Abstract
Introduction
Shikonin is the major bioactive compound abundant in Lithospermum erythrorhizon and possesses diverse pharmacological properties. This study aimed to examine shikonin roles in experimental renal ischemia/reperfusion (I/R) injury.
Methods
Renal tissues and blood were collected from experimental renal I/R injury models. Kidney functions, structural injuries, and cellular death were assessed. Markers of endoplasmic reticulum (ER) stress were evaluated by RT-qPCR and Western blotting. The effect of shikonin on Sirt1/Nrf2/HO-1 signaling was detected by Western blotting and immunofluorescence staining. HK-2 cells that underwent hypoxia/reoxygenation (H/R) process were used to perform CCK-8 and flow cytometry.
Results
For in vivo analysis, renal dysfunctions and tissue structural damage induced by I/R were relieved by shikonin. Additionally, shikonin alleviated ER stress-induced apoptosis in I/R mice. For in vitro analysis, shikonin inhibited ER stress-stimulated apoptosis of H/R cells. Mechanistically, shikonin activated Sirt1/Nrf2/HO-1 signaling post-I/R, and inhibition of Sirt1 limited shikonin-mediated protection against ER stress-stimulated apoptosis in both animal and cellular models.
Conclusion
By activating Sirt1/Nrf2/HO-1 signaling, shikonin inhibits apoptosis caused by ER stress and relieves renal I/R injury.
Keywords: Renal ischemia/reperfusion injury, Shikonin, Endoplasmic reticulum stress, Apoptosis, Sirt1, Nrf2/HO-1
Introduction
Acute kidney injury (AKI) is commonly found in patients undergoing cardiac surgery, kidney transplants, and partial nephrectomy [1]. This intractable clinical event which is accompanied by urinary tract obstruction, cardiorenal syndrome, and sepsis affects 10–15% of hospitalized patients with a mortality rate over 23.9% [2, 3]. In addition to high mortality, AKI can cause end-stage renal disease directly and is a risk factor of chronic kidney disease development [4]. Currently, largely therapeutic strategies for AKI are often effective [5]. Renal ischemia/reperfusion (I/R) injury can contribute to AKI initiation. Restricted blood supply to organs is a well-established contributor of ischemia, and blood flow reperfusion in the affected ischemia paradoxically initiates reperfusion injury [6]. Although researchers have been committed to explore effective therapeutics for protecting against I/R injury-induced AKI, little work has been validated in preclinical phase [7, 8]. Hence, investigating novel therapeutic options for I/R injury is necessary.
Endoplasmic reticulum (ER) stress and abnormal apoptosis of renal tubular epithelial cells are implicated in renal I/R pathogenesis [5, 9]. The ER represents an intracellular organelle that is essential in protein synthesis and degradation [10]. Apoptosis is triggered when the protein homeostasis is impaired by the adaptive unfolded protein response pathway under excessive ER stress [11]. This ER stress blocker has been found to decrease hypoxia/reoxygenation (H/R)-stimulated damage to tubular epithelial cells and alleviate kidney damage in I/R animals [12]. Therefore, attenuation of ER stress and apoptosis is beneficial to treating renal I/R.
Shikonin, a naphthoquinone pigment isolated from Lithospermum erythrorhizon root, is contained in oriental medicines for treating wound healing and urticaria [13]. Its antioxidant, anti-atherosclerotic, antithrombotic, antiapoptotic, and anti-inflammatory properties have been well established [14–18]. According to reports, shikonin exerts renoprotective effects against high glucose-triggered cell apoptosis and oxidative stress by activating AKT signaling [19], alleviates glomerular lesions in kidneys of NZB/W F1 mice [20], and relieves sepsis-stimulated cell damage by modulating the NOX4/PTEN/AKT pathway [21]. Moreover, shikonin has been found to relieve myocardial, hepatic, and cerebral I/R injuries [22–24]. Nevertheless, whether shikonin affects renal I/R injury remains uncertain.
