Summary
Chromatin immunoprecipitation (ChIP) is used to investigate genome binding by transcription factors, but it can be problematic. We present a protocol to isolate fixed DNA-protein complexes from mouse liver prior to chromatin shearing. We describe steps for liver disaggregation and cross-linking, DNA-protein complex isolation, chromatin shearing, and quality control analysis as well as procedures for ChIP, DNA purification, and ChIP analysis. This protocol yields high-quality samples using commercial antibodies.
For complete details on the use and execution of this protocol, please refer to Akl et al.1
Subject areas: molecular biology, antibody, chromatin immunoprecipitation, ChIP
Graphical abstract

Highlights
-
•
Steps for conducting ChIP on in vivo mouse liver samples
-
•
Protocol for purifying fixed DNA-protein complexes from enriched nuclear fractions
-
•
Instructions for chromatin shearing and performing quality control analysis
-
•
Detailed procedure for analyzing samples after high-quality ChIP
Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.
Chromatin immunoprecipitation (ChIP) is used to investigate genome binding by transcription factors, but it can be problematic. We present a protocol to isolate fixed DNA-protein complexes from mouse liver prior to chromatin shearing. We describe steps for liver disaggregation and cross-linking, DNA-protein complex isolation, chromatin shearing, and quality control analysis as well as procedures for ChIP, DNA purification, and ChIP analysis. This protocol yields high-quality samples using commercial antibodies.
Before you begin
The protocol described here has been optimized for mouse liver tissue. Here, we describe specific steps modified from Qin & Wang2 using mouse liver tissue, for which we have found can be utilized in ChIP-sequencing (ChIP-seq) and -quantitative polymerase chain reaction (ChIP-qPCR) experiments to identify the genomic sites that are bound by two transcription factors named nuclear factor erythroid 2 related factor-1 (NRF1) and nuclear factor erythroid 2 related factor-2 (NRF2).1 In our experience, this protocol renders high yield and quality using anti-NRF1 and anti-NRF2 antibodies. Though not described here, this protocol is also effective using nuclei isolated, beginning at step 2e, from the following cells grown in culture: Hep3b human hepatoma cells, Hepa 1–6 mouse hepatoma cells, and primary mouse embryo fibroblast (MEF) cells. While our focus here is on in vivo mouse liver samples, we mention important differences when using cell culture samples.
We use about 500 mg liver tissue for ChIP experiments for transcription factors of interest (NRF1 and NRF2). DNA yield is approximately 250–420 μg when using DNAzol3 reagent to isolate chromatin, which has more enriched chromatin proteins (Figure 1A), higher yield immunoprecipitation products (Figure 1B) and less background (Figure 1C) compared to nuclear fraction. For cultured cells, we normally get 200–300 μg of DNA from 1–2 × 107 cells. We typically use 30 μg of DNA for each ChIP reaction. However, less DNA can be used for each ChIP to achieve sufficient enrichment if working with more effective targets, such as histone proteins or highly abundant transcription factors with high quality antibodies.
Figure 1.
Fraction analysis
(A–C) The enrichment of nuclei and chromatin subcellular fractions from total liver tissue isolated from mice was assessed by immunoblot of these fractions (A) and by immunoblot on anti-IgG control and anti-Nrf1 immunoprecipitated samples (B) as well as by performing a silver stain of the NuPAGE gels used for electrophoresis (C). For these representative liver samples, total liver lysate and nuclei fraction were prepared using the method we described previously.1 Chromatin was prepared by using DNAzol, as described in this paper.
Institutional permission
This study was approved by the University of Saskatchewan’s Animal Care Committee, in accordance with animal use protocol number AUP20180090.
Preparing buffers
Timing: 2–3 h
-
1.Prepare the buffers listed below (recipes are listed below in materials and equipment section), making sure to adjust the temperature as indicated.
-
a.250-STM (sucrose/tris/MgCl2) buffer (homemade, filtered, 4°C).
-
b.16% formaldehyde (W/V), methanol-free (Cat# 28908, Thermo Fisher Scientific. Ready-to-use, room temperature).
-
c.2.5 M glycine (homemade, filtered, room temperature).
-
d.Phosphate buffered salts (PBS) buffer (Cat# SH3025601, Ge Hyclone, 4°C).
-
e.100% ethanol (Cat# 106-02-17N, Commercial Alcohols, 4°C).
-
f.75% ethanol (homemade, 4°C).
