In vivo and in vitro investigations of schisandrin B against angiotensin II induced ferroptosis and atrial fibrosis by regulation of the SIRT1 pathway

Abstract

Schisandrin B (Sch B) derived from Schisandra chinensis, is known for its anti-inflammatory and anti-microbial properties. The study aimed to explore Sch B’s protective roles and underlying mechanisms in angiotensin II (Ang II) - induced ferroptosis, atrial fibrosis, and AF using both in vivo and in vitro models. AF mice model generated induced by Ang II and established an in vitro model using the HL-1 cell line induced by Ang II. We assessed atrial fibrosis through histological analysis and oxidative stress analysis. We employed RT-qPCR and Western blot techniques to evaluate mRNA and protein expression. Sch B significantly attenuated Ang II-induced AF development, atrial apoptosis, and myocardial injury-related molecules, including CK-MB and LDH. Relative DHE intensity, MDA, NOX2, and NOX4 increased significantly, and SOD and CAT levels decreased markedly in Ang II-induced mice. Sch B treatment could inhibit atrial ROS production and oxidative stress in Ang II-infused mice. In addition, Sch B showed cardioprotective effects in Ang II-infused HL-1 cells. Sch B significantly reduced pro-inflammatory cytokines, including IL-1β, TNF-α, and IL-6, restored by EX527 (SIRT1 inhibitor). Sch B inhibited intracellular ROS generation and oxidative stress in HL-1 cells, which were restored by Ex-527. Furthermore, Sch B decreased the increase in Fe2 + concentration caused by Ang II infusion, which was recovered by Ex-527. Sch B markedly increased the expression of SIRT1, SLC7A11, GPX4 and FTH1 while reducing the expression patterns by Ex-527 treatment. Our experimental data suggest that Sch B protects against Ang II-induced ferroptosis, atrial fibrosis, and AF by activating SIRT1 in vivo and in vitro.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-89895-0.

Introduction

Atrial fibrillation (AF) is a common prevalent heart rhythm disorder that has a significant impact on health and healthcare costs worldwide¹. It is characterized by irregular electrical signals in the atria, leading to rapid and disordered heartbeats². Atrial fibrosis, which involves the replacement of normal heart tissue with scarred tissue, is a crucial factor in the structural changes in the atria associated with AF³. This disruption of normal heart tissue connections can lead to the initiation and perpetuation of AF⁴. Recent research has shown that the renin-angiotensin system (RAS), particularly Angiotensin II (Ang II), plays a critical role in the progression of atrial fibrosis^5,6. Ang II plays an important role in fibrosis by increasing calcium levels, stimulating the proliferation and differentiation of fibroblasts, and promoting the excessive production of reactive oxygen species (ROS)⁷. Ang II studies have been conducted to understand better, how atrial fibrosis leads to atrial remodeling in AF⁸.

Ferroptosis is a recently identified form of regulated cell death. It is primarily caused by the accumulation of iron and an excessive build-up of ROS within cells, surpassing the system’s ability to manage them. This imbalance results in the peroxidation of unsaturated fatty acids within the cell membrane⁹. Many studies have linked ferroptosis to various cardiovascular conditions such as cardiomyopathy¹⁰, myocardial infarction¹¹, ischemia/reperfusion injury¹², and heart failure¹³. Previous research reported that elevated levels of ROS¹⁴ and iron accumulation¹⁵ can lead to arrhythmias. Excessive iron levels can increase ROS production in mitochondria and disrupt the membrane potential. This disruption may lead to the opening of mitochondrial permeability transition pores, ultimately contributing to arrhythmias¹⁶. The evidence presented indicates a strong link between ferroptosis and arrhythmias, with AF being the most common. Therefore, it is hypothesized that ferroptosis plays an essential role in the pathophysiological mechanisms underlying AF.

Schisandrin B (Sch B), a compound found in Schisandra chinensis, a traditional Chinese herbal remedy. Figure 1A represents the structural formula for Sch B. Sch B is a natural compound with various beneficial effects. These include anti-inflammatory properties, resistance to oxidative stress, and protection against microbial agents^17,18. Sch B is a natural, non-enzymatic antioxidant that is safe and cost-effective, making it ideal for treating various health conditions. Recent studies have shown that Sch B can decrease inflammatory responses by inhibiting the NF-κB signaling pathway. It also reduces the levels of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6. Sch B protects against inflammatory damage in conditions like inflammatory bowel disease (IBD) and acute lung injury^19,20. Additionally, Sch B has been shown to help prevent nephrolithiasis by inhibiting inflammation and ferroptosis mechanisms²¹. Furthermore, Sch B has been observed to alleviate arthritis induced by adjuvants through the suppression of both inflammation and oxidative stress²². It has also been reported to inhibit diabetes by promoting insulin secretion²³. However, the specific mechanisms by which Sch B inhibits ferroptosis, atrial fibrosis, and AF in Ang II-infused mice remain to be explicitly elucidated.

Fig. 1.

Sch B shows no toxicity to liver and kidney of mice. (A) Chemical Structure of SchB. (B) Mice were intraperitoneally injected with Sch B (30 mg/kg/day) for 28 consecutively days. Hepatic and renal tissues were stained with hematoxylin and eosin (HE) (Magnification 400×). (C,D) Mice were intraperitoneally injected with Sch B for 28 days, and serum concentrations of ALT, AST, Scr and BUN were measured. ALT and AST: U/L; Scr: µM/L; BUN: mM/L. Data are presented as mean ± SD (n = 8 mice in each group). Sch B, Schisandrin B; Ang II, angiotensin II; ALT, alanine transaminase; AST, aspartate transaminase; Scr, serum creatinine; BUN, blood urea nitrogen.

Methods

Animals and housing conditions

Male C57BL/6 mice were obtained from Sino-British SIPPR/BK Lab Animal Ltd in Shanghai, China. The environmental conditions for enriched and standard housing setups were established based on previously reported research²⁴. In summary, the mice in the enriched environment were housed in groups of twelve per cage in spacious enclosures (61 × 43 × 21 cm), which included running wheels, tunnels, wooden toys, small shelters, and nesting materials. These housing features were rearranged biweekly and replaced weekly. In contrast, the mice in the standard environment were housed in groups of four per cage in conventional laboratory cages (26 × 16 × 13 cm) without additional enrichment features. All mice had continuous access to food and water and were kept in a temperature-regulated facility under a 12-hour light/dark cycle.