As an NAD+-dependent deacetylase, Sirt1 can regulate various cellular activities, including cellular stress response, energy homeostasis, gene transcription, senescence, and glucose metabolism through deacetylation of diverse factors [25–27]. Sirt1 mitigates I/R injury through diminishing ER stress [28–30]. It is shown that Sirt1 can induce nuclear translocation of Nrf2, enhance Nrf2 DNA binding and transcriptional activities, and upregulate HO-1 [31]. Reportedly, Nrf2/HO-1 signaling is an upstream regulator of ER stress during AKI [32, 33]. Shikonin has been found to upregulate Sirt1 expression in heart tissues induced by lipopolysaccharide [34]. Therefore, this study purposed to detect shikonin roles in renal I/R injury and detect whether Sirt1/Nrf2/HO-1 signaling is responsible for the renoprotective effect of shikonin.
Methods
Animals
C57BL/6 mice (male, 7–8 weeks, 23–25 g; Charles River Laboratories, Beijing, China) were housed in a SPF facility under controlled conditions (22–23°C, 50% of relative humidity, and a 12-h light/dark cycle) with 2 mice in a cage. All animals had free access to food and water. All animal experiments were conducted under the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health and approved by the Experimental Animal Ethics Committee of Quanzhou Medical College (2022030).
Experimental Design
Experimental renal I/R model was established in mice as previously documented [35]. Before surgery, mice were food-deprived for 12 h and then completely anesthetized with isoflurane (2% for induction and 1.5% for maintenance). Using a heating pad, mouse body was maintained at 36°C. After a midline laparotomy, mice underwent a right nephrectomy. Then, a noninvasive vascular clamp was used to perform left kidney ischemia for 45 min, followed by removal of the vascular clamp. Thereafter, the abdominal incision was sutured. To maintain fluid balance, mice were intraperitoneally injected with 0.5 mL PBS. After 24 h of reperfusion, mice were sacrificed by overdosed pentobarbital sodium (i.p., 200 mg/kg). Death was confirmed by termination of respiration and cardiac activity. Sham operations included all procedures except for clamping and ischemia.
Animal Treatment
Shikonin (HPLC ≥98%; MedChemExpress, Shanghai, China) were dissolved by 2% dimethyl sulfoxide (DMSO; vehicle). A preliminary study was conducted to determine the optimal dose of shikonin. Sixteen mice were randomly divided into I/R + DMSO and I/R + Shi (30, 60, or 90 mg/kg) groups with 4 mice per group. Mice were intraperitoneally injected with shikonin (30, 60, and 90 mg/kg) or DMSO for 24 h before surgery, followed by collection of blood samples and assessment of biochemical parameters. According to the evaluation result, 60 mg/kg of shikonin was chosen as the optimal dose of shikonin. Then, 30 mice were randomly allocated to sham, I/R, I/R + DMSO, I/R + Shi (60 mg/kg), I/R + 4-PBA (100 mg/kg), and I/R + Shi (60 mg/kg) + EX527 (10 mg/kg) groups with 5 mice per group. Mice in the I/R + Shi (60 mg/kg) + EX527 (10 mg/kg) received intraperitoneal injection of shikonin (60 mg/kg) and EX527 (5 mg/kg) for 24 h prior to surgery. Mice in the I/R + 4-PBA group were subjected to intraperitoneal injection of 4-PBA (100 mg/kg) for 24 h before surgery. EX527 and 4-PBA doses were selected according to previous studies [36, 37].
Assessment of Renal Function
After 24 h of reperfusion, blood samples were collected immediately and subjected to a 20-min centrifugation at 3,000 r/min. Serum levels of creatinine (Cr) and blood urea nitrogen (BUN) were measured using commercial kits (Jiancheng Bioengineering Institute, Nanjing, China).
Histopathological Changes
After being fixed in 4% paraformaldehyde and paraffin-embedded, kidney tissues were cut into 4 μm sections. Then, the sections underwent gradual deparaffinization and hydration, followed by hematoxylin and eosin (HE; Solarbio, Beijing, China) staining and Periodic acid-Schiff (PAS; Beyotime Shanghai, China). Images were observed by a light microscope (Olympus, Tokyo, Japan). Tissue damages were evaluated in a blind manner and scored on a scale of 0–4 [38] as follows: 4, more than 75% injury; 3, 50–75% injury; 2, 25–50% injury; 1, less than 25% injury; and 0, normal.