-
g.Immunoprecipitation (IP) buffer (homemade, filtered, 4°C).
-
h.10% sodium dodecyl sulfate (SDS), (homemade, filtered, room temperature).
-
i.5 M sodium chloride (NaCl) (homemade, room temperature).
-
j.3 M sodium acetate, pH 5.2 (homemade, filtered, 4°C).
-
k.2× ChIP elution buffer (filtered, freshly made, room temperature).
-
l.100 mM phenylmethylsulfonylfluoride (PMSF) in isopropanol (homemade, −20°C).
-
m.100 mM dithiothreitol DTT (homemade, −20°C).
-
n.Protease inhibitor cocktail solution (Cat# 3115879001, Roche 50×, −20°C).
-
a.
CRITICAL: All marked solutions should be filtered by a 0.22–0.45 μm filter unit.
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-NRF1 (2 μg/mL for ChIP and 1:1,000 for immunoblot) | Cell Signaling Technology | Cat# 8052; RRID: AB_11178947 |
| Anti-NRF2 (2 μg/mL for ChIP and 1:1,000 for immunoblot) | Cell Signaling Technology | Cat# 12721; RRID: AB_10891429 |
| Anti-GAPDH (1:1,000) | Invitrogen | Cat# AM4300; RRID: AB_2536381 |
| Anti-Lamin A/C (1:1,000) | Cell Signaling Technology | Cat# 4777; RRID: AB_10545756 |
| Anti-rabbit HRP conjugate (1:5,000) | Cell Signaling Technology | Cat# 7074S; RRID: AB_2099233 |
| Rabbit (DA1E) mAb IgG (2 μg/mL) | Cell Signaling Technology | Cat# 3900; RRID: AB_1550038 |
| Chemicals, peptides, and recombinant proteins | ||
| 16% Formaldehyde (W/V), methanol-free | Thermo Fisher Scientific | Cat# 28908 |
| ChIP-Grade Protein G Magnetic Beads | Cell Signaling Technology | Cat# 9006 |
| DNAzol | Invitrogen | Cat# 10974020 |
| Nitrocellulose membrane | Bio-Rad | Cat# 162-0115 |
| NP-40 Alternative | Calbiochem | Cat# 492016100ML |
| NuPAGE 4%–12% Bis-Tris Protein Gels | Thermo Fisher Scientific | Cat# NP0336 |
| NuPAGE MOPS running buffer | Thermo Fisher Scientific | Cat# NP0001 |
| Phosphate-buffered saline (PBS) | GE HyClone | Cat# SH3025601 |
| Protease inhibitor cocktail | Roche | Cat# 11873580001 |
| Proteinase K | Roche | Cat# 3115879001 |
| Critical commercial assays | ||
| GeneJET PCR Purification Kit | Thermo Fisher Scientific | Cat# K0702 |
| PowerUp SYBR Green Master Mix | Thermo Fisher Scientific | Cat# A25742 |
| Super Signal West Femto maximum sensitivity substrate | Thermo Fisher Scientific | Cat# 34096 |
| Deposited data | ||
| ChIP-seq data from Akl et al. (2023)1 | NCBI; BioProject ID: PRJN806849 | |
| Experimental models: Organisms/strains | ||
| Adult male and female Mus musculus C57BL/6J at 9–12 weeks of age | The Jackson Laboratory | Jax: 000664 |
| Oligonucleotides | ||
|
Ces1g Forward: CATTGCAGCATCAGCCTGT Reverse: TGGCCTGAGACAAAGTTCTGAG |
N/A | Akl et al. (2023)1 |
|
Gstm1 Forward: GGGAACAACAAGCGAATCGG Reverse: GTATTCAGCCAGGGTGCAGT |
N/A | Akl et al. (2023)1 |
|
Psma1 Forward: GGGCTCAACACACCATAGCTC Reverse: ACGATCACCGAACCGTAGTT |
N/A | Akl et al. (2023)1 |
|
Psmc2 Forward: CCTTCCACCAGACAACCCTT Reverse: CGCTGGTGTCTTCCCTTTCT |
N/A | Akl et al. (2023)1 |
| Software and algorithms | ||
| Fiji open-source image analysis software | Fiji | RRID: SCR_002285; https://fiji.sc/ |
| GraphPad Prism 9.3.1 | GraphPad Software | RRID: SCR_002798; https://www.graphpad.com |
| Other | ||
| Bioruptor Pico tube, 1.5 mL | Diagenode | Cat# C30010016 |
| Bioruptor pico sonicator device | Diagenode | Cat# B01060010 |
| (Alternative) CPX130 Ultrasonic Processor | Cole-Parmer instruments | N/A |
