Skip to main content
PeerJ logoLink to PeerJ
. 2025 Feb 17;13:e18942. doi: 10.7717/peerj.18942

Caffeic acid phenethyl ester inhibits multispecies biofilm formation and cariogenicity

Paopanga Kokilakanit 1, Nonthakorn Dungkhuntod 1, Nitchadakorn Serikul 1, Sittichai Koontongkaew 2, Kusumawadee Utispan 1,
Editor: Amjad Abu Hasna
PMCID: PMC11841590  PMID: 39981044

Abstract

Background

Caffeic acid phenethyl ester (CAPE), a natural phenolic compound, has demonstrated antibacterial effects. Dental caries etiology is multifactorial, including a cariogenic biofilm containing multispecies bacteria. However, the antibacterial property of CAPE on multispecies biofilm is unclear. The aim of this study was to assess the effect of CAPE on the formation and cariogenicity in biofilm containing Streptococcus mutans, Streptococcus oralis, and Streptococcus mitis.

Methods

S. mutans (ATCC 25175), S. oralis (ATCC 35037), and S. mitis (ATCC 49456T) were employed in this investigation. Each bacterial strain was cultured in the presence of CAPE, followed by susceptibility assessment through optical density measurements at a 600 nm wavelength. Multispecies biofilm formation was achieved by co-culturing S. mutans, S. oralis, and S. mitis at a 1:1:1 ratio on hydroxyapatite-coated 96-well plates. The anti-adherence activity of CAPE on multispecies biofilm was evaluated using a crystal violet staining assay. Cariogenic gene expression level and glucosyltransferase (GTF) function in CAPE-treated mixed bacteria were evaluated using real-time PCR and enzyme activity assay, respectively. The thickness and bacterial viability in CAPE-treated multispecies biofilm were examined using confocal laser scanning microscopy.

Results

CAPE demonstrated a significant antimicrobial effect on S. mutans, S. oralis, and S. mitis (p < 0.05). The inhibition concentration 50% (IC50) of CAPE against S. mutans, S. oralis, and S. mitis ranged from 1.6–6.4 mg/ml. CAPE significantly hindered the multispecies biofilm adherence (p < 0.05). Furthermore, the expression of genes involved in acidogenicity, aciduricity, sucrose-dependent adhesion and quorum sensing mechanism and GTF activity were significantly decreased in CAPE-treated mixed bacteria (p < 0.05). In a multispecies biofilm, CAPE significantly reduced its thickness and viable bacteria population (p < 0.05). In conclusion, CAPE exhibited antimicrobial, anti-adherence and anti-cariogenic effects within a multispecies biofilm. These findings suggest the potential use of CAPE as an adjunctive anti-cariogenic agent in future dental applications.

Keywords: Caffeic acid phenethyl ester, Multispecies biofilm, Cariogenicity, Cariogenic bacteria

Introduction

Dental caries is a biofilm-mediated, diet modulated, non-communicable, multifactorial dynamic disease, which impacts the net mineral loss of the tooth (Machiulskiene et al., 2020). Dental biofilm is composed of multispecies commensal bacteria that forms on the enamel surface. The biofilm environment changes when acid increases due to sugar fermentation in bacteria (Marsh, 1991). The normal flora in dental biofilm ferments the sugar and generates acid as a by-product. The acidic biofilm promotes the growth of cariogenic bacteria, especially Streptococcus mutans, Lactobacillus spp., and low pH non-mutans streptococci, such as S. mitis and S. oralis (Marsh, 1991; Takahashi & Nyvad, 2008). The ecological change in dental biofilm increases enamel demineralization (Marsh, 1991).

The cariogenic bacteria generate dental caries due to their acidogenicity, aciduricity, sucrose-dependent adhesion activity and quorum sensing-based adaptation mechanism (You, 2019). In an acidogenic biofilm, lactic acid is a product of lactate dehydrogenase (LDH) activity in the bacterial fermentation process (Duguid, 1985). The cariogenic bacteria contain an acid tolerance mechanism in response to a low pH environment (aciduricity). Up-regulation of brpA gene expression in S. mutans maintains membrane integrity and tolerance to acidic conditions (Lemos & Burne, 2008; Wen, Baker & Burne, 2006). S. mutans utilizes glucosyltransferases to catalyze sucrose into water-insoluble glucan to prolong biofilm adhesion on the tooth surface (Bowen & Koo, 2011). Moreover, the genes encoding glucan-binding proteins (gbps; gbpA, gbpB, and gbpC) (Banas & Vickerman, 2003) and bacterial surface antigen (spaP) participate in biofilm attachment (Yang et al., 2019). Quorum sensing, cellular metabolism, DNA repair, and stress tolerance in S. mutans are regulated by luxS-based signaling (Wen et al., 2011; Yoshida et al., 2005).

Natural compounds are considered as an adjunctive anti-plaque agent with good biocompatibility and less bacterial resistance (Jeon et al., 2011; Utispan et al., 2017). Natural products exhibit a wide range of biological activities, such as anti-microbial and anti-biofilm effects, which may useful for caries preventive agent development (Jeon et al., 2011). However, matrix production and tight adhesion of dental biofilm may reduce the effect of natural product application (Koo et al., 2002a). Caffeic acid phenethyl ester (CAPE), a common active compound extracted from propolis, has demonstrated antibacterial, anti-inflammatory, antioxidant and anticancer effects (Niu et al., 2020; Olgierd et al., 2021; Yin et al., 2022). CAPE has been proposed to inhibit bacterial activity against Staphylococcus aureus and Escherichia coli by generating reactive oxygen species that damage the outer membrane of bacteria (Lee et al., 2013). CAPE inhibits the growth of cariogenic bacteria in the planktonic phase; S. mutans, S. sobrinus, Actinomyces viscosus, and L. acidophilus (Niu et al., 2020). Moreover, CAPE inhibited the formation of S. mutans biofilm and its key virulence factors involved in acid production, acid tolerance and adhesion (Niu et al., 2020). In addition, CAPE inhibited cross-kingdom biofilm formation of S. mutans and Candida albicans and was biocompatible with a human oral keratinocyte cell line (Yin et al., 2022). However, the effect of CAPE on multispecies biofilm formation and cariogenicity remains unclear. Based on previous studies, we hypothesized that CAPE might inhibit multispecies biofilm formation and cariogenicity. Thus, the aim of this study was to evaluate the effect of CAPE on the formation and cariogenicity in a multispecies biofilm containing Streptococcus mutans, Streptococcus oralis, and Streptococcus mitis.