Western Blotting
Renal tissues or HK-2 cells were homogenized with RIPA lysis buffer with protease phosphatase inhibitor and protease inhibitor (Beyotime). Protein samples (20 μg/group) were separated by 10% SDS-PAGE gels and transferred onto PVDF membranes. Then, the membranes were blocked with 5% skimmed milk and incubated overnight with primary antibodies at 4°C, followed by secondary antibodies for 2 h at room temperature. Primary antibodies include antibodies against Bax (ab32503, 1:5,000; Abcam), GAPDH (ab9485, 1:2,500; Abcam, Shanghai, China), Nrf2 (#20733, 1:1,000; CST, Shanghai, China), Sirt1 (ab189494, 1:1,000; Abcam), cleaved caspase-3 (#9661, 1:1,000; CST), GRP78 (ab108615, 1:3,000; Abcam), KIM-1 (ab233720, 1:2,000; Abcam), CHOP (#2895, 1:1,000; CST), caspase-12 (sc-21747, 1:500; Santa Cruz Biotechnology, Shanghai, China), Bcl-2 (ab182858, 1:2,000; Abcam), and HO-1 (ab52947, 1:2,000; Abcam). Enhanced chemiluminescent reagents (Yeasen, Shanghai, China) and Image J software were used for Western blotting detection.
TUNEL Staining
Apoptotic cells in kidney tissues were identified by TUNEL assay using an in situ cell death detection kit (Sigma-Aldrich, Shanghai, China). Briefly, paraffined kidney sections were dewaxed, rehydrated, and then permeabilized with 0.1 m solution citrate, pH 6.0 at 37°C for 30 min. Thereafter, the sections were placed into a TUNEL reaction mixture at 37°C under humidified conditions for 1 h in the dark. The nuclei were stained with DAPI (Beyotime). A blinded investigator to experimental design counted the number of TUNEL-positive apoptotic cells in ten fields per slide (100 cells per field). The images were photographed via a fluorescence microscope. Data were analyzed using ImageJ software.
RT-qPCR
Total RNA was purified from frozen kidney tissues or HK-2 cells using TRIzol reagent (Absin, Shanghai, China), and 1 μg samples were reverse transcribed into cDNA via a reverse transcription kit (Sigma-Aldrich, Shanghai, China). The cDNA served as a template for the PCR reaction, which was performed using GoTaq polymerase (Promega, Beijing, China) and primers. The RT-qPCR was carried out on the thermal cycler (Bio-Rad, Richmond, CA, USA) and on the ABI PRISM 7000 Sequence Detection System using SensiFAST SYBR Hi-ROX Mix (Bioline, London, UK). GAPDH was used as endogenous references for mRNA detection. Data were calculated using the 2−△△CT method [39]. The primer sequences are listed in Table 1.
Table 1.
Sequences of primers used for reverse transcription-quantitative PCR
| Gene (human) | Sequence (5′→3′) |
|---|---|
| GRP78 forward | CACGGTCTTTGACGCCAAG |
| GRP78 reverse | CCAAATAAGCCTCAGCGGTTT |
| CHOP forward | GGAAACAGAGTGGTCATTCCC |
| CHOP reverse | CTGCTTGAGCCGTTCATTCTC |
| Caspase-12 forward | AACAACCGTAACTGCCAGAGT |
| Caspase-12 reverse | CTGCACCGGCTTTTCCACT |
| GAPDH forward | ACAACTTTGGTATCGTGGAAGG |
| GAPDH reverse | GCCATCACGCCACAGTTTC |
| Gene (mice) | Sequence (5′→3′) |
|---|---|
| GRP78 forward | ACTTGGGGACCACCTATTCCT |
| GRP78 reverse | ATCGCCAATCAGACGCTCC |
| CHOP forward | CTGGAAGCCTGGTATGAGGAT |
| CHOP reverse | CAGGGTCAAGAGTAGTGAAGGT |
| Caspase-12 forward | AGACAGAGTTAATGCAGTTTGCT |
| Caspase-12 reverse | TTCACCCCACAGATTCCTTCC |
| GAPDH forward | AGGTCGGTGTGAACGGATTTG |
| GAPDH reverse | TGTAGACCATGTAGTTGAGGTCA |
Cell Culture and Treatment
HK-2 cells (Procell, Wuhan, China) were incubated in DMEM (Solarbio) supplemented with 50 ng/mL human recombinant epidermal growth factor, 10% FBS, 100 μg/mL streptomycin, 100 U/mL penicillin, 0.05 mg/mL bovine pituitary extract, and nonessential amino acids under 5% CO2 at 37°C. Cellular model of H/R was constructed as previously documented [40]. The HK-2 cells were seeded in 35 mm dishes (1 × 106 cells/dish), and after reaching 90% confluence, the cells were cultured under hypoxic conditions (1% O2, 94% N2, and 5% CO2) for 12 h in glucose- and serum-free medium for hypoxia, followed by reoxygenation through incubating in regular culture medium with oxygen for 2 h. The cells were pretreated with shikonin (25, 50, 100, and 200 μm), 4-PBA (5 mm, dilution in DMSO) or EX527 (20 mm, dilution in DMSO) for 12 h prior to H/R induction. Control cells were incubated in complete culture medium in a regular incubator (5% CO2 and 95% air). The dosages of 4-PBA and EX527 were selected as previously documented [41, 42].