Animals and treatment

Male C57BL/6 mice (8–10 weeks, n = 24) were subcutaneously infused with angiotensin II (Ang II, 2.0 mg/kg/day, HY-13948, MedChemExpress) or the same volume saline using osmotic mini-pumps for 28 days. Schisandrin B (Sch B, 30 mg/kg/day, HY-N0089, MedChemExpress) or the same volume of saline was intraperitoneally injected once a day for 28 days. This study received thorough approval from the Animal Care and Use Committee at Shanghai Pudong Zhoupu Hospital. It was conducted in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85 − 23, revised 1996), ensuring adherence to the highest ethical standards.

Animal grouping and drug administration

The mice were randomly divided into three groups as follows: (1) the control group-saline was infused using osmotic mini-pumps (n = 8). (2) The Ang II group-received a saline infusion, and Ang II was infused at a 2.0 mg/kg/day dose (n = 8). (3) The Sch B group-received a saline infusion, and Sch B was infused at a 30 mg/kg/day dose (n = 8). The drug administration lasted for 28 days.

Measurement of blood pressure

Systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured using the reputable tail-cuff system (ALC-NIBP; Shanghai Alcott Biotech Co., Shanghai, China). This system was used the day before Ang II infusion, 7, 14, 21 and 28 days after Ang II infusion. The mean arterial pressure (MAP) was calculated from the formula MAP = (SBP + DBP×2)/3.

Electrocardiography

After 28 d of Ang II infusion and Sch B treatment, mice were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg/kg). AF was induced by caudal vein injection of the mixture of acetylcholine (Ach) and calcium chloride (CaCl₂) in saline solution (10 mL/kg: Ach, 25 µg/mL; CaCl₂, 6 mg/mL). ECGs were recorded 30 min after injection. The criteria of AF were as follows: an irregular and rapid atrial rhythm (fibrillatory baseline) with irregular R-R intervals for at least 1s²⁵.

Biochemical analysis

Serum was obtained to quantify the biochemical indicators using commercial kits: alanine transaminase (ALT, C009-2-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and aspartate aminotransferase (AST, C0010-2-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China). An automatic biochemical analyzer determined serum creatinine (Scr) and blood urea nitrogen (BUN). In addition, the atrial tissues and HL-1 cells were homogenized (10%, w/v) for measuring oxidative stress indicators: malondialdehyde (MDA, S0131S, Beyotime, Shanghai, China), superoxide dismutase (SOD, S0109, Beyotime), and catalase (CAT, S0051, Beyotime) activities using commercially available kits.

Sample collection

Mice were euthanized with CO₂, and atrial tissue was collected. Some of the tissue was snap-frozen in liquid nitrogen for RT-qPCR and Western blot analysis, while another portion was fixed in 4% paraformaldehyde for histological studies.

Histology

The results from hematoxylin and eosin (HE) staining, which evaluated the extent of liver and kidney damage, are crucial for understanding the study’s implications. Similarly, evaluating atrial fibrosis in mouse atrial tissue using Masson’s trichrome stain (D026-1-1; Nanjing Jiancheng Bioengineering Institute) provides crucial insights. The amount of fibrosis, measured by determining the ratio of fibrotic area to normal myocardium (collagen volume fraction), further underscores the importance of the research.

Tissue immunofluorescence

The technique of Immunofluorescence was executed following a previously outlined protocol²⁵. Frozen sections of murine atrial tissue were procured for analysis. Subsequent to three washes with phosphate-buffered saline (PBS), terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL, C1086, Beyotime) and dihydroergotamine (DHE, S0063, Beyotime) were administered. The specimens were then stained with 4′,6-diamidino-2-phenylindole (DAPI) and scrutinized using an inverted microscope (IX51, Olympus, Japan). The procedures involving TUNEL and DHE were conducted as per the guidelines provided by the respective manufacturers.

Cell culture and treatment

The mice cardiac muscle cell line HL-1 was purchased from Procell (CL-0605, China). HL-1 cells were cultivated in complete Claycomb Medium (Sigma, St. Louis, MO, USA) supplemented with 10% FBS (Gibco, Waltham, MA, USA), with 100 U/mL penicillin/streptomycin. The HL-1 cells were maintained at 37 °C in 5% CO₂. To construct an in vitro AF model, HL-1 cells were treated with 1 µM angiotensin (Ang) II for 24 h, and PBS treatment was served as a control. To explore the protective effect of Sch B, 20 µM Sch B was used to treat Ang II-induced HL-1 cells for 24 h. To examine the role of SIRT1, a SIRT1 inhibitor EX527 (10 µM, HY-15452, MedChemExpress) was used to pretreat HL-1 cells for 2 h in the presence of Ang II and Sch B treatment.

Cell viability

HL-1 (2 × 10³ cells/well) were seeded into 96‑well plates and then treated with saline, Ang II (1 µM), Sch B (20 µM), and Sch B + EX527 (20 µM + 10 µM) for 24 h. CCK‑8 (10 µL, C0037, Beyotime) solution was added to each well of the 96‑well plates. After 3 h of incubation, a microplate reader examined cell absorbance at 450 nm.

Lactate dehydrogenase (LDH) assay

Cell injury was meticulously assessed using an LDH assay kit (A020-3, Jiancheng, Nanjing, China) as per the manufacturer’s instructions. The assessment involved monitoring the release of LDH into the culture medium. After treating the cells for 24 h with saline, Ang II (1 µM), Sch B (20 µM), and Sch B + EX527 (20 µM + 10 µM), we collected 0.2 mL of the culture medium with utmost care to measure the LDH amount using spectrophotometry. All data points are expressed in U/dL, ensuring the reliability and thoroughness of our results.

