establish the OGD/R model, BV2 cells were deprived of glucose by incubation in a medium lacking glucose at 37°C. This process was performed in a humidified incubator containing 5% CO2 and 95% N2 for a duration of 2 h. Subsequently, the glucose‐deprived medium was replaced with the regular culture medium. The cells were then reintroduced into a standard incubator for reoxygenation over a 24‐h period. For investigating the effect of m6A modification on OGD/R injury in vitro, BV2 cells were treated with cycloleucine (Cyc), a specific inhibitor of S‐adenosylmethionine mediated methylation (40 μM, HY‐30008, MCE, Princeton, NJ), or DMSO (as control) for 24 h. Subsequently, the cells were subjected to OGD/R treatment as described above.

2.6. Plasmids and small interfering RNAs (siRNAs)

To achieve overexpression of WTAP in BV2 cells, the entire WTAP cDNA was subcloned into pcDNA3.1 vectors, along with control vectors, resulting in the generation of WTAP overexpression (oe‐WTAP) plasmids and a control (Vector). To induce WTAP knockdown, BV2 cells were transfected with a negative control (si‐NC) or siRNA (si‐WTAP) supplied by General Biology. Cell transfection was performed using Lipofectamine™ 3000 (Invitrogen Life Technologies) transfection reagent according to the the manufacturer's guidelines. The sequences of si‐NC and si‐WTAP are listed in Table S1. Transfection efficiency was assessed using quantitative reverse transcription polymerase chain reaction (qRT‐PCR).

2.7. Adeno‐associated virus (AAV) administration in murine brains

The mice were anesthetized with 5% sevoflurane and subsequently immobilized on a stereotactic apparatus. Following this, 3 µL solution of an AAV vector carrying shRNA (sh‐WTAP or sh‐NC, serotype of AAV9, with a titer of 4.0 × 10¹² IU, packaged and titrated at GenePharma, China) was directly injected at a rate of 0.2 µL per minute into the left striatum. Utilizing a Stoelting injection system, the injection was performed at coordinates 0.8 mm anterior and 2 mm lateral to the bregma, reaching a depth of 3.0 mm. The needle remained in position for 10 min. The MCAO model was established in these mice after a 4‐week period following viral vector injection.

The shRNA sequences were:

  • sh‐NC: 5ʹ‐TTCTCCGAACGTGTCACGT‐3ʹ

  • sh‐WTAP: 5ʹ‐GGAGGGAAAGTACACAGATCT‐3ʹ

2.8. Immunofluorescence

Immunofluorescence staining was performed according to established protocols. Brain sections (20 μm) were fixed with 4% PFA, permeabilized for 15 min using 0.3% Triton X‐100, and blocked with 10% serum for 1 h at room temperature (RT). Afterward, sections of brain tissue were subjected to ON incubation at 4°C with anti‐Iba‐1 (ab283319, Abcam, UK), anti‐CD86 (DF6332, Affinity, China), or anti‐CD206 (DF6332, Affinity, China) antibodies. Following the primary antibody incubation, the brain/cell sections underwent a secondary incubation with goat anti‐rabbit antibodies (ab150077, Abcam, UK) at 37°C for 1 h. Subsequently, the sections were stained with DAPI (ab104139, Abcam, UK) for 15 min. Samples were observed and imaged using a fluorescence microscope (Olympus, Tokyo, Japan). Quantification of co‐positive Iba‐1 and CD86 (or CD206) cells in the penumbra region of the slices was performed using ImageJ software. Three randomly selected microscopic fields were analyzed.

BV2 cells were fixed and blocked in the same way as described above. Cells were incubated with anti‐WTAP (DF3282, Affinity, China) primary antibody ON at 4°C. The cells were processed using the secondary antibody and DAPI reagent the following day, and immunoreactivity was observed under a fluorescence microscope.

2.9. Flow cytometry

BV2 cells were harvested and rinsed with phosphate buffered saline. Subsequently, the cells were treated with FACS buffer (BD Biosciences) and incubated for 15 min. The cells were then centrifuged for 3 min at 250 × g, and the resulting cell pellet was reconstituted in 500 mL of FACS buffer. On ice, the cells underwent a 10‐min treatment with mouse Fc blocking solution (abs9477, absin, China) and were then centrifugated at 250 × g at 4°C for 3 min. Next, the cells were stained with either mouse anti‐CD86‐APC or mouse anti‐CD206‐FITC (105011/141703; BioLegend) on ice for 30 min. FACS was used to quantify cell fluorescence. The collected data were analyzed using FlowJo software (BD Calibur).

2.10. Enzyme‐linked immunosorbent assay (ELISA)

Following a 24‐h reperfusion period, the mice were euthanized and blood samples were acquired through cardiac puncture. The collected samples were then preserved at −80°C for subsequent examination. Following the manufacturer's guidelines, we evaluated the serum concentrations of IL‐1β, IL‐6, TNF‐α, and TGF‐β using an ELISA kit (mouse IL‐1β, TNF‐α, IL‐6, and TGF‐β ELISA kits, all obtained from Jingkang, China). A microplate reader was used to measure the optical density of each sample at 450 nm.

2.11. Western blot analysis

Mouse brain tissue or cultured BV2 cells were lysed with RIPA buffer to extract total protein. The BCA Protein Assay Kit (P0010, Beyotime, China) was used for the quantitative assessment of all proteins. Following separation by SDS‐PAGE, the protein samples were transferred onto a PVDF membrane. After blocking, specific antibodies against WTAP (DF3282, Affinity, China), inducible nitric oxide synthase (iNOS, ab178945, Abcam, UK), arginase‐1 (Arg‐1, ab133543, Abcam, England), prostaglandin endoperoxide synthase‐2 (PTGS2) (AF7003, Affinity, China), and β‐actin (AC026, ABclonal, China) were applied to the membranes ON at 4°C. The membranes were then incubated with secondary antibodies for 2 h at RT. The membranes were visualized using an enhanced chemiluminescence solution (P0018AS; Beyotime, China). The experimental results were analyzed using ImageJ analysis software.