CCK-8 Assays
The cytotoxicity of shikonin was assessed by CCK-8 assays. HK-2 cells were cultured in 96-well plates (1 × 104 cells/well) and exposed to shikonin (0–400 μm) overnight. After indicated treatment, 100 μL medium-containing 10 μL CCK-8 solution (Beyotime) was added and incubated for 2 h at 37°C in 5% CO2. Absorbance at 450 nm was read using a microplate reader (Molecular Devices, Shanghai, China).
Flow Cytometry
HK-2 cells with indicated pretreatments were washed trice in PBS, and 5 × 103 cells were collected, followed by being resuspended in 500 μL of binding buffer. Then, cells were incubated with 20 μL propidium iodide and 10 μL Annexin V-FITC (Beyotime) for 15 min in the dark at 37°C. The apoptotic cells were detected using the FACS flow cytometer (BD Biosciences, Shanghai, China).
Immunofluorescence Staining
Immunofluorescence staining on kidney sections or cells was carried out to analyze the expression of Sirt1 and Nrf2 using anti-Sirt1 antibody (ab189494, 1:100; Abcam) and anti-Nrf2 antibody (ab137550, 1:500; Abcam) in a humidified chamber overnight at 4°C. Then, they were incubated with secondary antibodies for 1 h. Cell nuclei was stained with DAPI. Immunostained images were obtained with a confocal microscope. Nrf2 intensity was quantified using Image-Pro Plus software.
Statistics Analysis
Data were analyzed by GraphPad Prism 8.0 software (GraphPad Inc., San Diego, CA, USA) and described as the mean ± standard deviation. Student’s t test and one-way analysis of variance were conducted to compare differences. P < 0.05 was considered statistically significant.
Results
Shikonin Ameliorates I/R-Caused Renal Dysfunctions and Acute Tubular Damage
The experimental design of drug administration and renal surgery was presented in Figure 1a. After 24 h of reperfusion, serum and kidney tissues were collected. I/R significantly augmented Cr and BUN levels in serum, whereas pretreatment with shikonin counteracted the I/R-induced promotion in serum Cr and BUN levels dose-dependently (Fig. 1b, c). Notably, the greatest protective impact of shikonin was observed at 60 mg/kg; thus, shikonin (60 mg/kg) was used for subsequent studies. Then, as shown by HE staining, sham group exhibited basically normal kidney tissues. However, I/R group had acute tubular damages, including tubular dilatation, tubular epithelium swelling, brush border collapse, epithelial cell necrosis, as well as tubular pattern formation. Shikonin treatment greatly mitigated tubular injury and partially recovered renal structure to normal (Fig. 1d, e). The shikonin-induced attenuation in tubular structural abnormalities was validated by PAS staining (Fig. 1f, g). Moreover, Western blotting demonstrated that kidney injury molecule 1 (KIM-1) protein level was markedly elevated post-I/R, whereas administration of shikonin abolished the elevation (Fig. 1h).
Fig. 1.
Shikonin ameliorates renal dysfunctions in experimental I/R. a Schematic diagram depicting the process of drug administration and renal surgery. b Serum Cr, n = 4. c Serum BUN, n = 4. d Representative images of HE-stained renal tissues. e Quantification of kidney injury scores, n = 5. f Representative images of PAS-stained renal tissues. g Quantification of tubular injury scores, n = 5. h Western blotting of KIM-1 protein level, n = 3. Data are expressed as mean ± standard deviation. *p < 0.05 versus sham group; #p < 0.05 versus I/R group.