Apoptosis

HL-1 cells were cultured in a 24-well plate with 5 × 10⁴ cells per well and then treated for 48 h. Following the treatment, the cells were dissociated with trypsin and stained with Annexin V-FITC and propidium iodide (PI) for 15 min at room temperature. Flow cytometry thoroughly determined the cell apoptosis rate, which was analyzed using the Annexin V-FITC-positive and PI-negative cells. An Annexin V-FITC assay kit from Solarbio in Beijing, China, was utilized to quantify the apoptotic cells, ensuring the validity and reliability of our results.

Enzyme-linked immunosorbent assay (ELISA)

ELISA was used to measure the levels of inflammatory cytokines in the culture medium of HL-1 cells. After various treatments, supernatants were collected, and levels of interleukin-1β (IL-1β, MLB00C, R&D Systems), interleukin-6 (IL-6, M6000B, R&D Systems), and tumor necrosis factor-alpha (TNF-α, MTA00B, R&D Systems) were evaluated by ELISA kits (R&D Systems Inc, Minneapolis, MN, USA). The concentrations were expressed as pg/mL.

Immunofluorescence

The Immunofluorescence technique was performed using the method described previously²⁶. After being collected, frozen HL-1 cells were washed three times with phosphate-buffered saline (PBS). The cells were then treated with TUNEL (C1086, Beyotime), DAPI (S0063, Beyotime), and Mito Ferro Green (HY-D2295; MedChemExpress) stains and examined under an inverted microscope (IX51, Olympus, Japan).

Iron quantification

The ferrous ions (Fe2+) concentration in HL-1 cells was thoroughly analyzed using spectrophotometry. Iron in blank (ddH₂O), iron standard solution, and test samples were meticulously added to 96-well plates to do this. Then, a Fe assay buffer and ferrous chromogenic solution were carefully added to each well for incubation. The sample was dissolved by 2 M HCl, followed by a thorough spectrophotometry at 560 nm²⁷.

Real-time quantitative PCR (RT-qPCR)

The PrimeScript RT Reagent kit from TaKaRa Bio Inc in Dalian, China, a trusted and reliable source, synthesized cDNA with 1 µg of total RNA extracted from murine atrial tissue. The RNA was isolated using TRIzol, a dependable product from Invitrogen. RT-qPCR was performed using a Takara SYBR Green kit, known for its accuracy, and an Applied Biosystems 7500 real-time PCR machine from CA, USA. The primer sequences used for this study are listed in Table 1. GAPDH was used as an internal reference. All primers were designed using the NCBI Primer-Blast Tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The RT-qPCR settings included 7 min of denaturation at 95˚C, followed by 40 cycles of 15 s at 95˚C and 1 min at 60˚C. The relative mRNA level was estimated using the 2^−ΔΔCt technique²⁸.

Table 1.

List of primer sequences used in this study.

Genes	Forward primer (5′-3′)	Reverse primer (5′-3′)	Size (bp)
Mouse NOX2	CCAACTGGGATAACGAGTTCA	GAGAGTTTCAGCCAAGGCTTC	98
Mouse NOX4	TGCTCATTTGGCTGTCCCTA	TGCAGTTGAGGTTCAGGACA	150
Mouse BAX	GCCTCCTCTCCTACTTCGG	AAAAATGCCTTTCCCCTTC	187
Mouse BCL-2	CTCGTCGCTACCGTCGTGACTTCG	CAGATGCCGGTTCAGGTACTCAGTC	242
Mouse IL-1β	ACCTTCCAGGATGAGGACATGA	AACGTCACACACCAGCAGGTTA	108
Mouse TNF-α	ACGGCATGGATCTCAAAGAC	GTGGGTGAGGAGCACGTAGT	116
Mouse IL-6	AGTTGCCTTCTTGGGACTGA	TCCACGATTTCCCAGAGAAC	159
Mouse SLC7A11	TGGATGCTGTGCTTGGTCTTGATG	CTGCCTGCTGTACCGTGGTTATG	80
Mouse GPX4	CGATCTGCATGCCCGATATG	GGCATCGTCCCCATTTACAC	169
Mouse FTH1	AGGATATAAAGAAACCAGACCGTG	TCAGTAGCCAGTTTGTGCAG	121
Mouse GAPDH	TGGTGAAGGTCGGTGTGAAC	TTCCCATTCTCGGCCTTGAC	190

Western blotting

In the experiment, nuclear protein extraction was carried out using Extraction Reagents (Pierce Biotechnology, Inc., Rockford, IL, USA), and total protein isolation was accomplished using RIPA lysis buffer. The protein concentration was determined using a BCA protein assay kit (Beyotime Biotechnology, China). After being separated using 10% SDS-PAGE, the 50 µg protein samples were transferred to PVDF membranes. After blocking the membranes with 5% low-fat milk and then incubated with primary antibodies SIRT1 (1:500, sc-74465, mouse monoclonal, Santa Cruz), SLC7A11 (1:500, ab175186, rabbit monoclonal, Abcam), GPX4 (1:500, sc-166570, mouse monoclonal, Santa Cruz), and FTH1 (1:500, sc-376594, mouse monoclonal, Santa Cruz). After that, HRP-linked secondary antibodies were applied to the membranes, and GAPDH (1:2000, ab9485, rabbit polyclonal, Abcam) was utilized as the internal control. Ultimately, ECL (Thermo, Waltham, MA, USA) was used to observe the bands, and ImageJ was used to analyze them.

Statistical analysis

All data were presented as the mean value accompanied by the standard deviation (SD) derived from at least three independent experiments. Statistical analyses have been conducted using SPSS 20.0 (SPSS, Chicago, IL, USA) or GraphPad Prism 9.0 software. The differences between several groups were examined using one-way ANOVA and the post hoc Tukey test. AF incidence between various groups was analyzed using Fisher’s exact test. Statistical significance has been deemed as a P value of < 0.05.