2.12. qRT‐PCR and mRNA stability assay

Ischemic penumbra brain tissue or cultured cells were subjected to total RNA extraction using the TRIzol reagent. cDNA was synthesized using the First Strand cDNA Synthesis Kit (D7168L; Beyotime). qRT‐PCR was performed using the AceQ Universal SYBR qPCR Master Mix (Vazyme, China). Normalized to the endogenous β‐actin expression, the mRNA gene target levels were quantified utilizing the 2‐△△Ct method. The primer sequences are outlined in Table S2. To assess RNA stability, BV2 cells were treated with 5 μg/ml of actinomycin D (HY‐17559, MCE, Princeton, NJ). Next, the cells were collected at 0, 4, and 8 h after treatment to isolate total RNA. qRT‐PCR was used for RNA quantification.

2.13. Quantification of m6A levels in total RNA

The evaluation of m6A expression levels in the total RNA extracted from cultured BV2 cells after OGD/R was performed using the EpiQuik™ m6A RNA Methylation Quantitative Detection Kit (Colorimetric, ab185912, Abcam, UK). All experimental procedures were performed according to the manufacturer's instructions.

2.14. RNA immunoprecipitation (RIP) and methylated RIP (MeRIP)

RIP was performed using an RIP kit (Bes5101, BersinBio, China) according to the manufacturer's instructions. Briefly, BV2 cells were harvested and lysed in polysome lysis buffer. The RNA–protein complexes were then left ON at 4°C with either anti‐WTAP antibody (ab195308, Abcam, UK) or anti‐IgG antibody (ab172730, Abcam, UK). Subsequently, magnetic beads and 40 µL of protein A/G were added, and the cells were incubated at 4°C for 1 h. The RNA of interest was immunoprecipitated using the beads. Immunoprecipitated RNAs were extracted using TRIzol reagent, and RNA enrichment was evaluated using qRT‐PCR.

For m6A RNA‐binding assays, a MeRIP kit (Bes52203‐1, BersinBio, China) was used. Briefly, total RNA was isolated from BV2 cells and fragmented using fragmentation buffer. The fragmented RNA was incubated with an anti‐m6A antibody (ab284130, Abcam, UK), followed by magnetic beads. The enrichment of m6A‐containing mRNA was analyzed using qRT‐PCR and normalized to the input.

2.15. Bioinformatics analysis

We accessed GEO (https://www.ncbi.nlm.nih.gov/geo/) to obtain IS‐related microarray data from peripheral blood mononuclear cells of IS patients and sex‐ and age‐matched control patients in the GSE22255 data set. Differentially expressed genes (DEGs) between the normal and IS samples were identified using the “limma” R package. Genes were considered DEGs with an adjusted p‐value < .05. A t‐test was used to evaluate the differences in gene expression between samples from IS and those from normal conditions. Pearson's correlation coefficient was computed to examine the association between the expression of m6A regulators and inflammation‐related genes. Subsequently, Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment and Gene Ontology (GO) analyses were conducted using the “clusterProfiler” R package, focusing on the co‐expressed m6A regulators and inflammation‐related genes. The potential m6A modification site on PTGS2 mRNA was analyzed using m6AVar (http://m6avar.renlab.org/).

2.16. Statistical analysis

All data are presented as mean ± standard deviation. Statistical analyses were performed using SPSS 27.0 (IBM Corp., Armonk, NY). The Shapiro–Wilk normality test was used to assess the normality of continuous data. When the data met the criteria for normal distribution and homogeneity of variance, a two‐tailed unpaired t‐test was used for comparisons between two groups, whereas one‐way analysis of variance (ANOVA) was used for comparisons involving multiple groups. For data exhibiting a non‐normal distribution, analyses were performed using the Kruskal–Wallis and Mann–Whitney U tests. A significance level of p < .05 was considered statistically significant.

3. RESULTS

3.1. WTAP expression increased after IS

We identified 22,882 DEGs between the normal and IS samples, and 2 m6A regulators and 58 inflammation‐related genes exhibited differential expression (Figure 1a). The volcano plot illustrated the differential expression patterns of m6A regulators and inflammation‐related genes between the normal and IS samples. Specifically, one upregulated (WTAP) and one downregulated (METTL14) m6A regulator, along with 38 upregulated and 18 downregulated inflammatory gene, are shown in Figure 1b and 1cc, respectively. To assess the associations between these inflammation‐related genes and m6A regulators, a protein‐protein interaction network was constructed, which showed that the two differentially expressed m6A regulators were strongly correlated with most of the differentially expressed inflammatory genes (Figure 1d).

Figure 1.

Figure 1

Open in a new tab

IS induces WTAP activation and concurrent microglial polarization toward M1 and M2 phenotypes. (a) Heatmap illustrating the differential expression of inflammation‐related genes and m6A regulators between the normal and IS samples. (b) Volcano plot illustrating the differentially expressed m6A regulators between the normal and IS samples. (c) Volcano plot illustrating the differential expression of genes related to inflammation between the normal and IS samples. (d) Interaction network depicting connections between m6A regulators and inflammation‐related genes. The red and blue lines represent positive and negative correlations, respectively, and the thickness of the line represents the strength of the correlation. (e‐i) Western blot analysis of the differentially expressed m6A regulators WTAP and METTL14, along with the M1 phenotype microglial indicator, iNOS, and the M2 phenotype microglial indicator, Arg‐1, in the ischemic penumbra of the mouse brain post‐MCAO (n = 3). (j‐n) Western blot analysis of WTAP, METTL14, iNOS, and Arg‐1 in BV2 cells after OGD/R treatment (n = 3). (o) H&E staining was used to evaluate pathological features of the ischemic penumbra of the mouse brain after Sham or MCAO treatment. Scale bar, 50 µm. (p‐q) Illustrative immunohistochemical images and statistical analysis of WTAP concentration in the ischemic penumbra of mouse brain tissues after Sham or MCAO treatment. Scale bar, 50 µm. (r‐s) Illustrative immunofluorescence images and statistical assessment of WTAP in BV2 cells after Ctrl or OGD/R treatment. Scale bar, 50 µm. Quantitative data are shown as mean ± SD. Significant difference: **p < .01, ***p < .001 compared with the Sham or Ctrl group.