Shikonin Alleviates ER Stress-Triggered Apoptosis in Experimental I/R
As TUNEL revealed, the increased number of TUNEL-positive cells in I/R mice greatly decreased by shikonin treatment (Fig. 2a, b). Then, as shown by Western blotting, I/R modeling significantly increased Bax and cleaved caspase-3 protein levels while reducing Bcl-2 protein level, whereas pretreatment of shikonin reversed the effect of I/R (Fig. 2c). Next, expression of GRP78, CHOP, and caspase-12 was measured by RT-qPCR and Western blotting. Their mRNA and protein levels were remarkably upregulated following I/R injury, which were significantly lessened by shikonin (Fig. 2d–g). Moreover, the antiapoptotic effect of 4-PBA (an ER stress inhibitor) was evidenced by reduced Bax and cleaved caspase-3 protein levels and upregulated Bcl-2 protein level (Fig. 2h, i).
Fig. 2.
Shikonin alleviates ER stress-stimulated apoptosis in I/R model. a Representative images of TUNEL-stained kidney sections. b Quantification of the percent of TUNEL-positive cells. c Western blotting of Bax, Bcl-2, and cleaved caspase-3 protein levels, n = 3. RT-qPCR of GRP78 (d), CHOP (e), and caspase-12 mRNA (f) levels. g Western blotting of GRP78, CHOP, and caspase-12 protein levels. h, i Western blotting of ER stress-related proteins and apoptosis-related proteins in the sham, I/R, I/R + DMSO, and I/R + 4-PBA (100 mg/kg) groups. Data are expressed as mean ± standard deviation, n = 3. *p < 0.05 versus sham group; #p < 0.05 versus I/R group.
Shikonin Activates Sirt1/Nrf2/HO-1 Signaling in Experimental I/R
As Western blotting revealed, I/R injury dramatically downregulated Sirt1, Nrf2, and HO-1 protein levels, which increased by shikonin. By contrast, EX527 effectively reduced Sirt1, Nrf2, and HO-1 protein levels (Fig. 3a). Additionally, immunofluorescence staining showed that shikonin abolished the suppressive effect of I/R injury on Sirt1 expression, whereas EX527 significantly downregulated Sirt1 expression (Fig. 3b).
Fig. 3.
Shikonin activates Sirt1/Nrf2/HO-1 signaling in I/R model. a Western blotting of Sirt1, Nrf2, and HO-1 protein levels. b Immunofluorescence staining of Sirt1. Data are expressed as mean ± standard deviation, n = 3. *p < 0.05 versus sham group; #p < 0.05 versus I/R group; &p < 0.05 versus I/R + Shi group.
Sirt1 Inhibition Limits the Protective Effect of Shikonin
Administration of EX527 attenuated the inhibitory function of shikonin in Cr and BUN serum levels in I/R mice (Fig. 4a, b). As shown by HE and PAS staining, the shikonin-mediated protection against acute tubular damage was limited by EX527 (Fig. 4c–f). Moreover, EX527 significantly abolished the shikonin-induced inhibition in ER stress-related proteins (Fig. 4g). Finally, Western blotting results showed that EX527 increased Bax and cleaved caspase-3 protein levels while decreasing Bcl-2 protein level compared with the shikonin group (Fig. 4h).
Fig. 4.
Inhibition of Sirt1 limits the renoprotective effect of shikonin. a Serum Cr, n = 5. b Serum BUN, n = 5. Renal tissues were stained by kidney injury score (c) and HE (d) was evaluated, n = 5. Renal tissues were stained by PAS (e) and tubular injury score (f) was measured, n = 5. g Western blotting of GRP78, CHOP, and caspase-12 protein levels, n = 3. h Western blotting of Bax, Bcl-2, and cleaved caspase-3 protein levels, n = 3. Data are expressed as mean ± standard deviation. *p < 0.05 versus sham group; #p < 0.05 versus I/R group; &p < 0.05 versus I/R + Shi group.