Results

Preliminary assessment of the safety and physiological characteristics in mice models

Our comprehensive assessment focused on the safety of Sch B administration in mice. The mice were injected once a day with Sch B (30 mg/kg/day) for 28 days. Following the 28-day injection period, we conducted an in-depth assessment of the systemic toxicity of Sch B in vivo. The hepatic and renal function parameters in mice were examined, including ALT (55.41 ± 5.80 vs. 55.98 ± 4.58 U/L, p < 0.831), AST (17.27 ± 2.80 vs. 18.38 ± 2.36 U/L, p < 0.405), Creatinine (26.96 ± 2.38 vs. 27.25 ± 1.79 µmol/L, p < 0.785), and BUN (13.84 ± 1.35 vs. 14.18 ± 1.76 mM/L, p < 0.671). No detrimental impacts on hepatic and renal systems were observed compared to the saline and Ang II groups (Fig. 1C, D). The staining results with Hematoxylin and Eosin (H&E) also showed no adverse effects on the liver and kidney (Fig. 1B).

Furthermore, our study revealed a potential therapeutic benefit of Sch B. Mice were injected with Sch B (30 mg/kg/day) once a day for 28 days, two hours before receiving subcutaneous Ang II (2.0 mg/kg/day). The findings demonstrated that in Ang II-infused mice, Sch B significantly reduced SBP, DBP, and MAP (Fig. 1E-G). The results indicated no safety issues or adverse effects on physiological features in vivo.

Sch B inhibited Ang II-Induced AF

To study the role of Sch B in regulating atrial fibrillation (AF) development, mice were infused with Ang II with or without Sch B (30 mg/kg/day) for 28 days. Electrocardiogram recordings were taken following transesophageal fast atrial pacing. Mice in the AF group experienced typical AF attacks (Fig. 2A). The inducibility and duration of AF were studied in Ang II-infused mice with and without Sch B. After receiving Ang II therapy, the inducibility of AF significantly increased (4.63 ± 1.51 vs. 36.63 ± 5.20, p < 0.001). However, treatment with Sch B significantly reduced Ang II-induced AF inducibility (36.63 ± 5.20 vs. 12.63 ± 1.60, p < 0.001) (Fig. 2B). Furthermore, the overall duration of AF was considerably shortened in the Sch B-treated mice compared to those receiving only Ang II infusion (14.81 ± 2.95 vs. 7.84 ± 1.54 s, p < 0.001) (Fig. 2C). These results demonstrate that Sch B significantly attenuates Ang II-induced AF development in mice.

Fig. 2.

Sch B reduces the susceptibility of atrial fibrillation (AF) inducibility and AF duration of mice. (A) Representative images of electrogram recordings are shown. Mice were injected the mixture of acetylcholine (Ach) and calcium chloride (CaCl₂) through caudal vein. ECGs were recorded after 30 min. (B) Percentage of successful AF inducibility. (C) Average AF duration. Data are presented as mean ± SD (n = 8 mice in each group). ***P < 0.001 vs. Control group; ###P < 0.001 vs. Ang II group.

Sch B suppressed AF and apoptosis in Ang II-infused mice

To investigate the potential impact of Sch B on the regulation of Ang II-infused AF and apoptosis, mice were administered Ang II with or without Sch B (30 mg/kg/day) for 28 days. Ang II significantly increased the rate of fibrotic area (7.25 ± 0.49 vs. 35.24 ± 3.77%, p < 0.001), while Sch B notably reduced this rate (35.24 ± 3.77 vs. 14.26 ± 1.41%, p < 0.001) (Fig. 3A and B). Atrial apoptosis was assessed using TUNEL staining. The results showed that Ang II infusion increased the number of TUNEL-positive cells in atrial tissues (3.21 ± 1.33 vs. 14.04 ± 3.15%, p < 0.001), while Sch B notably decreased this number (14.04 ± 3.15 vs. 5.80 ± 0.59%, p < 0.001) (Fig. 3C and D). Our RT-qPCR analysis revealed significant changes in the mRNA levels of the apoptosis-related genes BAX and BCL-2 in mice treated with Ang II and those receiving Sch B (3.081 ± 0.306 vs. 1.589 ± 0.205 fold, p < 0.001 for BAX; 0.397 ± 0.048 vs. 0.896 ± 0.085 fold, p < 0.001 for BCL-2) (Fig. 3E). Colorimetry and ELISA, two widely accepted methods in the field, were employed to measure serum levels of myocardial injury-related molecules, including CK-MB and LDH. The results indicated that Ang II elevated CK-MB (183.43 ± 18.47 vs. 467.57 ± 40.15 U/L, p < 0.001) and LDH (159.09 ± 18.87 vs. 454.98 ± 69.24 U/L, p < 0.001) serum levels, which were significantly reduced (467.57 ± 40.15 vs. 294.28 ± 40.54 U/L, p < 0.001 for CK-MB; 454.98 ± 69.24 vs. 230.18 ± 24.13 U/L, p < 0.001 for LDH) by Sch B treatment (Fig. 3F, G). The experimental findings demonstrated that Sch B markedly suppressed AF and atrial apoptosis in Ang II-infused mice.

Fig. 3.

Sch B suppresses atrial fibrosis and apoptosis in Ang II-infused mice. (A) Atrial fibrosis was evaluated by staining atrial tissue with Masson trichrome (Magnification 200×). (B) Atrial fibrosis was quantified by calculating the percentage of the fibrotic area (blue area). (C) Atrial apoptosis was evaluated by TUNEL staining in the atria. (D) Quantification of TUNEL positive cells in atrial tissues. (E) RT-qPCR was used to determine the mRNA expression of two apoptosis genes, BAX and BCL-2, using GAPDH as an internal control. (F, G) Colorimetry and ELISA were used to measure serum levels of myocardial injury-related molecules, including CK-MB and LDH. Data are presented as mean ± SD (n = 8 mice in each group). ***P < 0.001 vs. control group; ###P < 0.001 vs. Ang II group. CK-MB, creatine kinase isoenzyme MB; LDH, lactate dehydrogenase.