| CFX384 Touch Real-Time PCR Detection System | Bio-Rad | N/A |
| Dissecting scissor | Almedic Ltd | 36-104-0098 |
| DynaMag-2 magnetic stand | Thermo Fisher Scientific | Cat# 12321D |
| Centrifuge tube with cap, 1.5 mL | Axygen | Cat# 14-222-672 |
| MicroAmp Clear adhesive film | Thermo Fisher Scientific | Cat# 4306311 |
| Microplates, PCR, 384-well skirted | Axygen | Cat# 14-222-306 |
| NanoDrop spectrophotometer | Thermo Fisher Scientific | Cat# ND-ONE-W |
| Teflon pestle tissue grinder | Wheaton Kimble | Cat# 358009 |
| Power homogenizer | Wheaton | Cat# 903475 |
Materials and equipment
250-STM buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| Sucrose | 250 mM | 42.78 g |
| 1 M Tris-HCl pH 7.4 | 50 mM | 25 mL |
| 1 M MgCl2 | 5 mM | 2.5 mL |
| ddH2O | To 500 mL | |
| Total | N/A | 500 mL |
Filter and store at 4°C for up to 1 month.
IP buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| NaCl | 150 mM | 4.383 g |
| 1 M Tris-HCl pH 7.4 | 50 mM | 25 mL |
| 100 mM EDTA | 5 mM | 25 mL |
| 10% NP-40 | 0.5% vol/vol | 25 mL |
| 10% Triton X-100 | 1.0% vol/vol | 50 mL |
| ddH2O | To 500 mL | |
| Total | N/A | 500 mL |
Filter and store at 4°C for up to 3 months.
Protein denature buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| 1 M Tris-HCl pH 7.4 | 50 mM | 2.5 mL |
| 10% SDS | 2% | 10 mL |
| Urea | 8 M | 24.024 g |
| ddH2O | To 50 mL | |
| Total | N/A | 50 mL |
Freshly made.
Note: To dissolve faster, this buffer can be incubated at 37°C water bath with gentle mixing occasionally.
2× ChIP elution buffer
| Reagent | Final concentration | Amount |
|---|---|---|
| NaHCO3 | 200 mM | 84 mg |
| 10% SDS | 2% | 1 mL |
| ddH2O | 4 mL | |
| Total | N/A | 5 mL |
Made freshly and stored at room temperature.
-
•100 mM PMSF/isopropanol:
- Add 174 mg PMSF in 10 mL isopropanol.
- Aliquot and store at −20°C for up to 6 months.
-
•10% SDS:
- Add 10 g SDS in 80 mL MilliQ water, add a magnetic flea and place on a magnetic stirring plate to mix solution. Heat solution to 60°C until SDS powder fully dissolved and top up the solution to 100 mL using MilliQ water.
- Filter and store at room temperature for up to 3 months.
CRITICAL: SDS is a fine powder and toxic chemical; it should be weighed under a fume hood to avoid inhalation.
-
•2.5 M Glycine:
- Add 93.8 g glycine in 400 mL MilliQ water. Adjust the volume to 500 mL with MilliQ water after glycine completely dissolved.
- Filtered and store at room temperature for up to 3 months.
-
•5 M NaCl:
- Add 292 g of NaCl in 800 mL of MilliQ water. Adjust the volume to 1 L with MilliQ water.
- Filter and store at room temperature up to 6 months.
-
•3 M sodium acetate, pH 5.2:
- Add 24.6 g of sodium acetate in 70 mL MilliQ water, Adjust the pH to 5.2 by adding glacial acetic acid. Adjust the volume to 100 mL with MilliQ water.
- Filter and store at room temperature up to 6 months.
-
•Protease inhibitor cocktail solution (50×):
- Dissolve one tablet in 1 mL MilliQ water.
- Aliquot and store at −20°C for up to 3 months.
Step-by-step method details
Liver tissue disaggregation and cross-linking
Liver tissue was homogenized and nuclei isolated and cross-linked to trap protein-DNA interactions
Timing: Day 1, 2–3 h
Fresh mouse liver tissue extraction, homogenization, nuclei isolation, and cross-linking.