Materials and Methods

This study was an experimental in vitro study. A multispecies cariogenic biofilm comprising S. mutans, S. mitis and S. oralis was established. The effects of CAPE on multispecies biofilm adhesion, cariogenicity, cariogenic gene expression and biofilm viability and thickness were evaluated.

Bacterial culture

S. mutans (ATCC 25175), S. oralis (ATCC 35037) and S. mitis (ATCC 49456T) were used in this study. Mitis salivarius bacitracin agar (HiMedia Technology, Shenzhen, China) was used as the selective media for S. mutans and mitis salivarius agar (HiMedia Technology, China) served as the selective media for S. oralis and S. mitis. The bacteria were separately or co-inoculated in brain heart infusion broth (BHI, Becton, Dickinson, Franklin Lakes, NJ, USA) overnight at 37 °C under aerobic conditions with 5% CO2 before performing the experiments.

Bacterial susceptibility test

Bacteria were maintained in BHI broth overnight, and the bacterial number was assessed at an optical density (OD) of 600 nm. The bacterial suspension of S. mutans, S. oralis or S. mitis was adjusted to 2 × 107 CFU/ml and transferred to a 96-well plate (100 µl/well). CAPE was purchased from Sigma-Aldrich (St. Louis, MO, USA). A stock solution of CAPE was prepared in 50% dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO, USA)-phosphate buffered saline (pH 7.4). To test bacterial susceptibility, CAPE at stock concentration was diluted in BHI media to final concentrations of 0.8, 1.6, 3.2 or 6.4 mg/ml in 5% DMSO in each well, based on a previous study (Niu et al., 2020). Bacteria cultured in BHI, 5% DMSO-BHI and 50 µg/ml chlorhexidine (CHX; Thermo Fisher Scientific, Waltham, MA USA) served as growth, solvent and positive controls, respectively. The plate was incubated at 37 °C for 48 h. The plate was measured for absorbance at 600 nm in a MULTISKAN Sky microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The OD 600 nm was converted to percent bacterial growth normalized to the solvent control. To determine the concentration of CAPE needed to inhibit bacterial growth by 50%, the 50% inhibitory concentration (IC50) of CAPE against the bacteria was analyzed. The IC50 was calculated from the concentration-response curve. Three independent experiments were performed.

Multispecies biofilm formation study

Dental biofilm forms on the hydroxyapatite (HA)-containing enamel surface. To mimic the dental surface for biofilm adhesion, HA-coated plates were prepared by modifying the protocol in a previous study (Schilling et al., 1994). Briefly, a calcifying solution containing 2.5 mM CaCl2·2H2O, 7.5 mM KH2PO4 and 250.0 mM triethanolamine at pH 7.4 was prepared and placed in 96-well microplates (Corning, Oneonta, NY, USA). The plates were incubated at 75 °C for 3.5 h for two cycles. The plates were dried at room temperature and sterilized with ethylene oxide. Bovine serum albumin (1%) in phosphate buffer was added in the HA-coated microplates and incubated for 1 h at 37 °C.

The multispecies bacteria comprising S. mitis, S. oralis and S. mutans was mixed at a 1:1:1 ratio in BHI broth supplemented with 1% sucrose and placed in the HA-coated wells. CAPE dilutions were added to each well at final concentrations of 0.8, 1.6 and 3.2 mg/ml. Bacteria grown in BHI, 5% DMSO-BHI and 50 µg/ml CHX served as growth, solvent and positive controls, respectively. The plate was incubated at 37 °C for 48 h. Non-adherent bacteria were washed out with phosphate buffered saline. Multispecies biofilm adhered on HA-coated wells was fixed with absolute methanol for 15 min and stained with 0.1% crystal violet for 5 min. The stained biofilm was solubilized with 33% glacial acetic acid. The OD at 592 nm was determined using a microplate reader. Biofilm formation was reported as a percentage normalized to the solvent control. Three independent experiments were conducted.

Total RNA extraction and cDNA synthesis

S. mitis, S. oralis and S. mutans co-culture was performed at a 1:1:1 ratio in BHI broth supplemented with 1% sucrose. The bacterial co-culture was treated with 1.6 mg/ml CAPE at 37 °C for 24 h. Bacteria treated with 5% DMSO served as the solvent control. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA concentration and purity were determined by a NanoDrop 2000 (Thermo Fisher, Waltham, MA, USA) with a 260/280 ratio in a range of 1.8–1.9. Total RNA (500 ng) was used to synthesize cDNA using a PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). The total volume of the reverse transcription (RT) mixture was 10 µl: total RNA, 6.5 µl; 5× primer Script Buffer, 2 µl; PrimeScript RT Enzyme Mix, 0.5 µl; Oligo dT Primer, 0.5 µl; and Random 6 mers, 0.5 µl. The RT conditions were: RT at 37 °C for 15 min, inactivation of reverse transcriptase at 85 °C for 5 s and hold at 4 °C. The cDNA was stored at −20 °C until use.

