| species | gene | direction | sequence |
|---|---|---|---|
| human | RPL10 | forward | TGGCTGTGGGGTCAAGTACA |
| human | RPL10 | reverse | GTCCAGAGGGCCACGATTG |
| human | SVB2 | forward | AGCGAGTCCTCAGCATGTCT |
| human | SVB2 | reverse | GCAAAAACAATCGGTAGAGCACC |
| human | SYT1 | forward | GCTGCTGGTAGGGATCATTCA |
| human | SYT1 | reverse | GTTTTTCGGTGGACTTTTGTCTC |
| mouse | Rpl10 | forward | CGTGGTGTCCCTGATGCTAAG |
| mouse | Rpl10 | reverse | GTTGGCACAAATACGGGCAG |
| mouse | Srebf2 | forward | GCAGCAACGGGACCATTCT |
| mouse | Srebf2 | reverse | CCCCATGACTAAGTCCTTCAACT |
| mouse | Nrxn1 | forward | AACGGACTGATGCTTCACACA |
| mouse | Nrxn1 | reverse | GATATTGTCACCTGACGCAGATT |
| mouse | Nlgn1 | forward | CGGTGCCCCATTGACTCTC |
| mouse | Nlgn1 | reverse | GCTGGAAACGATGTTCTCCTG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.