Shikonin Inhibits ER Stress-Stimulated Apoptosis of H/R-Challenged HK-2 Cells
As CCK-8 assays revealed, 0–200 μm shikonin did not impair cell viability (Fig. 5a). Then, HK-2 cells were pretreated with 0–200 μm shikonin for 12 h prior to H/R induction. CCK-8 assays revealed that 100 μm shikonin showed the optimal protective effect on cell viability (Fig. 5b). Thus, HK-2 cells treated with 100 μm shikonin were used for subsequent studies. H/R exposure significantly increased GRP78, CHOP, and caspase-12 mRNA and protein levels, whereas shikonin or 4-PBA reduced their expression in H/R-challenged cells (Fig. 5c–f). Then, as flow cytometry revealed, cellular apoptosis significantly increased after H/R exposure, which was relieved by shikonin and 4-PBA (Fig. 5g, h). Concomitantly, Western blotting analysis confirmed the above experimental outcomes. We found that shikonin and 4-PBA remarkably reversed the effect of H/R on increasing Bax and cleaved caspase-3 protein levels and decreasing Bcl-2 protein level (Fig. 5i).
Fig. 5.
Shikonin inhibits ER stress-induced apoptosis of H/R-exposed HK-2 cells. a HK-2 cells treated with 0–400 μm shikonin were subjected to CCK-8 assays. b HK-2 cells exposed to 25–200 μm shikonin under H/R conditions were used for CCK-8 assays. RT-qPCR of GRP78 (c), CHOP (d), and caspase-12 mRNA (e) levels. f Western blotting of GRP78, CHOP, and caspase-12 protein levels. g, h Flow cytometry of cell apoptosis. i Western blotting of Bax, Bcl-2, and cleaved caspase-3 protein levels. Data are expressed as mean ± standard deviation of three independent experiments. *p < 0.05 versus control group; #p < 0.05 versus H/R group.
Inhibition of Sirt1 Attenuates the Shikonin-Mediated Protection against ER Stress-Induced Apoptosis in vitro
As Western blotting revealed, Sirt1, Nrf2, and HO-1 protein levels markedly decreased in response to H/R. By contrast, shikonin pretreatment upregulated their protein levels under H/R conditions, which were then suppressed by EX527 (Fig. 6a). Immunofluorescence staining demonstrated that shikonin enhanced the nuclear translocation of Nrf2, which was counteracted by EX527 (Fig. 6b). Finally, Western blotting revealed that EX527 abolished the effect of shikonin on downregulating GRP78, CHOP, caspase-12, Bax, and cleaved caspase-3 protein levels and increasing Bcl-2 protein level (Fig. 6c, d). Figure 7 presents the schematic diagram illustrating how shikonin relieves renal I/R injury. Shikonin pretreatment alleviates renal I/R injury through activating Sirt1/Nrf2/HO-1 signaling to inhibit ER stress-mediated apoptosis.
Fig. 6.
Inhibition of Sirt1 attenuates the shikonin-mediated suppression in ER stress-induced cell apoptosis. a Western blotting Sirt1, Nrf2 and HO-1 protein levels. b Immunofluorescence staining of Nrf2. c Western blotting of GRP78, CHOP and caspase-12 protein levels. d Western blotting of Bax, Bcl-2, and cleaved caspase-3 protein levels. Data are expressed as mean ± standard deviation of three independent experiments. *p < 0.05 versus control group; #p < 0.05 versus H/R group; &p < 0.05 versus H/R + Shi group.
Fig. 7.
Scientific diagram. Shikonin pretreatment activates Sirt1/Nrf2/HO-1 signaling to inhibit ER stress, thus preventing apoptosis to exert its renoprotective effect on renal I/R injury.
Discussion
Shikonin is a natural product with many pharmacological benefits. In this study, we investigated shikonin roles and mechanisms in experimental I/R. Recently, many surgical models have received scientific attention for studying renal I/R injury [43]. The unilateral I/R injury with contralateral nephrectomy model possesses some notable merits [44–47], such as less variability and longer ischemic window to induce consistent kidney injury than the unilateral I/R injury model and the unilateral I/R injury without nephrectomy model. In this study, we used the unilateral I/R injury with contralateral nephrectomy model. We found that shikonin significantly alleviated renal dysfunctions and acute tubular damage in mice. Additionally, the renoprotective effect of shikonin was confirmed in vitro.