Real-time quantitative PCR (qPCR)

The PCR primers used in this study were from a previous study (Wen et al., 2010) (Table 1). 16s rRNA gene was used as an internal control (Thanetchaloempong, Koontongkaew & Utispan, 2022). To test the specificity of the primers, SYBR green based real time PCR was performed in the QuantStudio™ 3 Real‑Time PCR System (Thermo Fisher Scientific, Waltham, MA USA). The specific real time PCR condition was selected when the specific melting curve of the PCR product resulted in the tested primer group, while a disappearing melting curve/ cycle threshold (CT) was detected in the non-template control group.

Table 1. Primer sequences used for real-time PCR.

Primers Forward primers (5′-3′) Reverse primers (5′-3′) Size (bp)
gtfB AGCAATGCAGCCATCTACAAAT ACGAACTTTGCCGTTATTGTCA 98
ldh TTGGCGACGCTCTTGATCTTAG GTCAGCATCCGCACAGTCTTC 92
brpA CGTGAGGTCATCAGCAAGGTC CGCTGTACCCCAAAAGTTTAGG 148
spaP TCCGCTTATACAGGTCAAGTTG GAGAAGCTACTGATAGAAGGGC 121
luxS ACTGTTCCCCTTTTGGCTGTC AACTTGCTTTGATGACTGTGGC 93
gbpB CGTGTTTCGGCTATTCGTGAAG TGCTGCTTGATTTTCTTGTTGC 108
16S rRNA TCCACGCCGTAAACGATGA TTGTGCGGCCCCCGT 119

Real-time qPCR was performed using a KAPA SYBR® FAST qPCR Kit Master Mix (Kapa Biosystems, Wilmington, MA, USA). The total volume of the qPCR system was 20 µl: cDNA (10 ng/µl), 2 µl; sense/antisense primer (10 µM each), 0.4 µl each; SYBR Green Master Mix (Kapa Biosystems, Wilmington, MA, USA), 10 µl; and ddH2O, 7.2 µl. qPCR was performed in a two-step method in the QuantStudio™ 3 Real‑Time PCR System (Thermo Fisher Scientific, Waltham, MA USA). The qPCR conditions were: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 60 s. The melting curve analysis was performed at the end of the amplification from 60 °C to 95 °C and with a hold of 1 s every 0.16 °C. The original CT values of all genes were obtained from QuantStudio™ Design & Analysis Software (Thermo Fisher Scientific, Waltham, MA USA). The relative gene expression was evaluated by the difference in cycle threshold (ΔCT) between the CAPE-treated multispecies bacteria and the solvent control using the 2−ΔΔCT equation [ΔCT = CT (CAPE treatment) − CT (solvent control)] (Rao et al., 2013). Three independent experiments were conducted.

Glucosyltransferase activity assay

Multispecies or monospecies bacteria-derived glucosyltransferase (GTF) was prepared by modifying the protocol from a previous study (Linzer & Slade, 1976). Briefly, single bacteria (1 × 108 CFU/ml) or mixed S. mitis, S. oralis and S. mutans (1:1:1 ratio) were cultured in sucrose-free tryptic soy broth at 37 °C for 48 h. The cultured suspension was centrifuged at 10,000 × g for 30 min, and the supernatant was collected. Crude GTF was precipitated with 45% ammonium sulphate at 4 °C for 48 h. The precipitated enzyme was dissolved in 15 ml phosphate buffer, pH 7.4 and dialyzed for 4 days at 4 °C against 0.05 M phosphate buffer, pH 6.8 (4 L). The buffer was changed every 24 h. The dialyzed enzyme was lyophilized for 48 h. The enzyme powders were dissolved in 0.05 M phosphate buffer, pH 7.4. The protein concentration was determined using a PierceTM BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA USA) according to the manufacturer’s directions. The enzyme was kept at 80 °C and diluted in phosphate buffer to 200 mg/ml prior to use.

To determine GTF activity, 50 µl of the enzyme (200 mg/ml), was mixed with CAPE at final concentrations of 0.8, 1.6 and 3.2 mg/ml in sucrose (30 µmole) containing 0.6 M acetate buffer pH 5.5 to a final volume of 300 µl. The buffer without CAPE was used as control. The reaction mixture was incubated at 37 °C for 3 h and further heated at 100 °C for 5 min. The enzyme was heated to 100 °C for 5 min. The glucans produced from GTF activity were precipitated by centrifugation at 20,000 × g for 6 min. The glucans were collected by treating them with a 5% phenol-containing sulphuric acid solution, heated to 110 °C for 5 min and cooled to room temperature. Glucan production was measured via the OD at 490 nm in a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The GTF activity was expressed as the percentage of glucan production compared with the control group using the formula [(OD treatment − OD blank)/(OD control − OD blank)] × 100. Three independent experiments were conducted.

Confocal laser scanning microscopy

HA-coated surfaces were formed in eight-well chamber glass slides (SPL Lifesciences Co. Ltd, Gyeonggi-do, Korea) as previously described. The multispecies bacteria comprising S. mitis, S. oralis and S. mutans (1:1:1 ratio) were co-cultured in BHI supplemented with 1% sucrose in the HA-coated slides and incubated at 37 °C for 24 h. Non-adherent bacteria were removed from the well and washed with phosphate buffer. CAPE (0.8 and 1.6 mg/ml) was added in each well and incubated at 37 °C for 24 h. The biofilm in 5% DMSO-BHI and 50 µg/ml CHX served as solvent and positive controls, respectively. The biofilm was stained using the Live/Dead BacLight Bacterial Viability kit (Invitrogen Molecular Probes, Carlsbad, CA, USA). Live and dead bacteria were visualized as green and red signals, respectively, using a confocal laser scanning microscope (CLSM) (FLUOVIEW FV3000 Olympus, Tokyo, Japan). To analyze the bacterial viability within the biofilm and total biofilm thickness, the Z-stack images of the stained biofilm were obtained using the cellSens Dimension software (Olympus, Tokyo, Japan). Three independent experiments were conducted.