Sch B reduced atrial ROS and oxidative stress in Ang II-infused mice

DHE staining was performed to evaluate the influence of Sch B on the ROS production of atrial tissue. The results showed that Ang II infusion increased the ROS production (1 ± 0.13 vs. 6.48 ± 0.73%/s, p < 0.001) in the atrial tissue, while the Sch B treatment remarkably reduced (6.48 ± 0.73 vs. 1.82 ± 0.21%/s, p < 0.001) (Fig. 4A and B). The atrial tissue lysate was used to identify crucial oxidative stress biomarkers, such as MDA, SOD, and CAT. Increased MDA content (378.08 ± 36.24 vs. 602.82 ± 84.29 pmol/mg protein, p < 0.001) and decreased SOD (48.20 ± 3.55 vs. 15.50 ± 1.84 U/mg protein, p < 0.001) and CAT activity (28.98 ± 3.80 vs. 10.01 ± 1.21 U/mg protein, p < 0.001) were observed following Ang II infusion, while these changes were all reversed by Sch B treatment (602.82 ± 84.29 vs. 461.71 ± 64.73 pmol/mg protein, p < 0.04 for MDA; 15.50 ± 1.84 vs. 43.82 ± 4.81 U/mg protein, p < 0.001 for SOD; 10.01 ± 1.21 vs. 26.94 ± 2.67 U/mg protein, p < 0.001 for CAT) (Fig. 4C-E). Meanwhile, RT-qPCR was used to determine the expression of NOX2 and NOX4 genes. The Sch B treatment dramatically decreased the mRNA expression of NOX2 and NOX4 in mice compared to mice receiving Ang II infusion (2.71 ± 0.32 vs. 1.27 ± 0.18 fold, p < 0.001 for NOX2 and 3.36 ± 0.37 vs. 1.40 ± 0.25 fold, p < 0.001 for NOX4, respectively) (Fig. 4F). The experimental findings indicated that Sch B treatment attenuated the atrial ROS production and oxidative stress in Ang II-infused mice.

Fig. 4.

Sch B reduces atrial oxidative stress in mice after Ang II infusion. (A) Intracellular ROS was evaluated by DHE staining of atrial superoxide. (B) Quantification of DHE intensity. The levels of (C) MDA, (D) SOD and (E) CAT in atrial lysate were quantified. (F) Relative mRNA expression of NOX2 and NOX4 were determined by RT-qPCR. GAPDH as an internal control. Data are presented as mean ± SD (n = 8 mice in each group). ***P < 0.001 vs. control group; ###P < 0.001 vs. Ang II group.

Sch B inhibited ferroptosis by activation of SIRT1 in Ang II-induced mice

Western blot was used to measure the protein levels of key components of the SIRT1 and ferroptosis-related proteins in the atrial tissues of mice. The results showed that Sch B significantly increased the expression of SIRT1, SLC7A11, GPX4, and FTH1 in atrial tissues, which was reduced by Ang II infusion (Fig. 5A). In addition, the quantification analysis of protein bands showed the consistent expression patterns of the western blot analysis (0.47 ± 0.09 vs. 0.76 ± 0.10 fold, p < 0.001 for SIRT1; 0.42 ± 0.09 vs. 0.68 ± 0.07 fold, p < 0.001 for SLC7A11; 0.40 ± 0.04 vs. 0.62 ± 0.05 fold, p < 0.001 for GPX4; 0.44 ± 0.07 vs. 0.68 ± 0.07 fold, p < 0.001 for FTH1) (Fig. 5B-E). Protein expression was normalized to the GADPH.

Fig. 5.

Sch B increases the Ang II-induced decrease SIRT1 and ferroptosis. (A) Representative bands of Western blot results of SIRT1 and ferroptosis -related proteins in atrial tissues of mice. Quantitative analysis of protein bands for (B) SIRT1, (C) SLC7A11, (D) GPX4 and (E) FTH1. Protein expression was normalized to the GADPH. Data are presented as mean ± SD (n = 8 mice in each group). ***P < 0.001 vs. control group; ###P < 0.001 vs. Ang II group.

Sch B showed cardioprotective effects in Ang II-infused HL-1 cells

HL-1 cells were pretreated with the SIRT1 inhibitor EX527 (10 µM) for 2 h, followed by a 24 h incubation with Ang II (1 µM) and/or Sch B (20 µM). The impact of Sch B on cell viability and LDH cytotoxicity was assessed using CCK‑8 and an LDH cytotoxicity kit. No adverse effects on cell viability or LDH cytotoxicity were observed in HL-1 cells (Fig. 6A and B).

Fig. 6.

Sch B shows cardioprotective effects in HL-1 cells with induced by Ang II. HL-1 cells were pretreated with a SIRT1 inhibitor EX527 (10 µM) for 2 h, followed by incubation with Ang II (1 µM) and/or Sch B (20 µM) for further 24 h. (A) The effect of Sch B on cell viability was assessed by CCK‑8 assay. The results were expressed as the percentage of control group. (B) LDH release was measured using an LDH cytotoxicity assay kit. The results were expressed as the percentage of control group. (C) Cell apoptosis was evaluated by Annexin V-FITC double staining and analyzed by flow cytometry. (D) Representative images of flow cytometry are shown. Data are presented as mean ± SD in triplicates, and analyzed using one-way ANOVA. Bonferroni test was used for the post-hoc test. ***P < 0.001 vs. control group; ###P < 0.001 vs. Ang II group; $$P < 0.01, $$$P < 0.001 vs. Sch B group.

Cell apoptosis was determined using Annexin V-FITC double staining and analyzed by flow cytometry. The results indicated that Ang II infusion increased the apoptosis rate (1.57 ± 0.15 vs. 9.83 ± 0.85%/s, p < 0.001), which was reduced by the Sch B treatment (9.83 ± 0.85 vs. 3.11 ± 0.22%/s, p < 0.001). However, the Sch B + EX527 treatment restored the increased apoptosis rate (3.11 ± 0.22 vs. 8.71 ± 0.63%/s, p < 0.001) (Fig. 6C and D). These results suggest that Sch B may have cardioprotective effects against Ang II-infused HL-1 cells.