First, we assessed the expression of the two m6A regulators identified by bioinformatics analysis in the ischemic penumbra of brain tissue after MCAO in vivo. Protein expression analysis revealed a notable increase in WTAP levels and a slight reduction in METTL14 levels in the model group. Furthermore, the expression of microglial markers showed increased expression of both the M1‐type microglial indicator, iNOS, and the M2‐type microglial indicator, Arg‐1, compared with the sham group (Figure 1e‐i). We analyzed the expression of WTAP, METTL14, iNOS, and Arg‐1 in BV2 cells exposed to OGD/R in vitro. Consistent with the results shown in Figure 1e, OGD/R injury significantly upregulated WTAP, iNOS, and Arg‐1 levels in BV2 cells and slightly downregulated the expression of METTL14 (Figure 1j‐n). These data suggested that WTAP expression was elevated after IS and was accompanied by microglial activation. Additionally, H&E staining of the cerebral cortex revealed increased infiltration of inflammatory cells, neuronal edema, and death in the MCAO group compared with the sham group (Figure 1o). Immunohistochemical analysis of the ischemic penumbra further corroborated the significant increase in IS‐induced WTAP expression (Figure 1p, q). Furthermore, immunofluorescence staining analysis revealed a significantly higher fluorescence intensity of WTAP in BV2 cells subjected to OGD/R intervention than that in the control group (Figure 1r, s), consistent with the in vivo experimental results. Overall, these data suggest that IS leads to the activation of WTAP, concomitant with the polarization of microglia into M1 and M2 phenotypes.

3.2. WTAP knockdown protects against OGD/R‐induced M1 polarization in BV2 cells

Microglial polarization is a critical pathological process in IS. To explore the potential association between microglial polarization and m6A modification, BV2 cells were transfected with si‐WTAP (1, 2, and 3) and a negative control (si‐NC) to knockdown WTAP. WTAP mRNA levels were significantly decreased after gene knockdown, and si‐WTAP‐2, which exhibited the highest knockdown efficiency, was used in further experiments (Figure 2a). Initially, under both OGD/R and normal conditions, si‐WTAP effectively reduced WTAP concentration in BV2 cells (Figure 2b, c). Subsequently, we assessed the levels of the microglial indicators iNOS for the M1 phenotype and Arg‐1 for the M2 phenotype in BV2 cells. Western blot analysis revealed that WTAP knockdown decreased iNOS concentration and increased Arg‐1 concentration in the presence or absence of OGD/R (Figure 2b, d, e). These results suggested that WTAP knockdown inhibited M1 polarization and promoted M2 polarization in BV2 cells after OGD/R treatment. Flow cytometry was used to evaluate the proportion of M1 microglia labeled with CD86 and M2 microglia labeled with CD206 in the entire BV2 cell population after OGD/R treatment. These findings revealed an increase in the ratio of both M1 and M2 microglia after OGD/R. However, WTAP knockdown led to a reduction in the M1 microglia ratio and an increase in the M2 microglia ratio, irrespective of whether OGD/R was performed(Figure 2f‐g), which was consistent with the western blot analysis results. In summary, these results suggest that the absence of WTAP hindered M1 polarization and promoted M2 polarization in BV2 cells following OGD/R.

Figure 2.

Figure 2

Open in a new tab

WTAP knockdown mitigates OGD/R‐ induced M1 phenotype polarization in BV2 cells. (a) qRT‐PCR assessment of the transfection efficiency of WTAP knockdown in BV2 cells. Mock refers to treating cells with transfection reagents only; negative control (si‐NC) denotes cells transfected with siRNA of the negative control; si‐WTAP‐1, 2, and 3 represent cells transfected with WTAP siRNA‐1, 2, and 3 (n = 3). (b‐e) Protein expression was assessed by western blot analysis of WTAP, iNOS, and Arg‐1 in BV2 cells after exposure to specific siRNAs (n = 3). (f‐g) Flow cytometry was conducted to differentiate positive cell populations for M1 (CD86) and M2 (CD206) in BV2 microglial cells under OGD/R conditions. Quantitative data are shown as the mean ± SD. Significant difference: &&& p < .001 compared with the si‐NC group. **p < .01, ***p < .001 compared with the Ctrl + si‐NC group and ### p < .001 compared with the OGD/R + si‐NC group.

3.3. WTAP knockdown protects against MCAO‐induced M1 polarization of microglia and mitigates brain injury

We investigated the effect of WTAP knockdown on ischemic brain injury in vivo, considering that IS induces high WTAP expression. Four weeks after stereotactic injection of sh‐WTAP and sh‐NC into the left lateral ventricle of mice, MCAO was performed. qRT‐PCR and western blot analyses demonstrated a notable decrease in WTAP expression in brains injected with sh‐WTAP as opposed to those injected with sh‐NC (Figure 3a‐c). To further evaluate the effect of WTAP knockdown on IS‐induced cerebral injury, we assessed the protein concentrations of iNOS and Arg‐1 in the ischemic penumbra following MCAO. These findings indicated that WTAP knockdown led to a substantial reduction in both WTAP and iNOS expression after MCAO treatment, accompanied by an elevation in Arg‐1 expression (Figure 3b‐e). Similarly, immunofluorescence staining revealed that reduction in WTAP levels reduced the ratio of CD86/Iba‐1‐positive microglia and increased the proportion of CD206/Iba‐1‐positive microglia in the ischemic penumbra of mouse brains subjected to MCAO (Figure 3f‐h). These findings suggest that the suppression of WTAP expression effectively hinders M1‐type polarization of microglia and facilitates their shift toward M2‐type polarization in the ischemic penumbra area of the mouse brain experiencing CIRI.

Figure 3.