Statistical analysis

The data are quantitative and presented as the means and standard error of the mean (SEM). The unpaired t-test was performed to compare the gene expression level between the solvent control and the CAPE-treated group. For multiple group comparison of percent bacterial growth, percent GTF activity, live/dead bacterial ratio and biofilm thickness, one-way ANOVA was applied, followed by Dunnett’s post hoc test using Prism GraphPad 8.0 (GraphPad Software, La Jolla, CA, USA). Significance was determined at p ≤ 0.05.

Results

Antibacterial effect of CAPE

To confirm the antibacterial effect of CAPE, the cytotoxic effect of the CAPE solvent (5% DMSO) was evaluated on S. mitis, S. oralis and S. mutans. The solvent control maintained bacterial growth similar to the control group (p > 0.05), thus, it was non-toxic to the tested bacteria (Fig. 1). Therefore, the solvent control was used to compare the CAPE effects in subsequent experiments. CAPE at 0.8, 1.6, 3.2 and 6.4 mg/ml exhibited a significant antibacterial effect on S. mitis (Fig. 1A) and S. mutans (Fig. 1C) compared with the solvent control (p < 0.05). CAPE at 1.6, 3.2 and 6.4 mg/ml significantly decreased the percent bacterial growth in S. oralis compared with the solvent control (p < 0.05) (Fig. 1B). The 50% inhibitory concentration (IC50) value of CAPE was also calculated. The IC50 of CAPE (mean ± SEM) against S. mitis, S. oralis and S. mutans was 0.87 ± 0.02, 1.39 ± 0.09 and 1.66 ± 0.14 mg/ml, respectively. Based on the IC50 data, S. mutans had the highest resistance to CAPE among the tested bacteria.

Figure 1. Antibacterial effect of CAPE.

Figure 1

Effect of CAPE (0.8−6.4 mg/ml) on planktonic growth of (A) S. mitis, (B) S. oralis and (C) S. mutans. Bacteria cultured in media without CAPE was used as growth control. Bacteria cultured in media with 5% DMSO was used as solvent control. Chlorhexidine (CHX) at 50 µg/ml was used as positive control. Bars represent the mean ± SEM of the percent bacterial growth (n = 3). *p < 0.05 compared with solvent control.

CAPE affected adhesion and cariogenic gene expression in the multispecies biofilm

A multispecies biofilm comprised of S. mitis, S. oralis and S. mutans (1:1:1) was established. The effect of CAPE on the adhesion and gene expression of virulence factors in the multispecies biofilm were investigated. The results demonstrated that 0.8, 1.6 and 3.2 mg/ml CAPE significantly reduced multispecies biofilm formation by 0.5–70% compared with the solvent control (p < 0.05) (Fig. 2A). Moreover, 1.6 mg/ml CAPE significantly decreased gene expression involved in sucrose-dependent adhesion (gtfB and gbpB), acidogenicity (ldh), aciduricity (brpA) and quorum sensing (luxS) in multispecies biofilm compared with the solvent control (p < 0.05) (Fig. 2B). However, there was no significant difference in sucrose-independent adhesion (spaP) gene expression in the multispecies biofilm between the CAPE treatment and solvent control group (p > 0.05).

Figure 2. Effect of CAPE on multispecies biofilm formation and cariogenic gene expression.

Figure 2

CAPE (0.8–3.2 mg/ml) was used to treat the multispecies biofilm comprising S. mitis, S. oralis and S. mutans (1:1:1) for 48 h. Multispecies biofilm in media without CAPE was used as growth control. Multispecies biofilm in media with 5% DMSO was used as solvent control. Chlorhexidine (CHX) at 50 µg/ml was used as positive control. (A) Multispecies biofilm adhesion was evaluated using crystal violet staining. The multispecies bacteria were treated with 1.6 mg/ml CAPE for 24 h. (B) Cariogenic gene expression in the multispecies biofilm was evaluated using real time PCR. Bars represent the mean ± SEM of the percent multispecies biofilm formation or gene expression level (n = 3). *p < 0.05 compared with the solvent control.

CAPE reduced GTF activity in monospecies and multispecies bacterial cultures

The intrinsic GTF activity in monospecies and multispecies bacterial cultures is presented in Table 2. S. oralis and S. mutans expressed relatively high GTF activity compared with that of S. mitis. Moreover, the maximum GTF activity was found in the multispecies bacterial culture model. Therefore, the changes in GTF activity after CAPE treatment in the monoculture of S. oralis and S. mutans and multisspecies co-culture comprising S. mitis, S. oralis and S. mutans were evaluated. The results indicated that 0.8 and 1.6 mg/ml CAPE significantly decreased GTF activity in S. oralis compared with control (p < 0.05) (Fig. 3A). However, 3.2 mg/ml CAPE did not significantly change GTF activity in S. oralis. Interestingly, CAPE at all tested concentrations significantly inhibited GTF activity in S. mutans to approximately 48% compared with control (p < 0.05) (Fig. 3B). In addition, CAPE significantly reduced GTF activity in the multispecies co-culture system in a dose-dependent manner compared with control (p < 0.05) (Fig. 3C).

Table 2. Glucosyltransferase activity in monospecies and multispecies bacterial cultures.