Sch B suppressed Ang II-infused inflammation in HL-1 cells

The mRNA levels of pro-inflammatory cytokines were measured in HL-1 cells by RT-qPCR, including IL-1β, TNF-α, and IL-6. The results indicated that Ang II infusion enhanced IL-1β (1 ± 0.33 vs. 3.12 ± 0.62 fold, p < 0.001), TNF-α (1 ± 0.13 vs. 2.60 ± 0.36 fold, p < 0.001), and IL-6 (1 ± 0.23 vs. 3.44 ± 0.38 fold, p < 0.001) expression levels, which were reduced by Sch B treatment (3.12 ± 0.62 vs. 1.40 ± 0.75 fold, p < 0.001 for IL-1β; 2.60 ± 0.36 vs. 1.26 ± 0.17 fold, p < 0.001 for TNF-α; 3.44 ± 0.38 vs. 1.21 ± 0.10 fold, p < 0.001 for IL-6). On the other hand, the Sch B + EX527 treatment restored the increased levels of IL-1β (1.40 ± 0.75 vs. 2.46 ± 0.71 fold, p < 0.001), TNF-α (1.26 ± 0.17 vs. 2.28 ± 0.26 fold, p < 0.001), and IL-6 (1.21 ± 0.10 vs. 2.84 ± 0.45 fold, p < 0.001) (Fig. 7A-C).

Fig. 7.

Sch B suppresses Ang II-induced inflammation in HL-1 cells. (A–C) The mRNA levels of pro-inflammatory cytokines were measured in HL-1 cells by RT-qPCR, including IL-1β, TNF-α, and IL-6. (D–F) The levels of IL-1β, TNF-α, and IL-6 in the culture media of HL-1 cells were measured by ELISA. Data are presented as mean ± SD in triplicates, and analyzed using one-way ANOVA and Bonferroni test was used for the post-hoc test. ***P < 0.001 vs. control group; ###P < 0.001 vs. Ang II group; $$$P < 0.001 vs. Sch B group.

In addition, the levels of IL-1β, TNF-α, and IL-6 in the culture media of HL-1 cells were measured by ELISA. We observed increased levels of IL-1β (45.08 ± 4.42 vs. 140.25 ± 16.67 pg/mL, p < 0.001), TNF-α (56.40 ± 5.83 vs. 125.83 ± 9.59 pg/mL, p < 0.001), and IL-6 (32.64 ± 3.26 vs. 128.63 ± 9.34 pg/mL, p < 0.001) expression in HL-1 cells following Ang II infusion, while Sch B treatment reduced the expression levels (140.25 ± 16.67 vs. 61.10 ± 7.25 pg/mL, p < 0.001 for IL-1β; 125.83 ± 9.59 vs. 66.05 ± 7.86 pg/mL, p < 0.001 for TNF-α; 128.63 ± 9.34 vs. 47.47 ± 6.87 pg/mL, p < 0.001 for IL-6). However, the Sch B + EX527 treatment recovered the enhanced IL-1β (61.10 ± 7.25 vs. 130.37 ± 10.44 pg/mL, p < 0.001), TNF-α (66.05 ± 7.86 vs. 108.54 ± 12.96 pg/mL, p < 0.001), and IL-6 (47.47 ± 6.87 vs. 112.74 ± 12.57 pg/mL, p < 0.001) expression levels (Fig. 7D-F). The experimental findings suggest that Sch B treatment inhibited Ang II-infused inflammation in HL-1 cells.

Sch B inhibited intracellular ROS generation and oxidative stress in HL-1 cells

DHE staining was performed to evaluate the influence of Sch B on intracellular ROS generation and oxidative stress in Ang II-induced HL-1 cells. Sch B treatment reduced the increase in superoxide formation (DHE staining) caused by Ang II infusion (36.65 ± 5.21 vs. 9.81 ± 0.87%/s, p < 0.001), which was restored by Sch B + Ex-527 treatment (9.81 ± 0.87 vs. 26.86 ± 2.87%/s, p < 0.001) (Fig. 8A, B). The HL-1 cell lysate was used to identify crucial oxidative stress biomarkers, such as SOD, CAT, and MDA. Increased MDA content (131.19 ± 9.88 vs. 338.77 ± 26.16 pmol/mg protein, p < 0.001) and decreased SOD (278.33 ± 24.19 vs. 106.41 ± 11.69 U/mg protein, p < 0.001) and CAT (84.80 ± 11.64 vs. 36.72 ± 7.41 U/mg protein, p < 0.001) activity were observed following Ang II infusion, while these changes were all reversed by Sch B treatment (338.77 ± 26.16 vs. 154.43 ± 29.08 pmol/mg protein, p < 0.001 for MDA; 106.41 ± 11.69 vs. 223.28 ± 18.09 U/mg protein, p < 0.001 for SOD; 36.72 ± 7.41 vs. 67.29 ± 10.11 U/mg protein, p < 0.001 for CAT). On the other hand, Sch B + Ex-527 treatment restored their activity (154.43 ± 29.08 vs. 280.09 ± 18.89 pmol/mg protein, p < 0.001 for MDA; 223.28 ± 18.09 vs. 124.73 ± 23.73 U/mg protein, p < 0.001 for SOD; 67.29 ± 10.11 vs. 36.40 ± 4.26 U/mg protein, p < 0.001 for CAT) (Fig. 8C-E).

Fig. 8.

Sch B inhibits intracellular ROS generation and oxidative stress in Ang II-induced HL-1 cells. (A) Cells were stained with DHE and the representative image of intracellular ROS are shown (200×). (B) Intracellular ROS extent was evaluated by quantitative of DHE positive cells (normalized to DAPI-stained cells). The cell lysate of HL-1 cells were used to measure the oxidative stress markers for (C) MDA, (D) SOD and (E) CAT. (F) RT-qPCR was carried out to determine the mRNA expression of NOX2 and NOX4. GAPDH serves as an internal control. Data are shown as mean ± SD (n = 6 per group), and analyzed by ANOVA. ***P < 0.001 vs. control group; ###P < 0.001 vs. Ang II group; $$P < 0.01, $$$P < 0.001 vs. Sch B group.