Figure 3

Open in a new tab

WTAP knockdown attenuates MCAO‐induced M1 polarization of microglia and mitigates brain injury. (a) qRT‐PCR analysis was conducted to assess the effectiveness of silencing WTAP in the respective mouse brain tissues following a 4‐week sh‐WTAP injection (n = 3). (b‐e) Protein expression was assessed by western blot analysis of WTAP, iNOS, and Arg‐1 in the ischemic penumbra of the mouse brain post‐MCAO after treatment with the specific AAVs (n = 3). (f‐g) Immunofluorescence staining analysis of M1 phenotype microglial indicator (CD86), M2 phenotype microglial indicator (CD206), and microglial indicator (Iba‐1) in the ischemic penumbra of the mouse brain post‐MCAO. Scale bar, 20 µm. (h) Statistical analysis of CD86+, CD206+ microglial percent. CD86+ (CD206+) microglia refers to cells that are co‐positive for CD86+ (CD206+) and Iba‐1 (n = 3). (i‐l) Assessment of M1 (IL‐1β and TNF‐α) and M2 (TGF‐β and IL‐10) phenotype cytokines in mouse serum by ELISA post‐MCAO (n = 7). (m) Representative TTC staining images, where pale regions denote ischemic tissues and red regions represent unaffected tissues. (n) Measurement of infarction area proportion stained with TTC (n = 3). (o) Neurological scores were determined using the mNSS in mice subjected to MCAO (n = 7). Quantitative data are shown as mean ± SD. Significant difference: &&& p < .001 compared to the sh‐NC group. ***p < .001 compared with the Sham + sh‐NC group and ### p < .001 compared with the MCAO + sh‐NC group.

We assessed the release of inflammatory cytokines into the serum of mice subjected to MCAO in the presence of sh‐WTAP. WTAP knockdown led to a decrease concentrations of MCAO‐induced serum pro‐inflammatory factors IL‐1β and TNF‐α, while increased concentrations of anti‐inflammatory factors IL‐10 and TGF‐β (Figure 3i‐l). As anticipated, WTAP knockdown substantially decreased infarct volume in brain tissue and neurological deficits following I/R injury. (Figure 3m‐o). Hence, our findings suggest that WTAP knockdown impedes the M1 polarization of microglia, thereby mitigating brain injury following IS.

3.4. WTAP knockdown can reverse IS‐ induced upregulation of PTGS2 expression both in vivo and in vitro

We have established that the m6A regulator WTAP can influence microglial polarization, leading us to hypothesize that WTAP may exert this effect by modulating key inflammatory molecules. As shown in Figure 1d, several inflammation‐related genes were co‐expressed with WTAP. We identified three prominent differentially expressed inflammatory molecules by bioinformatics analysis: PTGS2, CCL3, and CX3CR1 (Figure 4a). Correlation analysis revealed unveiled a robust association between WTAP and the three inflammatory molecules in IS, based on expression profiles from GEO. Notably, the Pearson's correlation coefficient was as high as 0.91 between PTGS2 and WTAP, 0.91 for CCL3, and −0.81 for CX3CR1 (Figure 4b). Therefore, it is reasonable to speculate that these highly correlated inflammatory genes are potential targets of WTAP in regulating microglial polarization in IS. Subsequently, we conducted KEGG pathway annotation and GO analyses to investigate the physiological roles of the co‐expressed m6A regulators and inflammation‐related genes in IS. GO results showed that the genes highly correlated with these mRNA m6A regulators were mainly involved in metabolic and cellular physiological processes and were enriched in the modulation of the inflammatory response (Figure 4c). Furthermore, KEGG analysis indicated their main association with cytokine‐cytokine receptor interactions (Figure 4d). These findings support the hypothesis that WTAP regulates microglial polarization by targeting inflammatory molecules in IS.

Figure 4.

Figure 4

Open in a new tab

Knockdown of WTAP reverses the upregulation of PTGS2 expression induced by IS. (a) Violin plots illustrating the expression differences of PTGS2, CCL3, and CX3CR1 between the IS and normal samples. (b) Fitting curve generated by the lm function was used to assess the association of WTAP with the three differentially inflammation‐related genes; absolute value of R > 0.25 was considered a significant correlation. (c‐d) GO and KEGG enrichment analysis of co‐expressed m6A regulators and inflammation‐related genes. The color denotes the statistical significance of the term, while the magnitude reflects the number of enriched genes. (e) qRT‐PCR was performed to analyze the mRNA expression of PTGS2, CCL3, and CX3CR1 in BV2 cells under OGD/R or Ctrl condition (n = 3). (f‐g) Western blot analysis was conducted to assess the protein expression of PTGS2 in BV2 cells following transfection with si‐WTAP under OGD/R or Ctrl conditions (n = 3). (h) qRT‐PCR was performed to measure the mRNA expression of PTGS2 in BV2 cells following transfection with si‐WTAP under OGD/R or Ctrl conditions (n = 3). (i‐j) Western blot analysis was conducted to assess the protein expression of PTGS2 in the ischemic penumbra of the mouse brain following transfection with sh‐WTAP under MCAO or Sham conditions (n = 3). (k) qRT‐PCR was performed to measure the mRNA expression of PTGS2 in the ischemic penumbra of the mouse brain following sh‐WTAP transfection under MCAO or Sham conditions (n = 3). Quantitative data are shown as mean ± SD. Significant difference: *p < .05, **p < .01 compared with the normal or Ctrl group, & & & p < .001 compared with the Ctrl + si‐NC group, and ### p < .001 compared with the OGD/R + si‐NC group.

Based on the above results, we determined the mRNA expression of three genes (PTGS2, CCL3, and CX3CR1) in BV2 cells after OGD/R using qRT‐PCR. During OGD/R, we observed a notable increase in the mRNA levels of PTGS2, a slight decrease in CX3CR1 expression, and no change in CCL3 expression (Figure 4e). Given that PTGS2 is an essential component of the cytokine‐cytokine receptor interaction pathway, these lines of evidence strongly suggest that PTGS2 mediates the effects of WTAP on microglial polarization in IS. Therefore, we assessed PTGS2 protein and mRNA expression in WTAP‐depleted BV2 cells undergoing OGD/R treatment. The findings demonstrated a notable increase in PTGS2 protein and mRNA levels in BV2 cells after OGD/R, and WTAP knockdown effectively mitigated this increase (Figure 4f‐h). We also assessed the protein and mRNA expression of PTGS2 in vivo and demonstrated that WTAP knockdown significantly reduced PTGS2 protein and mRNA concentrations in the ischemic penumbra of the mouse brain following transfection with sh‐WTAP under MCAO conditions (Figure 4i‐k), which was in agreement with the in vitro results. In summary, WTAP knockdown reversed the upregulation of PTGS2 expression induced by IS, both in vivo and in vitro. This provides compelling grounds for speculating that PTGS2 may be a target of microglial polarization regulated by WTAP during IS.