Bacteria Baseline GTF activity measured at OD 490 nm (mean ± SEM)
S. mitis 0.03 ± 0.03
S. oralis 1.44 ± 0.17
S. mutans 0.70 ± 0.08
Multispecies 1.67 ± 0.08

Figure 3. Effect of CAPE on GTF activity.

Figure 3

Single species or multispecies bacteria (S. mitis, S. oralis and S. mutans) was cultured and the GTF enzyme was collected. CAPE (0.8−3.2 mg/ml) was added in the enzyme reaction mixture. GTF reaction without CAPE was used as control. GTF activity was determined in monoculture of (A) S. oralis and (B) S. mutans and (C) co-culture of multispecies bacteria. Bars represent the mean ± SEM of percent GTF activity (n = 3). *p < 0.05 compared with control.

Bactericidal penetrative effect of CAPE in multispecies biofilm

The bactericidal penetrative effect of 0.8 and 1.6 mg/ml CAPE was assessed in the multispecies biofilm using CLSM. Z-stack images displayed the bactericidal depth of CAPE from the outermost into innermost layers of the multispecies biofilm (Fig. 4A). We found that 0.8 and 1.6 mg/ml CAPE significantly decreased the live/dead bacterial ratio in the multispecies biofilm compared with the solvent control (p < 0.05) (Fig. 4B).

Figure 4. Bactericidal penetrative effect of CAPE on multispecies biofilm.

Figure 4

CAPE (0.8 and 1.6 mg/ml) was used to treat the multispecies biofilm that comprised S. mitis, S. oralis and S. mutans (1:1:1). Multispecies biofilm in media with 5% DMSO was used as solvent control. Chlorhexidine (CHX) at 50 µg/ml served as positive control. (A) Confocal laser scanning microscopy displayed live (green) and dead (red) bacteria in each layer of multispecies biofilm. (B) Ratio of live/dead bacteria in the CAPE-treated multispecies biofilm was calculated and compared with solvent control. Bars represent the mean ± SEM of live/dead bacterial ratio in multispecies biofilm (n = 3). *p < 0.05 compared with solvent control.

Effect of CAPE on the reduction of the multispecies biofilm thickness

The thickness of the 0.8 and 1.6 mg/ml CAPE-treated multispecies biofilm was evaluated using CLSM. The confocal images exhibited 3D structures with live/dead bacteria in the multispecies biofilm at all conditions (Fig. 5A). Measurement of the multispecies biofilm structure indicated that 1.6 mg/ml CAPE significantly reduced the biofilm thickness compared with the solvent control (p < 0.05) (Fig. 5B).

Figure 5. Effect of CAPE on the reduction of multispecies biofilm thickness.

Figure 5

CAPE (0.8 and 1.6 mg/ml) was used to treat multispecies biofilm that comprised S. mitis, S. oralis and S. mutans (1:1:1). Multispecies biofilm in media with 5% DMSO was used as solvent control. Chlorhexidine (CHX) at 50 µg/ml served as positive control. (A) Confocal 3D imaging displayed structures with live (green)/dead (red) bacteria in multispecies biofilm. (B) The multispecies biofilm thickness was calculated in micrometers (µm) and compared with solvent control. Bars represent the mean ± SEM of biofilm thickness (n = 3). *p < 0.05 compared with solvent control.

Discussion

CAPE is a common bioactive compound detected in propolis extract and has anti-cariogenic effects on oral bacteria and S. mutans biofilm (Niu et al., 2020; Yin et al., 2022). The present study created a multispecies cariogenic biofilm model composed of S. mitis, S. oralis and S. mutans. The results demonstrated that CAPE inhibited the multispecies biofilm formation, reduced cariogenicity, cariogenic gene expression and biofilm viability and thickness. In the planktonic bacterial susceptibility assay, CAPE exhibited anti-bacterial activity against S. mutans at IC50 1.66 ± 0.14 mg/ml, which is consistent with previous studies (Niu et al., 2020; Yin et al., 2022). Moreover, the present study is the first to report the anti-bacterial property of CAPE against S. mitis and S. oralis. Based on their IC50 values, S. mitis and S. oralis had higher susceptibility to CAPE compared with that of S. mutans. However, there was no direct evidence that explained the anti-microbial effect of CAPE on S. mitis, S. oralis and S. mutans. The anti-microbial property of propolis was studied in a wide range of oral bacteria (Navarro-Perez et al., 2021) and might be indirectly used to compare with our data. This previous evidence indicated that propolis extracts had a lower bactericidal effect on S. mutans compared with other oral bacteria. The present study might confirm the high CAPE resistance in S. mutans found in the prior study.

The multispecies biofilms have an effective response to environmental change. This synergistic function of multispecies biofilm improves its ability to respond to that change compared with that of monospecies by effectively reducing the metabolic products in the biofilm (Ouidir, Gabriel & Nait Chabane, 2022). Cariogenic biofilm containing S. mutans (Niu et al., 2020) or cross-kingdom microbes (S. mutans and C. albicans) (Yin et al., 2022) were used as the model to demonstrate the CAPE effect on the monospecies and dualspecies biofilm, respectively. They found that 0.04 mg/ml and 20 µg/ml CAPE significantly inhibited monospecies and cross-kingdom, respectively, biofilm formation. Using the multispecies cariogenic biofilm model, we found that 0.8 mg/ml CAPE significantly decreased biofilm formation. Our data imply that the multispecies biofilm exhibited higher CAPE resistance than that of single or cross-kingdom biofilm.