Meanwhile, RT-qPCR was used to determine the expression of NOX2 and NOX4 genes. The Sch B treatment dramatically decreased the mRNA expression of NOX2 (2.78 ± 0.53 vs. 1.34 ± 0.29 fold, p < 0.001) and NOX4 (2.86 ± 0.44 vs. 1.45 ± 0.36 fold, p < 0.001) in HL-1 cells compared to HL-1 cells receiving Ang II infusion alone. However, NOX2 and NOX4 expression in HL-1 cells were recovered by Sch B + Ex-527 treatment (1.34 ± 0.29 vs. 2.44 ± 0.41 fold, p < 0.001 of NOX2; 1.45 ± 0.36 vs. 2.43 ± 0.45 fold, p < 0.001 for NOX4) (Fig. 8F). The experimental results demonstrated that Sch B inhibited intracellular ROS generation and oxidative stress in HL-1 cells, which were restored by Sch B + Ex-527 treatment (Fig. 8).

Sch B inhibited ferroptosis by activation of SIRT1 in Ang II-induced HL-1 cells

Ferro Green staining was performed to evaluate the influence of Sch B on ferroptosis in Ang II-induced HL-1 cells. Sch B treatment reduced the increase in the percentage of Ferro Green positive cells caused by Ang II infusion (27.09 ± 4.69 vs. 6.83 ± 1.45%/s, p < 0.001), which was restored by Sch B + Ex-527 treatment (6.83 ± 1.45 vs. 19.33 ± 1.99%/s, p < 0.001) (Fig. 9A, B). The concentration of Fe2 + was measured in HL-1 cells. The results showed that Sch B decreased the increase in Fe2 + concentration caused by Ang II infusion (144.34 ± 22.01 vs. 72.61 ± 12.20 mmol/mg Pro, p < 0.001), which was recovered by Sch B + Ex-527 treatment (72.61 ± 12.20 vs. 120.69 ± 16.34 mmol/mg Pro, p < 0.001) (Fig. 9C).

Fig. 9.

Sch B inhibits ferroptosis by activation of SIRT1 in Ang II-induced HL-1 cells. (A) Representative image of FerroGreen-stained cells are shown (200×). (B) Quantitative analysis of the percentage of FerroGreen positive cells among all DAPI-stained cells. (C) The concentration of Fe²⁺ were measured in HL-1 cells. (D) Western blot was performed to determine SIRT1 and three ferroptosis-related proteins, SLC7A11, GPX4 and FTH1. (E) Quantification of SIRT1, SLC7A11, GPX4 and FTH1 protein, which were normalized to GAPDH. Data are shown as mean ± SD (n = 6 per group), and analyzed by ANOVA. ***P < 0.001 vs. control group; ##P < 0.01, ###P < 0.001 vs. Ang II group; $$$P < 0.001 vs. Sch B group.

Western blot was performed to determine SIRT1 and three ferroptosis-related proteins, including solute carrier family 7 member 11 (SLC7A11), glutathione peroxidase 4 (GPX4) and ferritin heavy chain 1 (FTH1). The results indicated that Sch B markedly increased the expression of SIRT1, SLC7A11, GPX4 and FTH1 (Fig. 9D). In addition, the quantification analysis of protein bands showed consistent expression patterns of the western blot analysis (0.33 ± 0.03 vs. 0.61 ± 0.04 fold, p < 0.001 for SIRT1; 0.51 ± 0.03 vs. 0.76 ± 0.02 fold, p < 0.001 for SLC7A11; 0.43 ± 0.04 vs. 0.69 ± 0.07 fold, p < 0.001 for GPX4; 0.41 ± 0.05 vs. 0.76 ± 0.05 fold, p < 0.001 for FTH1) while reducing the expression patterns by Sch B + Ex-527 treatment (0.61 ± 0.04 vs. 0.39 ± 0.04 fold, p < 0.001 for SIRT1; 0.76 ± 0.02 vs. 0.55 ± 0.05 fold, p < 0.001 for SLC7A11; 0.69 ± 0.07 vs. 0.52 ± 0.03 fold, p < 0.001 for GPX4; 0.76 ± 0.05 vs. 0.54 ± 0.09 fold, p < 0.001 for FTH1) (Fig. 9E). Protein expression was normalized to GAPDH. The findings demonstrated that Sch B inhibited ferroptosis by activating SIRT1 in Ang II-induced HL-1 cells.

Discussion

The pathological mechanisms underlying AF exhibit considerable complexity, largely due to the diverse genetic predispositions. However, the complex interaction of different mechanisms highlights the intricacy of this condition. Atrial structure remodeling is instrumental in AF’s onset, recurrence, and persistence²⁹. Atrial fibrosis serves as a crucial intermediary stage in the structural remodeling of the atria associated with AF³⁰. However, the role of Sch B on ferroptosis, atrial fibrosis and AF in Ang II-infused mice has not been reported. Our study revealed that Sch B, a potential pharmacological agent, had no adverse effects on hepatic or renal tissues. This significant finding paves the way for further research. Equally impressive is that Sch B significantly reduced SBP, DBP, and MAP in Ang II-infused mice. Sch B’s significant inhibitory effects on Ang II-infused AF, apoptosis, atrial ROS generation, and oxidative stress, as well as its enhancement of the Ang II-induced decrease in SIRT1 and ferroptosis in mice, further underscore its potential. Moreover, Sch B’s cardioprotective effects and its ability to inhibit inflammation, intracellular ROS generation, oxidative stress, and ferroptosis by activating SIRT1 in Ang II-induced HL-1 cells provide further intrigue. Thus, Sch B may exhibit a protective effect against ferroptosis, atrial fibrosis, and AF induced by Ang II, as well as the subsequent development of AF in mice models.

The outcomes of drug treatments in mice can vary significantly based on the duration of the treatment. Treatments lasting longer than 28 days facilitate a more thorough evaluation of the drug’s efficacy and potential side effects³¹. A recent study indicated that 28 days of treatment yield more information than 7 or 14 days³². However, this study, which primarily focused on assessing the safety of administering Sch B to mice, reaffirmed the safety of Sch B. The mice received daily injections of Sch B at a dosage of 30 mg/kg/day for 28 days. After the 28-day injection period, we thoroughly examined the systemic toxicity of Sch B in vivo. We examined mice’s hepatic and renal function parameters, including ALT, AST, Creatinine, and BUN. The findings showed no harmful effects on the hepatic and renal systems compared to the control group treated with saline and the mice infused with Ang II (Fig. 1C, D). In addition, Sch B significantly reduced SBP, DBP, and MAP in Ang II-infused mice (Fig. 1E-G). The results indicated no safety issues or adverse effects on physiological features in vivo.