3.5. WTAP increases PTGS2 stability by facilitating its m6A modification in BV2 cells after OGD/R

The ability of WTAP to recognize m6A‐modified mRNA enhances RNA stability and facilitates translation. We first measured the overall m6A concentration of total RNA in BV2 cells after WTAP knockdown and OGD/R treatment using an RNA m6A quantification kit to explore the relationship between WTAP and m6A modifications in IS. The results indicated a significant increase in total m6A levels after OGD/R treatment, which was reversed by WTAP knockdown (Figure 5a). As expected, WTAP upregulated m6A modification during OGD/R. To further explore whether m6A modification affects PTGS2 expression in IS, we first predicted the potential m6A modification site at 6015 base of PTGS2 mRNA using m6Avar (http://m6avar.renlab.org/) (Figure 5b, c), and then we treated BV2 cells with Cyc 24 h before OGD/R treatment, and found that the inhibition of m6A modification significantly decreased both PTGS2 mRNA expression level and its stability in BV2 cells after OGD/R treatment (Figure 5d, e), indicating that m6A methylation modification promotes PTGS2 expression during OGD/R. These results suggest that si‐WTAP may reduce the mRNA expression of PTGS2 by reducing mRNA stability in an m6A‐dependent manner. The MeRIP assay confirmed that OGD/R upregulated m6A modification of PTGS2 mRNA (Figure 5f). We further explored the interaction between PTGS2 mRNA and WTAP using the RIP assay, which revealed a significant interaction between WTAP and PTGS2 mRNA, indicating that OGD/R treatment significantly strengthened the interaction between WTAP and PTGS2 mRNA (Figure 5g). WTAP knockdown reduced the level of m6A‐modified PTGS2 mRNA in BV2 cells after OGD/R (Figure 5h). Additionally, mRNA stability assays indicated that WTAP knockdown substantially decreased PTGS2 mRNA stability (Figure 5i), implying that WTAP was involved in enhancing PTGS2 mRNA stability. These results confirmed our previous conjecture that WTAP contributes to the upregulation of PTGS2 mRNA by promoting its m6A modification in BV2 cells after OGD/R.

Figure 5.

Figure 5

Open in a new tab

WTAP upregulates PTGS2 expression by facilitating its m6A modification. (a) Quantitative analysis of m6A content in total RNA of BV2 cells after WTAP knockdown and OGD/R treatment. (n = 4). (b, c) The m6A potential sites in PTGS2 mRNA analyzed using m6AVarm6AVar. (d) qRT‐PCR analysis of PTGS2 mRNA expression in BV2 cells treated with Cyc, a methylation‐specific inhibitor, followed by OGD/R (n = 3). (e) BV2 cells treated with Cyc 24 h after OGD/R were exposed to Act‐D (5 μg/ml) for 0, 4, and 8 h. The relative abundance of PTGS2 mRNA was detected by qRT‐PCR. (n = 3). (f) Analysis of m6A‐modified PTGS2 mRNA levels in BV2 cells with or without OGD/R detected by the MeRIP assay (n = 3). (g) Analysis of PTGS2 mRNA levels bound to WTAP in BV2 cells with or without OGD/R detected by the RIP assay (n = 3). (h) Analysis of m6A‐modified PTGS2 mRNA levels in BV2 cells with or without WTAP knockdown detected by the MeRIP assay (n = 3). (i) qRT‐PCR analysis of PTGS2 mRNA in BV2 cells transfected with si‐NC or si‐WTAP and exposed to OGD/R followed by Act‐D treatment (n = 3). Quantitative data are shown as mean ± SD. Significant difference: **p < .01, ***p < .001 compared with the Ctrl + si‐NC group, ## p < .01, ### p < .001 compared with the OGD/R + si‐NC group, ****p < .01, *****p < .001 compared with the Ctrl group. & & & p < .001 compared with the DMSO group, ^^^p < .001 compared with the IgG group, %%% p < .001 compared with 0 h, and $$$ p < .001 compared with 4 h.

3.6. WTAP promotes M1 phenotype polarization of BV2 cells induced by OGD/R by targeting PTGS2

To verify whether PTGS2 is a key target in the WTAP regulation of microglial phenotypic polarization, we conducted in vitro overexpression of WTAP, while simultaneously introducing the PTGS2 inhibitor, NS‐398 (HY‐13913, MCE, Princeton, NJ). Overexpression of WTAP resulted in a further increase in PTGS2 and iNOS levels and a further decrease in Arg‐1 expression induced by OGD/R. However, the inhibition of PTGS2 reversed the WTAP overexpression‐induced M1 polarization of BV2 cells after OGD/R (Figure 6a‐e). Furthermore, the results targeting key pro‐inflammatory and anti‐inflammatory cytokines were remarkably consistent with the protein expression findings (Figure 6f‐i). In summary, WTAP is pivotal in modulating BV2 cell polarization by targeting PTGS2 in CIRI.

Figure 6.

Figure 6

Open in a new tab

WTAP promotes M1 phenotype polarization of BV2 cells induced by OGD/R by upregulatingg PTGS2 expression. (a‐e) Western blot analysis of WTAP, PTGS2, iNOS, and Arg‐1 protein expression in BV2 cells transfected with oe‐WTAP, exposed to NS‐398 (10 μM), and then subjected to OGD/R (n = 3). (f‐i) qRT‐PCR was performed to analyze the mRNA expression of M1 (IL‐1β and TNF‐α) and M2 (IL‐10 and TGF‐β) phenotype factors in BV2 cells. Cells were transfected with oe‐WTAP, treated with NS‐398, and subsequently exposed to OGD/R (n = 7). Quantitative data are shown as mean ± SD. Significant difference: ***p < .001 compared with the OGD/R group, ### p < .001 compared with the OGD/R + Vector + DMSO group, and & & & p < .001 compared with the OGD/R + oe‐WTAP group.