Cariogenic bacteria, such as S. mutans, lactobacilli or low pH non-mutans streptococci, synergistically respond to environmental changes in the biofilm (Marsh, 1991; Takahashi & Yamada, 1999). To survive in the stress environment biofilm, the cariogenic bacteria express acidogenicity (Duguid, 1985), aciduricity (Lemos & Burne, 2008), adhesion (Banas & Vickerman, 2003; Bowen & Koo, 2011; Yang et al., 2019) and adaptation (Wen et al., 2011; Yoshida et al., 2005) through the effective function of several genes and corresponding proteins. This study demonstrated that CAPE attenuated the cariogenic-associated gene expression levels of ldh (acidogenicity), brpA (aciduricity), gtfB and gbpB (sucrose-dependent adhesion) and luxS (quorum sensing-related signaling pathway) in the multispecies biofilm. However, CAPE did not affect the gene expression of spaP. In absence of sucrose, S. mutans directly binds to the tooth surface using spaP (Bowen et al., 1991). When sucrose is present, GTF, a key enzyme found in S. mutans and S. oralis, catalyzes sucrose into glucans (Bowen & Koo, 2011; Fujiwara et al., 2000). Glucans bind to glucan-binding proteins to create bacterial co-aggregation within the biofilm (Banas & Vickerman, 2003). In this study, 1% sucrose was supplemented in the culture media, therefore sucrose-associated adhesion molecules might be the target of CAPE. Our findings indicate the anti-cariogenic potential of CAPE on acidogenicity, acid tolerance, sucrose-dependent adhesion and quorum sensing mechanism in the multispecies biofilm.

Water-insoluble glucans are the most important molecules for biofilm adhesion and are targeted by several anti-cariogenic natural compounds (Koo et al., 2002b). In the present study, intrinsic GTF activity was detected in S. mutans and S. oralis and multispecies bacteria, but not in S. mitis. Low CAPE concentration significantly inhibited GTF function in the single and multispecies bacteria. Moreover, high CAPE concentration specifically decreased GTF activity in S. mutans and multispecies bacteria. The competitive growth of cariogenic bacteria is a critical phenomenon in a multispecies biofilm (Jakubovics, 2015). S. mutans exhibited bactericidal factors or modified its essential mechanisms to overcome the growth of other bacteria in a mixed species biofilm (Choi et al., 2023; Kreth et al., 2005). From the previous evidence, we hypothesize that S. mutans might be a major target of action of CAPE for inhibiting GTF in the multispecies biofilm. In mature biofilm formation, bacterial colonization and extracellular polysaccharide (EPS) are completely organized (Bowen & Koo, 2011). Complete EPS synthesis determines the protective structure and environmental niche in dental biofilm (Vu et al., 2009). EPS production is performed by GTF in a wide range of cariogenic bacteria (Bowen & Koo, 2011). This study demonstrated that CAPE inhibited GTF function, penetrated mature biofilm and significantly reduced live bacteria and biofilm thickness. These results suggest that decreased multispecies biofilm thickness and viable bacteria might be a consequence of CAPE-suppressed GTF activity.

Conclusions

The present study demonstrated that CAPE had anti-cariogenic effects on the multispecies biofilm formation. We found that CAPE suppressed cariogenic gene expression involved in acidogenicity, acid tolerance, sucrose-dependent adhesion and luxS-derived quorum sensing. Moreover, CAPE inhibited GTF functions and exerted penetrative bactericidal and biofilm thickness reduction. Our findings suggest that CAPE might be applied as an adjunctive agent in dental products for caries prevention. However, the role of CAPE in suppressing the specific bacteria and components in cariogenic multispecies biofilm requires further investigation.

Supplemental Information

Supplemental Information 1. Raw data of antibacterial test.
peerj-13-18942-s001.xlsx (20.4KB, xlsx)
DOI: 10.7717/peerj.18942/supp-1
Supplemental Information 2. Raw data of biofilm formation assay.
peerj-13-18942-s002.xlsx (11.8KB, xlsx)
DOI: 10.7717/peerj.18942/supp-2
Supplemental Information 3. Raw data of GTF activity assay.
peerj-13-18942-s003.xlsx (17.6KB, xlsx)
DOI: 10.7717/peerj.18942/supp-3
Supplemental Information 4. Raw data of real time PCR.
peerj-13-18942-s004.xlsx (17.3KB, xlsx)
DOI: 10.7717/peerj.18942/supp-4
Supplemental Information 5. Raw data of confocal analysis.
peerj-13-18942-s005.xlsx (13.5KB, xlsx)
DOI: 10.7717/peerj.18942/supp-5
Supplemental Information 6. Real-Time Quantitative PCR checklist.
peerj-13-18942-s006.xls (30.5KB, xls)
DOI: 10.7717/peerj.18942/supp-6

Acknowledgments

We thank Dr. Suppanut Jongjitaree, International College of Dentistry, Walailak University for preliminary information on CAPE.

Funding Statement

This work was supported by the Faculty of Dentistry Thammasat University Research Fund (No. 2/2566). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare that they have no competing interests.

Author Contributions

Paopanga Kokilakanit performed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Nonthakorn Dungkhuntod performed the experiments, prepared figures and/or tables, and approved the final draft.

Nitchadakorn Serikul performed the experiments, prepared figures and/or tables, and approved the final draft.

Sittichai Koontongkaew analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Kusumawadee Utispan conceived and designed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Data Availability

The following information was supplied regarding data availability:

The raw measurements and statistical analysis of all experiments are available in the Supplemental Files.