Several factors are involved in causing and maintaining complications associated with AF³³. Atrial fibrosis is the primary cause of structural changes in individuals with AF. The fundamental structural basis facilitates its recurrence, a crucial condition element. The progression of atrial fibrosis in the left atrium (LA) is essential for initiating focal activities and re-entrant circuits, establishing and sustaining AF³⁴. Myocardial fibrosis is commonly observed in experimental models and patients with AF³⁵. A recent study showed that Sch B could alleviate rats’ AF and improve myocardial injury and cardiac dysfunction by inhibiting the Akt/mTOR/S6K signaling pathway³⁶. Our observations showed that typical AF attacks were observed in AF mice (Fig. 2A). Treatment with Sch B dramatically reduced Ang II-induced AF inducibility in mice (Fig. 2B). Sch B also significantly decreased the average duration of AF in Ang II-treated mice (Fig. 2C).

Pathological cardiac hypertrophy, especially in the context of hypertension, is significantly linked to higher mortality rates among patients with heart failure. People with high blood pressure, heart attacks, or other heart conditions can effectively prevent the onset of heart failure by addressing cardiac hypertrophy early³⁷. Recent, groundbreaking research has shed light on the increase in ROS and the triggering of apoptosis, which may play a crucial role in developing cardiac hypertrophy caused by various factors, including Ang-II and phenylephrine³⁸. The interaction between ROS generation and cellular antioxidant defense mechanisms is thought to be marked by differences, leading to oxidative stress³⁹. This new understanding is crucial in our investigation against heart failure. However, our study showed that Ang II significantly increased AF, apoptosis, atrial ROS generation and oxidative stress, while Sch B remarkably inhibited these effects (Figs. 3 and 4). In addition, Sch B markedly enhanced the Ang II-induced decrease in SIRT1 and ferroptosis (Fig. 5).

The research on Sch B’s cardioprotective effects in HL-1 cells infused with Ang II has potential implications. It indicates that Sch B can safeguard against Ang II-induced damage to endothelial cells by reducing inflammation, inhibiting apoptosis (cell death), and enhancing cell survival⁴⁰. These beneficial effects are believed to be mediated by the activation of protective pathways and a reduction in oxidative stress^40,41. However, our results showed that Sch B treatment inhibited Ang II-infused inflammation, intracellular ROS generation and oxidative stress in HL-1 cells (Figs. 7 and 8).

Ferroptosis is a distinct form of cellular death that differs morphologically, biochemically, and genetically from other cell death mechanisms. It is primarily characterized by the accumulation of iron-dependent lethal lipid ROS⁴². Glutathione peroxidase 4 (GPX4) is recognized as the only peroxidase in mammals capable of reducing phospholipid hydroperoxides found in cellular membranes, making it a crucial regulator of ferroptosis⁴³. Additionally, GPX4 activity serves as a molecular marker for this specific mode of cell death⁴⁴. Furthermore, Stockwell et al. identified the cystine/glutamate antiporter SLC7A11 (also known as xCT), which facilitates the import of cystine. This process promotes the biosynthesis of glutathione (GSH), enabling GPX4 to detoxify lipid peroxides and inhibit ferroptosis⁴⁵. Thus, SLC7A11 plays a vital role in modulating GPX4 activity, helping to protect cells from ferroptosis^42,46. However, the present showed that Sch B plays a protective role in cells, inhibiting ferroptosis in Ang II-induced HL-1 cells by activating SIRT1. SIRT1, a member of the Sirtuin family of proteins, is crucial for cellular regulation related to aging, inflammation, and stress resistance⁴⁷. The activation of SIRT1 by Sch B reduces oxidative stress and lipid peroxidation, thereby protecting cells from ferroptosis. The current investigation has uncovered promising results. It has been demonstrated that Sch B treatment effectively reduces the rise in Ferro Green-positive cells induced by Ang II infusion. Additionally, it decreases the increase in Fe2 + concentration caused by Ang II. Furthermore, Sch B significantly enhances the expression of SIRT1, SLC7A11, GPX4, and FTH1 while reducing the expression patterns by Sch B + Ex-527 treatment (Fig. 9). The research suggests that Sch B reduced ferroptosis by activating SIRT1 in Ang II-induced HL-1 cells.

In summary, this investigation demonstrated that Sch B has a protective effect against ferroptosis, atrial fibrosis, and atrial fibrillation (AF) induced by Ang II, both in vivo and in vitro (Fig. 10). Sch B inhibits Ang II-induced ferroptosis by activating SIRT1. This study offers new insights into the role of ferroptosis in the progression of atrial fibrosis and AF, providing evidence that Sch B could be a potential therapeutic target for treating AF.

Fig. 10.

Schematic diagram of Sch B on ferroptosis and AF.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

M.S. Conceptualization, Methodology, Data curation, Visualization, Investigation, Writing-original draft. Z.N. Project administration, Supervision, Funding acquisition, Resources, Writing-review & editing.

Funding

This study was supported by (1) Key Discipline Group of Discipline Construction Plan of Pudong New Area Health Commission (PWZxq2022-11); (2) Pudong New Area Health Commission Clinical Peak Discipline Construction Plan (PWYgf2021-04); (3) Key Discipline of Shanghai Health System (2024ZDXK0019).

Data availability

Due to confidentiality issues, the datasets generated and/or analyzed during the current work are not publicly available but are available from the corresponding author upon reasonable request.

Declarations

Ethics approval

This study was approved (2023-C-039-E01) by Shanghai University of Medicine and Health Science Affiliated Zhoupu Hospital Ethics Committee. The authors envisaged all standard protocols in accordance with the 1964 Declaration of Helsinki. All methods carried out in this study were in accordance with ARRIVE guidelines..

Competing interests

The authors declare no competing interests.