-
1.Prepare solution for homogenizing and cross-linking.
-
a.Prepare homogenizing solution by freshly adding 1 mL 100 mM PMSF to 99 mL 250-STM buffer at final concentration of 1 mM. Keep solution on ice. 10 mL will be used for each liver sample.
-
b.Prepare cross-linking solution in fume hood by adding 16% formaldehyde to 250-STM buffer at a final concentration of 1% (e.g., add 2 mL 16% formaldehyde to 30 mL buffer). Bring the cross-linking solution to room temperature before use. 10 mL will be used for each liver sample.
-
a.
-
2.Mouse liver cross-linking (troubleshooting 1).
-
a.Start with 250–500 mg fresh mouse liver tissue, place the liver piece in a 50 mL beaker containing 10 mL ice cold homogenizing solution.
-
b.Cut tissue into about 3 mm small pieces with a dissecting scissor, and transfer solution to a Teflon pestle tissue grinder mounted on Wheaton power homogenizer.
-
c.Set the speed of homogenizer at 4, disaggregate liver tissue for 5 s to get a homogeneous suspension.
-
d.Transfer the tissue suspension into a 50 mL tube and centrifuge at 800 g for 15 min at 4°C. Gently discard the supernatant and keep nuclei-containing pellet.
-
e.Resuspend the pellet in 10 mL of 250-STM buffer containing 1% of formaldehyde (cross-linking solution).Note: All steps with formaldehyde need to be done in a chemical hood.
-
f.Incubate by gentle mixing on a rotator for 30 min at room temperature.
-
g.Stop the cross-linking by adding 500 μL of 2.5 M glycine stock to a final concentration of 125 mM glycine. Continue to rotate at room temperature for 5 min.
-
h.Centrifuge samples at 800 g for 15 min at 4°C. Gently discard the supernatant and keep the pellet.
-
i.Resuspend the pellet in 10 mL of ice-cold PBS containing 100 μL 100 mM PMSF (Final concentration is 1 mM) to wash the pellet.
-
j.Centrifuge at 2000 g at 4°C for 5 min and discard the supernatant.
-
k.Repeat step i-j one more time.
Pause Point: Cross-linked liver nuclei samples can be used immediately or stored at −80°C for at least 6 months.
CRITICAL: Formaldehyde will be oxidized to formic acid when exposed to oxygen, which will compromise the cross-linking efficiency. We recommend purchasing small bottles of formaldehyde and preferably finish them within one month. The 16 % formaldehyde used in this protocol is a 10 mL solution in an ampule-sealed package, which allows access to ‘fresh’ formaldehyde each time.
CRITICAL: The cross-linking time is crucial for obtaining optimal result, especially for transcription factors and cofactors. Therefore, additional optimization might be required depending on your protein of interest.
-
a.
DNA-protein complex isolation
Timing: Day 2, 5 h
Isolating DNA-protein complex by using DNAzol,3 which is a guanidine salt containing reagent used for genomic DNA isolation. Qin & Wang2 have used this reagent to isolate and investigate crosslinked nuclear acid-binding proteins. The following steps are used to isolate and purify crosslinked DNA-protein complex.
Cross-linked liver nuclei samples are lysed by DNAzol reagent, non-crosslinked protein is dissociated, and DNA-protein complexes are isolated and sheared.
-
3.DNA-Protein complex isolation.
-
a.Add 5 mL DNAzol reagent to the nuclei pellet (or 1 mL per 100 mg homogenized tissue), resuspend the pellet with a wide bore tip.Note: Prepare wide bore pipette tips by cutting 2–3 mm from the end of tips.
-
b.Incubate for 15 min at room temperature with gentle rotation.
CRITICAL: Do not clear the sample by centrifugation after this step. -
c.Add 2.5 mL ice-cold 100% ethanol (or half volume of DNAzol Reagent used) to the tube.
-
d.Mix samples by inversion and incubate at −20°C for 1 h to precipitate the DNA-protein complexes.
-
e.Prepare protein denature buffer during precipitation.
-
f.Pellet precipitates via centrifugation at 4000 g at 4°C for 10 min.
-
g.Wash pellets with 5 mL ice-cold 75% ethanol (or same volume as DNAzol reagent used).
-
h.Centrifuge at 4000 g at 4°C for 10 min.
-
i.Discard supernatant and air-dry pellets for 5–15 s.