Apoptosis, a form of programmed cell death, is well recognized in renal I/R injury. Increasing evidence has suggested the significant role of ER stress in apoptosis [48, 49]. BiP/GRP78, an element of unfolded protein response, binds to major transmembrane protein sensors of ER stress in ER lumen [50]. CHOP-mediated and Ca2+-mediated pathways are found to play important roles in ER stress-mediated apoptosis. CHOP, a bZIP transcription factor, can initiate the apoptotic cascade by upregulating proapoptotic genes and downregulating antiapoptotic genes [51]. Ca2+ releasing from ER to mitochondria results in caspase-12 activation [52]. 4-PBA can decrease ER stress overload and suppress signal induction of ER stress [53]. Here, we found that inhibiting ER stress using 4-PBA could decrease Bax and cleaved caspase-3 protein levels and increase Bcl-2 protein level in animal and cellular models of I/R, suggesting that attenuation of ER stress can inhibit HK-2 cell apoptosis. The suppressive effect of shikonin on ER stress and apoptosis has been reported previously. For example, shikonin can inhibit neuronal apoptosis in rat model of chronic cervical cord compression by inhibiting ER stress [54]. Additionally, shikonin is found to ameliorate isoproterenol-induced myocardial damage through preventing ER stress and apoptosis [55]. The current study revealed that shikonin significantly downregulated GRP78, CHOP, caspase-12, Bax, and cleaved caspase-3 proteins levels in renal tissues of I/R mice and H/R-challenged HK-2 cells, indicating that shikonin can prevent apoptosis and ER stress pose-I/R.
Then, we uncovered the underlying mechanisms. Inhibition of Sirt1 can exacerbate I/R-induced ER stress [29], while activation of Sirt1 reduces cell apoptosis induced by H/R and attenuates renal injury after I/R [30, 56]. Sirt1 can induce Nrf2 nuclear translocation, promote Nrf2 transcription, and increase HO-1 level [31]. Shikonin can upregulate Sirt1 in heart tissues induced by lipopolysaccharide [34]. The current study revealed that shikonin significantly increased Sirt1, Nrf2, and HO-1 expression in experimental renal I/R injury models. EX527, a Sirt1 inhibitor, reversed the renoprotective effect of shikonin after I/R.
Limitations existed in this study. First, due to first passage metabolism by the liver or poor absorption from the serosa to the circulation, the renal concentration of shikonin that was intraperitoneally injected into mice was limited. Second, experiments were performed at a single time point. Third, whether other molecular mechanisms are involved in the renoprotective effect of shikonin is unknown. These limitations require to be addressed in the future.
Collectively, this study indicates that shikonin relieves renal I/R injury by activating Sirt1/Nrf2/HO-1 signaling to prevent ER stress-triggered apoptosis. This study suggests that shikonin would be an effective agent in treating renal I/R injury.
Acknowledgments
The authors appreciate the help of First Hospital of Quanzhou Affiliated to Fujian Medical College.
Statement of Ethics
All animal experiments were conducted under the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health and approved by the Experimental Animal Ethics Committee of Quanzhou Medical College (2022030).
Conflict of Interest Statement
The authors declare that they have no competing interests.
Funding Sources
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
Author Contributions
Qian Huang conceived and designed the experiments. Qian Huang, Zilu Shi, Dandan Zheng, Huiqin Chen, and Qiuhong Huang carried out the experiments. Qian Huang and Zilu Shi analyzed the data. Qian Huang and Zilu Shi drafted the manuscript. All authors agreed to be accountable for all aspects of the work. All authors have read and approved the final manuscript.
Funding Statement
This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.
Data Availability Statement
The datasets used or analyzed during the current study could compromise the privacy of research but are available from the corresponding author (Z.S.).