4. DISCUSSIONIS

As the predominant posttranscriptional epigenetic alteration, m6A modification plays a central role in overseeing essential physiological processes and contributes to the pathogenesis of diverse neurological conditions, including stroke (Li et al., 2021; Yi et al., 2021). In light of the pivotal regulatory function of microglia in inflammatory cascades within the central nervous system, our investigation focused on this mechanism. Here, we aimed to understand how m6A modification influences microglia‐mediated neuroinflammation in IS. For the first time, we identified the critical role of WTAP in IS neuroinflammation. There was an obvious increase in WTAP expression in microglia following IS, and knockdown of WTAP facilitated the shift of microglia from a pro‐inflammatory M1 phenotype to an anti‐inflammatory M2 phenotype, thereby providing effective relief from post‐IS brain injury. Mechanistically, WTAP aggravated IS by promoting M1 polarization of microglia and enhancing PTGS2 mRNA stability in an m6A‐dependent manner (Figure 7). Our findings highlight the crucial involvement of WTAP in IS and suggest that WTAP is a promising target for treating IS.

Figure 7.

Figure 7

Open in a new tab

Mechanism diagram of WTAP regulating microglial polarization in ischemic stroke.

Modifications in RNA methylation are prevalent in the mammalian brain and play a role in regulating learning, neurogenesis, and memory (Mathoux et al., 2021). An imbalance in m6A modifications can lead to various neurological conditions, including neurodegenerative, neurodevelopmental, and cerebrovascular diseases (Dermentzaki & Lotti, 2020). Several studies have demonstrated the influence of RNA methylation on stroke regulation. A recent investigation documented changes in m6A modifications in a CIRI rat model, identifying over 1000 genes with differentially expressed hypomethylated or hypermethylated m6A modifications, and the hypermethylated genes were involved in processes related to inflammation (Yi et al., 2021). The reported findings indicate a substantial increase in m6A levels in IS. Adjusting m6A levels can regulate microglial inflammatory responses to reduce brain injury after a stroke (Zhang, Ding, et al., 2023). Our results are consistent with the aforementioned studies in that m6A methylation modification can affect the stability of the mRNA of the key inflammation‐related gene PTGS2 and its expression level in the OGD model.

WTAP, a key subunit of the m6A methyltransferase complex, has been implicated in arteriovenous malformations in the brain through the inhibition of endothelial cell angiogenesis (Wang et al., 2020). WTAP promotes m6A methylation of NLRP3 mRNA, leading to pyroptosis and inflammation in diabetic nephropathy (Lan et al., 2022). However, the function and regulatory pathways of WTAP in IS remain unclear. Our research utilized bioinformatics analysis to identify the differential expression of the WTAP gene in peripheral blood mononuclear cells of IS patients and controls. We subsequently confirmed increased WTAP levels in microglia and the ischemic penumbra of brain tissues after CIRI in both in vitro and in vivo settings. Notably, this discovery diverges from the observations made in a previous study (Xu et al., 2020), and we attribute this inconsistency to various factors, including differences in animal species and experimental conditions. Therefore, we hypothesized that WTAP plays a role in the pathological process of IS by regulating the m6A modification of certain molecules. Combined with our results that inhibition of m6A modification reduced PTGS2 mRNA expression and that WTAP increased the m6A levels of total RNA and promoted PTGS2 mRNA expression, it is reasonable to speculate that WTAP may play a role in promoting PTGS2 mRNA expression through m6A modification during IS. We employed RIP and MeRIP assays and transgenic technology to demonstrate for the first time that WTAP knockdown inhibits the expression of PTGS2 by reducing m6A modification of its mRNA, thereby promoting M2 polarization of microglial cells and exhibiting anti‐inflammatory properties in IS.

PTGS plays a well‐established role in the regulation of vascular tone, inflammation, and pain (Smyth et al., 2009). In humans, there are two types of PTGS, PTGS1 and PTGS2. PTGS1 is constitutively expressed, and prior research has suggested an association between PTGS2 transcription and various inflammatory signaling pathways, including NF‐κB, AP‐1, and Sp1. A recent investigation showed that m6A modification of PTGS2 is positively associated with lung inflammation induced by exposure to PM2.5 (Li, Su, et al., 2023). These findings are consistent with our findings that PTGS2 may be a key mediator of WTAP in the regulation of microglia‐mediated inflammation in IS. To further validate our hypothesis, we treated BV2 cells that overexpressed WTAP with a PTGS2 inhibitor before OGD/R and confirmed that the inhibition of PTGS2 reversed the polarization of M1 microglia induced by WTAP overexpression. Consequently, we determined that PTGS2 is a novel target of WTAP during IS. In summary, WTAP increased PTGS2 mRNA expression in an m6A‐dependent manner, which induced microglial polarization to the pro‐inflammatory M1 phenotype and aggravated brain injury after CIRI.

Although our data substantiate the crucial role of WTAP in IS and its potential regulatory mechanisms, it is essential to acknowledge certain limitations. First, the use of BV2 microglia in this study involved a microglial cell line that exhibits substantial differences from in vivo microglia (Orihuela et al., 2016). Despite the widespread use of BV2 microglia to explore the underlying mechanisms of neuroinflammation during CIRI (Kim et al., 2022), transcriptome sequencing has indicated that established BV2 microglial cell lines may inadequately represent primary microglia (Das et al., 2016). The molecular mechanism by which m6A modification regulates neuroinflammation in primary microglia requires further validation. Second, only male mice were included in this study, overlooking the main role of sex in the pathological mechanisms of cerebral diseases. Kim et al. (2019) demonstrated significant differences in the prevalence, age at onset, pathophysiology, and symptomatology of many CNS injuries between males and females (Kim et al., 2019). Furthermore, sex disparities have been identified in the distribution and function of immune cell populations during stroke between males and females (Liu et al., 2022). Therefore, it is imperative to explore whether sex differences influence disparities in the mechanisms or functions of WTAP in IS.