-
j.Add 5 mL of protein denature buffer and resuspend pellets (or same volume as DNAzol Reagent used) and then incubate samples at 37°C for 30 min with gentle shaking to remove non-covalently bound proteins from chromatin sample.
-
k.Add 5 mL of 5 M NaCl (equal volume as protein denature buffer) and incubate at 37°C for 30 min.
-
l.Add 1 mL (0.1 volume) of 3 M sodium acetate and 30 mL (3 volumes) of ice-cold 100% ethanol.
-
m.Incubate at −20°C for 1 h to precipitate purified DNA and DNA-protein complexes.
-
n.Collect pellet by centrifugation at 4000 g at 4°C for 10 min.
-
o.Resuspend and wash the pellets with 25 mL ice-cold 75% ethanol to remove salts and detergents.
-
p.Centrifuge at 4000 g at 4°C for 10 min. Discard supernatant and place samples on ice.
-
q.Repeat step o-p two more times to have total of 3 washes.
-
r.Air-dry the pellets for 10 min at room temperature.
-
s.Dissolve pellets on ice with 5 mL IP buffer containing 0.5% SDS and protease inhibitor cocktail.Note: To make complete IP buffer for dissolving pellets, add 250 μL 10 % SDS, 100 μL 50× protease inhibitor cocktail solution to 4750 μL IP buffer.Optional: Save 50 μL aliquot of each sample as pre-sonication control. Another aliquot can also be saved for verifying target of interest by western blot.
-
a.
Chromatin shearing
Timing: day 2, 2–3 h
Isolated chromatin is sheared and cleared, and an aliquot is set aside for quality control analysis.
-
4.
Split each sample into 300 μL aliquots and transfer to 1.5 mL Bioruptor Microtubes with caps.
-
5.
Shear chromatin via sonication using Bioruptor Pico, set 20 cycles of 30 s ON/30 s OFF.
CRITICAL: Bioruptor Microtubes are specifically designed for efficient delivery of sonication energy to the samples. Regular Eppendorf 1.5 mL tube will not work for this type of instrument (Figure 2A).
CRITICAL: When using Bioruptor tube holder, all the slots need to be filled with microtubes containing equal volumes of samples or water for similar sound wave distribution across samples.
CRITICAL: Sonication conditions should be determined for different sonicator model, as well as cell line or tissue type. The optimal size range of chromatin should be between 150-700 base pair.
Alternatives: Here, we used diagenode Bioruptor Pico for shearing the chromatin. We also tested a probe sonicator by Cole-Parmer instruments (Model: CPX130) and had comparable result with the settings of 60% output, 1 sec pulse on/2 sec off, 15 pulses per cycle, total 4 cycles (Figure 2B).
-
6.
Transfer samples to new 1.5 Eppendorf tubes and clear the lysate by centrifuging at 13,000 g for 10 min at 4°C. Collect and save the supernatant which contains the sheared chromatin.
Note: Bioruptor tubes may break when centrifuging at high speed, therefore we use Eppendorf tubes instead for clearing samples.
-
7.
Take an aliquot of 50 μL for assessment of chromatin shearing and store at −80°C.
Optional: Save 50 μL aliquot of each sample for verifying target of interest by western blot.
Pause point: Chromatin can be frozen in liquid nitrogen and stored at −80°C for at least 2 months.
Figure 2.
Gel of sheared DNA
(A) Comparison of tube effect on sonication efficiency was tested using mouse genomic DNA in an Eppendorf or bioruptor tube.
(B) Analysis of size range for sheared chromatin isolated using DNAzol and comparing the effect of a probe sonicator and bioruptor with different cycle settings.
Sheared chromatin quality control analysis
Timing: Day 3, 2–3 h
An aliquot of sheared chromatin is reverse-crosslinked and purified using PCR purification kit. The size range of chromatin is analyzed by electrophoresis. DNA concentration is measured by NanoDrop.
-
8.
Thaw aliquoted chromatin from step 7, which contains 50 μL sheared chromatin and add 150 μL 1× ChIP elution buffer.
-
9.
Add 8 μL 5 M NaCl to each sample, mix and then incubate at 95°C for 15 min. Afterward, cool samples to room temperature.
-
10.
Purify and collect DNA in 50 μL of elution buffer. This protocol used the GeneJET PCR Purification Kit from Thermo Fisher (https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0012662_GeneJET_PCR_Purification_UG.pdf).
-
11.