References

  • Banas & Vickerman (2003).Banas JA, Vickerman MM. Glucan-binding proteins of the oral streptococci. Critical Reviews in Oral Biology & Medicine. 2003;14(2):89–99. doi: 10.1177/154411130301400203. [DOI] [PubMed] [Google Scholar]
  • Bowen & Koo (2011).Bowen WH, Koo H. Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms. Caries Research. 2011;45(1):69–86. doi: 10.1159/000324598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Bowen et al. (1991).Bowen WH, Schilling K, Giertsen E, Pearson S, Lee SF, Bleiweis A, Beeman D. Role of a cell surface-associated protein in adherence and dental caries. Infection and Immunity. 1991;59(12):4606–4609. doi: 10.1128/iai.59.12.4606-4609.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Choi et al. (2023).Choi A, Dong K, Williams E, Pia L, Batagower J, Bending P, Shin I, Peters DI, Kaspar JR. Human saliva modifies growth, biofilm architecture and competitive behaviors of oral streptococci. 2023. BioRxiv. [DOI] [PMC free article] [PubMed]
  • Duguid (1985).Duguid R. In-vitro acid production by the oral bacterium Streptococcus mutans 10449 in various concentrations of glucose, fructose and sucrose. Archives of Oral Biology. 1985;30(4):319–324. doi: 10.1016/0003-9969(85)90004-4. [DOI] [PubMed] [Google Scholar]
  • Fujiwara et al. (2000).Fujiwara T, Hoshino T, Ooshima T, Sobue S, Hamada S. Purification, characterization, and molecular analysis of the gene encoding glucosyltransferase from Streptococcus oralis. Infection and Immunity. 2000;68(5):2475–2483. doi: 10.1128/IAI.68.5.2475-2483.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Jakubovics (2015).Jakubovics NS. Intermicrobial interactions as a driver for community composition and stratification of oral biofilms. Journal of Molecular Biology. 2015;427(23):3662–3675. doi: 10.1016/j.jmb.2015.09.022. [DOI] [PubMed] [Google Scholar]
  • Jeon et al. (2011).Jeon JG, Rosalen PL, Falsetta ML, Koo H. Natural products in caries research: current (limited) knowledge, challenges and future perspective. Caries Research. 2011;45(3):243–263. doi: 10.1159/000327250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Koo et al. (2002a).Koo H, Cury JA, Rosalen PL, Ambrosano GM, Ikegaki M, Park YK. Effect of a mouthrinse containing selected propolis on 3-day dental plaque accumulation and polysaccharide formation. Caries Research. 2002a;36(6):445–448. doi: 10.1159/000066535. [DOI] [PubMed] [Google Scholar]
  • Koo et al. (2002b).Koo H, Rosalen PL, Cury JA, Park YK, Bowen WH. Effects of compounds found in propolis on Streptococcus mutans growth and on glucosyltransferase activity. Antimicrobial Agents and Chemotherapy. 2002b;46(5):1302–1309. doi: 10.1128/AAC.46.5.1302-1309.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Kreth et al. (2005).Kreth J, Merritt J, Shi W, Qi F. Competition and coexistence between Streptococcus mutans and Streptococcus sanguinis in the dental biofilm. Journal of Bacteriology. 2005;187(21):7193–7203. doi: 10.1128/JB.187.21.7193-7203.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Lee et al. (2013).Lee H, Lee S, Park S, Lee J, Ahn S, Young Mook C, Choib D, Chang J. Antimicrobial medical sutures with caffeic acid phenethyl ester and their in vitro/in vivo biological assessment. RSC Medicinal Chemistry. 2013;4:777–782. doi: 10.1039/C2MD20289A. [DOI] [Google Scholar]
  • Lemos & Burne (2008).Lemos JA, Burne RA. A model of efficiency: stress tolerance by Streptococcus mutans. Microbiology. 2008;154(11):3247–3255. doi: 10.1099/mic.0.2008/023770-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Linzer & Slade (1976).Linzer R, Slade HD. Characterization of an anti-glucosyltransferase serum specific for insoluble glucan synthesis by Streptococcus mutans. Infection and Immunity. 1976;13(2):494–500. doi: 10.1128/iai.13.2.494-500.1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Machiulskiene et al. (2020).Machiulskiene V, Campus G, Carvalho JC, Dige I, Ekstrand KR, Jablonski-Momeni A, Maltz M, Manton DJ, Martignon S, Martinez-Mier EA, Pitts NB, Schulte AG, Splieth CH, Tenuta LMA, Ferreira Zandona A, Nyvad B. Terminology of dental caries and dental caries management: consensus report of a workshop organized by ORCA and cariology research group of IADR. Caries Research. 2020;54(1):7–14. doi: 10.1159/000503309. [DOI] [PubMed] [Google Scholar]
  • Marsh (1991).Marsh PD. Sugar, fluoride, pH and microbial homeostasis in dental plaque. Proceedings of the Finnish Dental Society. 1991;87:515–525. [PubMed] [Google Scholar]
  • Navarro-Perez et al. (2021).Navarro-Perez ML, Vadillo-Rodriguez V, Fernandez-Babiano I, Perez-Giraldo C, Fernandez-Calderon MC. Antimicrobial activity of a novel Spanish propolis against planktonic and sessile oral Streptococcus spp. Scientific Reports. 2021;11:23860. doi: 10.1038/s41598-021-03202-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Niu et al. (2020).Niu Y, Wang K, Zheng S, Wang Y, Ren Q, Li H, Ding L, Li W, Zhang L. Antibacterial effect of caffeic acid phenethyl ester on cariogenic bacteria and Streptococcus mutans Biofilms. Antimicrobial Agents and Chemotherapy. 2020;64(9):e00251. doi: 10.1128/AAC.00251-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Olgierd et al. (2021).Olgierd B, Kamila Z, Anna B, Emilia M. The pluripotent activities of caffeic acid phenethyl ester. Molecules. 2021;26(5):1335. doi: 10.3390/molecules26051335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Ouidir, Gabriel & Nait Chabane (2022).Ouidir T, Gabriel B, Nait Chabane Y. Overview of multi-species biofilms in different ecosystems: wastewater treatment, soil and oral cavity. Journal of Biotechnology. 2022;350(308):67–74. doi: 10.1016/j.jbiotec.2022.03.014. [DOI] [PubMed] [Google Scholar]