5. CONCLUSIONS

In conclusion, our observations indicated that WTAP may serve as a pivotal posttranscriptional regulator of neuroinflammation following IS. WTAP knockdown provided cerebral protection by triggering the transformation of the microglial phenotype from M1 to M2. This shift was accomplished by a reduction in PTGS2 mRNA stability in an m6A‐dependent manner.

AUTHOR CONTRIBUTIONS

Haijing Sui: Conceptualization; data curation; methodology; formal analysis; investigation; and writing–original draft. Chang Liu: Software and visualization. Zhenyu Sun: Data curation and validation. Hongjie Xi: Funding acquisition; project administration; supervision; resources; writing–review and editing.

FUNDING

This research was funded by the Second Affiliated Hospital of Harbin Medical University.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

Supporting information

Supporting information.

CBIN-49-288-s001.docx (16.5KB, docx)

ACKNOWLEDGEMENTS

We appreciate the support from the staff of the Heilongjiang Province Key Laboratory of Research on Anesthesiology. We thank Editage (www.editage.cn) for English language editing.

Sui, H. , Liu, C. , Sun, Z. , & Xi, H. (2025). Wilms' tumor 1‐associated protein aggravates ischemic stroke by promoting M1 polarization of microglia by enhancing PTGS2 mRNA stability in an m6A‐dependent manner. Cell Biology International, 49, 288–302. 10.1002/cbin.12266

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Calis, Z. , Mogulkoc, R. , & Baltaci, A. K. (2020). The roles of flavonols/flavonoids in neurodegeneration and neuroinflammation. Mini‐Reviews in Medicinal Chemistry, 20(15), 1475–1488. 10.2174/1389557519666190617150051 [DOI] [PubMed] [Google Scholar]
  2. Chang, H. , Yang, J. , Wang, Q. , Zhao, J. , & Zhu, R. (2022). Role of N6‐methyladenosine modification in pathogenesis of ischemic stroke. Expert Review of Molecular Diagnostics, 22(3), 295–303. 10.1080/14737159.2022.2049246 [DOI] [PubMed] [Google Scholar]
  3. Chen, Y. , Peng, C. , Chen, J. , Chen, D. , Yang, B. , He, B. , Hu, W. , Zhang, Y. , Liu, H. , Dai, L. , Xie, H. , Zhou, L. , Wu, J. , & Zheng, S. (2019). WTAP facilitates progression of hepatocellular carcinoma via m6A‐HuR‐dependent epigenetic silencing of ETS1. Molecular Cancer, 18(1), 127. 10.1186/s12943-019-1053-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chokkalla, A. K. , Mehta, S. L. , Kim, T. , Chelluboina, B. , Kim, J. , & Vemuganti, R. (2019). Transient focal ischemia significantly alters the m(6)A epitranscriptomic tagging of RNAs in the brain. Stroke, 50(10), 2912–2921. 10.1161/strokeaha.119.026433 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Das, A. , Kim, S. H. , Arifuzzaman, S. , Yoon, T. , Chai, J. C. , Lee, Y. S. , Park, K. S. , Jung, K. H. , & Chai, Y. G. (2016). Transcriptome sequencing reveals that LPS‐triggered transcriptional responses in established microglia BV2 cell lines are poorly representative of primary microglia. Journal of Neuroinflammation, 13(1), 182. 10.1186/s12974-016-0644-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dermentzaki, G. , & Lotti, F. (2020). New insights on the role of N (6)‐Methyladenosine RNA methylation in the physiology and pathology of the nervous system. Frontiers in Molecular Biosciences, 7, 555372. 10.3389/fmolb.2020.555372 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dominissini, D. , Moshitch‐Moshkovitz, S. , Schwartz, S. , Salmon‐Divon, M. , Ungar, L. , Osenberg, S. , Cesarkas, K. , Jacob‐Hirsch, J. , Amariglio, N. , Kupiec, M. , Sorek, R. , & Rechavi, G. (2012). Topology of the human and mouse m6A RNA methylomes revealed by m6A‐seq. Nature, 485(7397), 201–206. 10.1038/nature11112 [DOI] [PubMed] [Google Scholar]
  8. Fisher, M. , & Savitz, S. I. (2022). Pharmacological brain cytoprotection in acute ischaemic stroke‐renewed hope in the reperfusion era. Nature Reviews Neurology, 18(4), 193–202. 10.1038/s41582-021-00605-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hu, X. , Leak, R. K. , Shi, Y. , Suenaga, J. , Gao, Y. , Zheng, P. , & Chen, J. (2015). Microglial and macrophage polarization—new prospects for brain repair. Nature Reviews Neurology, 11(1), 56–64. 10.1038/nrneurol.2014.207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jurcau, A. , & Simion, A. (2021). Neuroinflammation in cerebral ischemia and ischemia/reperfusion injuries: From pathophysiology to therapeutic strategies. International Journal of Molecular Sciences, 23(1), 14. 10.3390/ijms23010014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kim, J. K. , Yang, H. J. , & Go, Y. (2022). Quercus acuta thunb. suppresses LPS‐Induced neuroinflammation in BV2 microglial cells via regulating MAPK/NF‐κB and Nrf2/HO‐1 pathway. Antioxidants (Basel, Switzerland), 11(10), 1851. 10.3390/antiox11101851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kim, T. , Chelluboina, B. , Chokkalla, A. K. , & Vemuganti, R. (2019). Age and sex differences in the pathophysiology of acute CNS injury. Neurochemistry International, 127, 22–28. 10.1016/j.neuint.2019.01.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lan, J. , Xu, B. , Shi, X. , Pan, Q. , & Tao, Q. (2022). WTAP‐mediated N(6)‐methyladenosine modification of NLRP3 mRNA in kidney injury of diabetic nephropathy. Cellular & Molecular Biology Letters, 27(1), 51. 10.1186/s11658-022-00350-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Li, Q. , Wen, S. , Ye, W. , Zhao, S. , & Liu, X. (2021). The potential roles of m(6)A modification in regulating the inflammatory response in microglia. Journal of Neuroinflammation, 18(1), 149. 10.1186/s12974-021-02205-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li, Y. , Li, J. , Yu, Q. , Ji, L. , & Peng, B. (2023). METTL14 regulates microglia/macrophage polarization and NLRP3 inflammasome activation after ischemic stroke by the KAT3B‐STING axis. Neurobiology of Disease, 185, 106253. 10.1016/j.nbd.2023.106253 [DOI] [PubMed] [Google Scholar]
  16. Li, Z. , Su, Q. , Xu, R. , Peng, J. , Wang, Z. , Zhu, X. , & Wei, Y. (2023). Effect of acute PM(2.5) exposure on PTGS2 and RNA m6A modification. Environmental Pollution, 335, 122264. 10.1016/j.envpol.2023.122264 [DOI] [PubMed] [Google Scholar]
  17. Liu, C. , Chen, H. , Tao, X. , Li, C. , Li, A. , & Wu, W. (2024). ALKBH5 protects against stroke by reducing endoplasmic reticulum stress‐dependent inflammation injury via the STAT5/PERK/EIF2α/CHOP signaling pathway in an m(6)A‐YTHDF1‐dependent manner. Experimental Neurology, 372, 114629. 10.1016/j.expneurol.2023.114629 [DOI] [PubMed] [Google Scholar]
  18. Liu, J. , Harada, B. T. , & He, C. (2019). Regulation of gene expression by N‐methyladenosine in cancer. Trends in Cell Biology, 29(6), 487–499. 10.1016/j.tcb.2019.02.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Liu, J. , Sato, Y. , Falcone‐Juengert, J. , Kurisu, K. , Shi, J. , & Yenari, M. A. (2022). Sexual dimorphism in immune cell responses following stroke. Neurobiology of Disease, 172, 105836. 10.1016/j.nbd.2022.105836 [DOI] [PubMed] [Google Scholar]
  20. Longa, E. Z. , Weinstein, P. R. , Carlson, S. , & Cummins, R. (1989). Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke, 20(1), 84–91. 10.1161/01.str.20.1.84 [DOI] [PubMed] [Google Scholar]
  21. Mathoux, J. , Henshall, D. C. , & Brennan, G. P. (2021). Regulatory mechanisms of the RNA modification m(6)A and significance in brain function in health and disease. Frontiers in Cellular Neuroscience, 15, 671932. 10.3389/fncel.2021.671932 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Orihuela, R. , McPherson, C. A. , & Harry, G. J. (2016). Microglial M1/M2 polarization and metabolic states. British Journal of Pharmacology, 173(4), 649–665. 10.1111/bph.13139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Smyth, E. M. , Grosser, T. , Wang, M. , Yu, Y. , & FitzGerald, G. A. (2009). Prostanoids in health and disease. Journal of Lipid Research, 50(Suppl), S423–S428. 10.1194/jlr.R800094-JLR200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Virani, S. S. , Alonso, A. , Benjamin, E. J. , Bittencourt, M. S. , Callaway, C. W. , Carson, A. P. , Chamberlain, A. M. , Chang, A. R. , Cheng, S. , Delling, F. N. , Djousse, L. , Elkind, M. S. V. , Ferguson, J. F. , Fornage, M. , Khan, S. S. , Kissela, B. M. , Knutson, K. L. , Kwan, T. W. , Lackland, D. T. , … Tsao, C. W. (2020). Heart disease and stroke statistics‐2020 update: a report from the American Heart Association. Circulation, 141(9), e139–e596. 10.1161/cir.0000000000000757 [DOI] [PubMed] [Google Scholar]
  25. Wang, L. , Xue, Y. , Li, H. , Huo, R. , Yan, Z. , Wang, J. , Xu, H. , Wang, J. , Cao, Y. , & Zhao, J. (2020). Wilms' tumour 1‐associating protein inhibits endothelial cell angiogenesis by m6A‐dependent epigenetic silencing of desmoplakin in brain arteriovenous malformation. Journal of Cellular and Molecular Medicine, 24(9), 4981–4991. 10.1111/jcmm.15101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Xu, K. , Mo, Y. , Li, D. , Yu, Q. , Wang, L. , Lin, F. , Kong, C. , Balelang, M. F. , Zhang, A. , Chen, S. , Dai, Q. , & Wang, J. (2020). N(6)‐methyladenosine demethylases Alkbh5/Fto regulate cerebral ischemia‐reperfusion injury. Therapeutic Advances in Chronic Disease, 11, 2040622320916024. 10.1177/2040622320916024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yi, D. , Wang, Q. , Zhao, Y. , Song, Y. , You, H. , Wang, J. , Liu, R. , Shi, Z. , Chen, X. , & Luo, Q. (2021). Alteration of N (6) ‐methyladenosine mRNA methylation in a rat model of cerebral ischemia‐reperfusion injury. Frontiers in Neuroscience, 15, 605654. 10.3389/fnins.2021.605654 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. You, S. , Su, X. , Ying, J. , Li, S. , Qu, Y. , & Mu, D. (2022). Research progress on the role of RNA m6A modification in glial cells in the regulation of neurological diseases. Biomolecules, 12(8), 1158. 10.3390/biom12081158 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zhang, F. , Ran, Y. , Tahir, M. , Li, Z. , Wang, J. , & Chen, X. (2022). Regulation of N6‐methyladenosine (m6A) RNA methylation in microglia‐mediated inflammation and ischemic stroke. Frontiers in Cellular Neuroscience, 16, 955222. 10.3389/fncel.2022.955222 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhang, N. , Ding, C. , Zuo, Y. , Peng, Y. , & Zuo, L. (2023). N6‐methyladenosine and neurological diseases. Molecular Neurobiology, 59(3), 1925–1937. 10.1007/s12035-022-02739-0. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information.

CBIN-49-288-s001.docx (16.5KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Cell Biology International are provided here courtesy of Wiley

RESOURCES