Use 10 μL sample and determine DNA fragment size by electrophoresis on a 1.5% agarose gel with a 100 base pair DNA marker (Troubleshooting 2).
-
12.
To determine DNA concentration, transfer 2 μL of purified DNA to NanoDrop. The concentration of DNA should be 50–90 ng/μL.
Chromatin immunoprecipitation—Forming antibody/chromatin complexes
Timing: Day 3, 30 min and 16 h incubation
An antibody (negative, positive or specific targeting protein of interest) is added to chromatin samples and incubated overnight at 4°C to allow forming antibody/chromatin complexes.
-
13.
Into prechilled 1.5 mL Eppendorf tube, aliquot 30 μg of original sheared chromatin sample for each specific target if using multiple antibodies, plus a positive control if available and the negative control (IgG or Mock-IP).
Note: To calculate amount of chromatin samples used for immunoprecipitation, we will first check the sample concentration from step 12 and then calculate then volume of samples that needed. For example, if the DNA concentration from step 12 is 100 ng/μL, then for 30 μg of sample, we should take 300 μL (30 μg × 1000/100 ng/μL = 300 μL) of original sheared chromatin.
-
14.
Dilute samples from step 13 to final volume of 1 mL by adding proper amount of IP buffer containing 1× protease inhibitor (e.g., add 800 μL IP buffer to 200 μL chromatin sample), make sure SDS concentration is less than 0.1% after dilution.
-
15.
Aliquot 50 μL of diluted chromatin into a new 1.5 mL tube and label as “5% Input”. Store sample at −80°C until used in step 21.
-
16.
Add 2 μg target-specific antibody to sample, and 2 μg IgG sample for the negative control. Thus, the antibody concentration is approximately 2 μg/mL.
CRITICAL: When using IgG as negative control, it is important to make sure the isotope of IgG is the same as target-specific antibody.
-
17.
Incubate IP samples overnight at 4°C with rotation.
Chromatin immunoprecipitation—Adding beads, elute, and reverse crosslinking
Timing: Day 4, 5 and 16 h incubation
The antibody/chromatin complexes are pulled down by magnetic beads. Non-specific binding is largely removed by intensive washes using IP buffer. The DNA-protein complexes are eluted, and the crosslinks are reversed by heating.
-
18.
Gently vortex ChIP-Grade Protein G magnetic beads, add 30 μL of Protein G magnetic beads to each IP reaction and incubate for 2 h, at 4°C with rotation.
-
19.
Place the tubes in a magnetic stand, wait 1 min for solution to clear.
-
20.
Remove supernatant carefully.
-
21.
Wash magnetic beads with 1 mL ice-cold IP buffer.
-
22.
Place the tubes in a magnetic stand, wait 1 min for solution to clear.
-
23.
Remove supernatant carefully.
-
24.
Repeat step 21 to 23 four more times.
-
25.Elution of chromatin and reversal of cross-links
-
a.Add 150 μL of the 1× ChIP elution buffer to the 5% input sample tube from step 7, and set aside at room temperature until step 25 g.
-
b.Add 150 μL 1× ChIP elution buffer to each IP sample and resuspend.
-
c.Elute chromatin from the antibody/protein G magnetic beads for 30 min at 65°C with gentle vortexing (1,200 rpm).
-
d.Centrifuge at 10,000 g for 10 s to remove condensed sample from cap.
-
e.Pellet protein G magnetic beads by placing the tubes in a magnetic stand, wait 1 min for the solution to clear.
-
f.Carefully transfer eluted chromatin supernatant to a new tube with screw cap.Optional: Save 10 μL aliquot of each sample verifying target of interest by immunoblot.
CRITICAL: We highly recommend using tubes with screw cap for overnight reverse-crosslinking, which preserve all the samples and avoid sample loss due to evaporation. -
g.To all samples, including the “5% input” sample from step 21a, add 6 μL 5 M NaCl and 2 μL of 20 mg/mL proteinase K, and reverse cross-links by incubating at 65°C overnight.
-
a.
DNA purification and ChIP-qPCR analysis
Timing: Day 5, 4–5 h
Reverse-crosslinked ChIP samples are purified with a PCR purification kit. qPCR is used to evaluate the signal enrichment.
-
26.
Centrifuge at 10,000 g for 10 s to remove condensed sample from cap.
-
27.
Purify and collect DNA in 50 μL of elution buffer with a PCR purification kit, following manufacturer’s instructions (same as step 10).
Pause point: The eluted DNA products can be stored at 20°C or used right away for qPCR analysis.
-
28.
Dilute eluted DNA 2× with nuclease free water and use 2 μL as template per qPCR reaction (Troubleshooting 3 and 4).
-
29.
Set up PCR reaction master mix as follow. Run qPCR to evaluate the signal enrichment. Make sure to include positive and negative control primers.
PCR reaction master mix
| Reagent | Amount |
|---|---|
| DNA template | 2 μL (2× diluted) |
| 2× SYBR mix | 7.5 μL |
| Forward primer (10 μM) | 1 μL |
| Reverse primer (10 μM) | 1 μL |
| ddH2O | 3.5 μL |
| Total | 15 μL |
PCR cycling conditions
| Steps | Temperature | Time | Cycles |
|---|---|---|---|
| UDG pre-treatment | 50°C | 2 min | |
| Initial Denaturation | 95°C | 2 min | 1 |
| Denaturation | 95°C | 15 s | 40 cycles |
| Annealing | 60°C | 15 s | |
| Extension | 72°C | 1 min | |
| Final extension | 72°C | 10 min | 1 |
| Hold | 4°C | forever | |
Expected outcomes
Though we do not show ChIP-seq or ChIP-qPCR results in this protocol, examples of ChIP outcomes is shown in Akl et al.1 In this study, mouse liver nuclei was isolated, and chromatin was purified using the method described in this protocol. Enrichment of transcription factor NRF1 or NRF2 protein following anti-NRF1 or anti-NRF2 ChIP was confirmed by immunoblot (example shown in Figure 4B of Akl et al.1). ChIP-qPCR result shows NRF1 binds loci in genes Psma1 and Psmc2, while NRF2 binds loci in genes Ces1g and Gstm1 (example shown in Figure 4E of Akl et al.1). Moreover, ChIP-seq was used to investigate genome-wide binding sites, the results of which as well as methods used for library construction and sequencing and location of corresponding sequence data are described in Akl et al.1
Limitations
Although this protocol has been successfully applied for analysis of ChIP samples from mouse liver tissue, it has not been tested for other tissues. We recommend pilot tests and optimization for each step should be considered when applying this protocol for other types of specimens. Also, the success of ChIP relies on the specificity and sensitivity of the antibody. We highly recommend using ChIP-Grade quality antibodies, if they are available.
Troubleshooting
Problem 1
Low DNA yield (difficult to be visible by electrophoresis from step 11 or very low reading of NanoDrop from step 12)
Potential solution
Crosslinked samples will not completely dissolve in DNAzol reagent. Therefore, it is crucial to maintain all soluble and insoluble sample after step 3b, and do not centrifuge the sample at this step, and proceed to step 3c directly. Yield of DNA will significantly be decreased if only use the soluble portion.
Low DNA yields can also be caused by insufficient samples, especially when working with liver tissue that contains large amount of lipids (for example, livers collected from mice that have been fed high fat diet). To increase the DNA yield, more liver sample can be collected at step 2a.
Problem 2
Inconsistent shearing of DNA (Step 5).
Potential solution
The effect of shearing varies depending on sample type, crosslinking conditions and sonicator under use.4,5 When shearing the chromatin, it is important to follow the recommendations from manufacturer and optimize accordingly. For example, the Bioruptor Pico recommends not to exceed the maximum volume in the tube (related to step 4). We noticed that overfilling the tube (exceed the maximum limit of volume) reduce the efficiency of sonication. It is also important to ensure sample holder is spinning when sonication cycle starts, otherwise the sonication will not be efficient and consistent.
We recommend optimizing sonication conditions when using a probe sonicator (such as CPX130 from Cole-Parmer instruments), for example, by testing a time course with a starting output of 50%. For duration of sonication, a series of short pulses is more efficient than a single long pulse,6 which also produce less heat during sonication.
Problem 3
High background noise of ChIP-qPCR (Step 25).
Potential solution
High specificity and sensitivity of antibody is key to success of ChIP experiments. Using a ChIP-Grade quality antibody will reduce background noise and improve signal to noise ratio (step 16). Increase the time and repetition of washing steps. Alternatively, beads can be washed with more stringent buffer (e.g., IP buffer contains 400 μM sodium chloride) and prolong washing time to further remove non-specific binding (step 20).
Problem 4
Low ChIP signal (Step 25).
Potential solution
Low ChIP signal, or enrichment of positive control region is not different than IgG negative control, can result for multiple reasons. Potential solutions are as follows.
-
•
Conducting a pilot experiment including a positive control ChIP using ChIP-grade antibody against a protein that strongly binds to chromatin, such as anti-histone 3.
-
•
Take aliquots at step 3, 7 and 21 and determine the enrichment of target of interest at each step by western blotting. If less protein is enriched after chromatin immunoprecipitation, increase the amount of antibody used or try different antibody.
-
•
Less stringent washes may be used, but care need to be taken that this will also increase the background noise.
-
•
It is possible that target of interest may interact with DNA transiently and cannot be efficiently detected by ChIP,7 or the formaldehyde crosslinking method may not be sufficient for target of interest. For hyper-dynamic transcription factors, combination of protein-protein fixation followed by protein-DNA fixation can be used.8,9
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Scott B. Widenmaier (scott.widenmaier@usask.ca).
Technical contact
Further information regarding specific details of the steps for this protocol should be directed to and will be fulfilled by the technical contact, Lei Li (lei.li@usask.ca).
Materials availability
This study did not generate any unique reagents or datasets.
Data and code availability
The ChIP-Seq data generated using this protocol has been published1 and is available at the National Center for Biotechnology Information repository (NCBI; BioProject ID: PRJNA806849).
Acknowledgments
We thank Austin Hammond as well as Mohan Babu and colleagues for experimental assistance with ChIP-seq and associated analysis. This work was supported by a Saskatchewan Health Research Foundation Establishment grant and Canadian Institutes of Health Research Project grant. The graphical abstract was created with Biorender.com.
Author contributions
L.L. optimized the protocol and wrote the original manuscript. M.G.A. contributed to optimizing and collecting mouse liver sample. S.B.W. conceived the approach for the protocol, contributed to optimizing and collecting mouse liver sample, edited the manuscript, and supervised the project.
Declaration of interests
The authors declare no competing interests.
References
- 1.Akl M.G., Li L., Baccetto R., Phanse S., Zhang Q., Trites M.J., McDonald S., Aoki H., Babu M., Widenmaier S.B. Complementary gene regulation by NRF1 and NRF2 protects against hepatic cholesterol overload. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.112399. [DOI] [PubMed] [Google Scholar]
- 2.Qin H., Wang Y. Exploring DNA-binding proteins with in vivo chemical cross-linking and mass spectrometry. J. Proteome Res. 2009;8:1983–1991. doi: 10.1021/pr8009319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Chomczynski P., Mackey K., Drews R., Wilfinger W. DNAzol: a reagent for the rapid isolation of genomic DNA. Biotechniques. 1997;22:550–553. doi: 10.2144/97223pf01. [DOI] [PubMed] [Google Scholar]
- 4.Sullivan A.E., Santos S.D.M. An Optimized Protocol for ChIP-Seq from Human Embryonic Stem Cell Cultures. STAR Protoc. 2020;1 doi: 10.1016/j.xpro.2020.100062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.de Jonge W.J., Brok M., Kemmeren P., Holstege F.C.P. An Optimized Chromatin Immunoprecipitation Protocol for Quantification of Protein-DNA Interactions. STAR Protoc. 2020;1 doi: 10.1016/j.xpro.2020.100020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Nelson J.D., Denisenko O., Bomsztyk K. Protocol for the fast chromatin immunoprecipitation (ChIP) method. Nat. Protoc. 2006;1:179–185. doi: 10.1038/nprot.2006.27. [DOI] [PubMed] [Google Scholar]
- 7.Schmiedeberg L., Skene P., Deaton A., Bird A. A temporal threshold for formaldehyde crosslinking and fixation. PLoS One. 2009;4 doi: 10.1371/journal.pone.0004636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kurdistani S.K., Grunstein M. In vivo protein-protein and protein-DNA crosslinking for genomewide binding microarray. Methods. 2003;31:90–95. doi: 10.1016/s1046-2023(03)00092-6. [DOI] [PubMed] [Google Scholar]
- 9.Tian B., Yang J., Brasier A.R. Two-step cross-linking for analysis of protein-chromatin interactions. Methods Mol. Biol. 2012;809:105–120. doi: 10.1007/978-1-61779-376-9_7. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The ChIP-Seq data generated using this protocol has been published1 and is available at the National Center for Biotechnology Information repository (NCBI; BioProject ID: PRJNA806849).


Timing: 2–3 h