  • Rao et al. (2013).Rao X, Huang X, Zhou Z, Lin X. An improvement of the 2^(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 2013;3:71–85. [PMC free article] [PubMed] [Google Scholar]
  • Schilling et al. (1994).Schilling KM, Carsona RG, Boskoa CA, Golikeri GD, Bruinooge A, Hoyberg K, Waller AM, Hughes NP. A microassay for bacterial adherence to hydroxyapatite. Colloids Surfaces B: Biointerfaces. 1994;3(1–2):31–38. doi: 10.1016/0927-7765(93)01120-G. [DOI] [Google Scholar]
  • Takahashi & Nyvad (2008).Takahashi N, Nyvad B. Caries ecology revisited: microbial dynamics and the caries process. Caries Research. 2008;42(6):409–418. doi: 10.1159/000159604. [DOI] [PubMed] [Google Scholar]
  • Takahashi & Yamada (1999).Takahashi N, Yamada T. Acid-induced acid tolerance and acidogenicity of non-mutans streptococci. Oral Microbiology and Immunology. 1999;14:43–48. doi: 10.1034/j.1399-302x.1999.140105.x. [DOI] [PubMed] [Google Scholar]
  • Thanetchaloempong, Koontongkaew & Utispan (2022).Thanetchaloempong W, Koontongkaew S, Utispan K. Fixed orthodontic treatment increases cariogenicity and virulence gene expression in dental biofilm. Journal of Clinical Medicine. 2022;11:5860. doi: 10.3390/jcm11195860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Utispan et al. (2017).Utispan K, Chitkul B, Monthanapisut P, Meesuk L, Pugdee K, Koontongkaew S. Propolis extracted from the stingless bee Trigona sirindhornae inhibited S. mutans activity in vitro. Oral Health & Preventive Dentistry. 2017;15:279–284. doi: 10.3290/j.ohpd.a38528. [DOI] [PubMed] [Google Scholar]
  • Vu et al. (2009).Vu B, Chen M, Crawford RJ, Ivanova EP. Bacterial extracellular polysaccharides involved in biofilm formation. Molecules. 2009;14(7):2535–2554. doi: 10.3390/molecules14072535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wen, Baker & Burne (2006).Wen ZT, Baker HV, Burne RA. Influence of BrpA on critical virulence attributes of Streptococcus mutans. Journal of Bacteriology. 2006;188(8):2983–2992. doi: 10.1128/JB.188.8.2983-2992.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wen et al. (2011).Wen ZT, Nguyen AH, Bitoun JP, Abranches J, Baker HV, Burne RA. Transcriptome analysis of LuxS-deficient Streptococcus mutans grown in biofilms. Molecular Oral Microbiology. 2011;26(1):2–18. doi: 10.1111/j.2041-1014.2010.00581.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Wen et al. (2010).Wen ZT, Yates D, Ahn SJ, Burne RA. Biofilm formation and virulence expression by Streptococcus mutans are altered when grown in dual-species model. BMC Microbiology. 2010;10:111. doi: 10.1186/1471-2180-10-111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yang et al. (2019).Yang J, Deng D, Brandt BW, Nazmi K, Wu Y, Crielaard W, Ligtenberg AJM. Diversity of SpaP in genetic and salivary agglutinin mediated adherence among Streptococcus mutans strains. Scientific Reports. 2019;9:19943. doi: 10.1038/s41598-019-56486-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yin et al. (2022).Yin W, Zhang Z, Shuai X, Zhou X, Yin D. Caffeic Acid Phenethyl Ester (CAPE) inhibits cross-kingdom biofilm formation of Streptococcus mutans and Candida albicans. Microbiology Spectrum. 2022;10(5):e0157822. doi: 10.1128/spectrum.01578-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Yoshida et al. (2005).Yoshida A, Ansai T, Takehara T, Kuramitsu HK. LuxS-based signaling affects Streptococcus mutans biofilm formation. Applied and Environmental Microbiology. 2005;71(5):2372–2380. doi: 10.1128/AEM.71.5.2372-2380.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • You (2019).You Y-O. Virulence genes of Streptococcus mutans and dental caries. International Journal of Oral Biology. 2019;44(2):31–36. doi: 10.11620/ijob.2019.44.2.31. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Information 1. Raw data of antibacterial test.
peerj-13-18942-s001.xlsx (20.4KB, xlsx)
DOI: 10.7717/peerj.18942/supp-1
Supplemental Information 2. Raw data of biofilm formation assay.
peerj-13-18942-s002.xlsx (11.8KB, xlsx)
DOI: 10.7717/peerj.18942/supp-2
Supplemental Information 3. Raw data of GTF activity assay.
peerj-13-18942-s003.xlsx (17.6KB, xlsx)
DOI: 10.7717/peerj.18942/supp-3
Supplemental Information 4. Raw data of real time PCR.
peerj-13-18942-s004.xlsx (17.3KB, xlsx)
DOI: 10.7717/peerj.18942/supp-4
Supplemental Information 5. Raw data of confocal analysis.
peerj-13-18942-s005.xlsx (13.5KB, xlsx)
DOI: 10.7717/peerj.18942/supp-5
Supplemental Information 6. Real-Time Quantitative PCR checklist.
peerj-13-18942-s006.xls (30.5KB, xls)
DOI: 10.7717/peerj.18942/supp-6

Data Availability Statement

The following information was supplied regarding data availability:

The raw measurements and statistical analysis of all experiments are available in the Supplemental Files.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES