Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
A, Electropherogram showing M319K mutation sequence. B, NlaIII digested 181-bp products, run on a 2% agarose gel from a subset of affected and unaffected family members. Since the HOXD10 M319K mutation does not alter a naturally occurring restriction enzyme recognition site, a primer (TCAAGATTTGGTTTCAAAACCGCCGC*A) was designed that would create an NlaIII site in combination with wild-type sequence but not with the M319K mutation.