References
- 1. Kosieradzki M, Rowiński W. Ischemia/reperfusion injury in kidney transplantation: mechanisms and prevention. Transplant Proc. 2008;40(10):3279–88. [DOI] [PubMed] [Google Scholar]
- 2. Ronco C, Bellomo R, Kellum JA. Acute kidney injury. Lancet. 2019;394(10212):1949–64. [DOI] [PubMed] [Google Scholar]
- 3. Rewa O, Bagshaw SM. Acute kidney injury-epidemiology, outcomes and economics. Nat Rev Nephrol. 2014;10(4):193–207. [DOI] [PubMed] [Google Scholar]
- 4. Sharfuddin AA, Molitoris BA. Pathophysiology of ischemic acute kidney injury. Nat Rev Nephrol. 2011;7(4):189–200. [DOI] [PubMed] [Google Scholar]
- 5. Han SJ, Lee HT. Mechanisms and therapeutic targets of ischemic acute kidney injury. Kidney Res Clin Pract. 2019;38(4):427–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Eltzschig HK, Eckle T. Ischemia and reperfusion: from mechanism to translation. Nat Med. 2011;17(11):1391–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Zhang Y, Zhang JJ, Liu XH, Wang L. CBX7 suppression prevents ischemia-reperfusion injury-induced endoplasmic reticulum stress through the Nrf-2/HO-1 pathway. Am J Physiol Renal Physiol. 2020;318(6):F1531–8. [DOI] [PubMed] [Google Scholar]
- 8. Wang L, Chen Z, Weng X, Wang M, Du Y, Liu X. Combined ischemic postconditioning and ozone postconditioning provides synergistic protection against renal ischemia and reperfusion injury through inhibiting pyroptosis. Urology. 2019;123:296.e1–8. [DOI] [PubMed] [Google Scholar]
- 9. He L, Wei Q, Liu J, Yi M, Liu Y, Liu H, et al. AKI on CKD: heightened injury, suppressed repair, and the underlying mechanisms. Kidney Int. 2017;92(5):1071–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Bravo R, Parra V, Gatica D, Rodriguez AE, Torrealba N, Paredes F, et al. Endoplasmic reticulum and the unfolded protein response: dynamics and metabolic integration. Int Rev Cell Mol Biol. 2013;301:215–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Zhao L, Ackerman SL. Endoplasmic reticulum stress in health and disease. Curr Opin Cell Biol. 2006;18(4):444–52. [DOI] [PubMed] [Google Scholar]
- 12. Wang X, Zhang Y, Wuyun K, Gong H. Therapeutic effect and mechanism of 4-phenyl butyric acid on renal ischemia-reperfusion injury in mice. Exp Ther Med. 2022;23(2):144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Papageorgiou VP, Assimopoulou AN, Ballis AC. Alkannins and shikonins: a new class of wound healing agents. Curr Med Chem. 2008;15(30):3248–67. [DOI] [PubMed] [Google Scholar]
- 14. Tanaka S, Tajima M, Tsukada M, Tabata M. A comparative study on anti-inflammatory activities of the enantiomers, shikonin and alkannin. J Nat Prod. 1986;49(3):466–9. [DOI] [PubMed] [Google Scholar]
- 15. Kourounakis AP, Assimopoulou AN, Papageorgiou VP, Gavalas A, Kourounakis PN. Alkannin and shikonin: effect on free radical processes and on inflammation: a preliminary pharmacochemical investigation. Arch Pharm. 2002;335(6):262–6. [DOI] [PubMed] [Google Scholar]
- 16. Esmaeilzadeh E, Gardaneh M, Gharib E, Sabouni F. Shikonin protects dopaminergic cell line PC12 against 6-hydroxydopamine-mediated neurotoxicity via both glutathione-dependent and independent pathways and by inhibiting apoptosis. Neurochem Res. 2013;38(8):1590–604. [DOI] [PubMed] [Google Scholar]
- 17. Han T, Zhang G, Yan D, Yang H, Ma T, Ye Z. Modulation of plasminogen activator inhibitor-1 (PAI-1) by the naphthoquinone shikonin. Fitoterapia. 2016;113:117–22. [DOI] [PubMed] [Google Scholar]
- 18. Lü SL, Dang GH, Deng JC, Liu HY, Liu B, Yang J, et al. Shikonin attenuates hyperhomocysteinemia-induced CD4(+) T cell inflammatory activation and atherosclerosis in ApoE(-/-) mice by metabolic suppression. Acta Pharmacol Sin. 2020;41(1):47–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Tong Y, Chuan J, Bai L, Shi J, Zhong L, Duan X, et al. The protective effect of shikonin on renal tubular epithelial cell injury induced by high glucose. Biomed Pharmacother. 2018;98:701–8. [DOI] [PubMed] [Google Scholar]
- 20. Wang XC, Feng J, Huang F, Fan YS, Wang YY, Cao LY, et al. Effects of shikonin isolated from zicao on lupus nephritis in NZB/W F1 mice. Biol Pharm Bull. 2009;32(9):1565–70. [DOI] [PubMed] [Google Scholar]
- 21. Peng Y, Li Y, Li H, Yu J. Shikonin attenuates kidney tubular epithelial cells apoptosis, oxidative stress, and inflammatory response through nicotinamide adenine dinucleotide phosphate oxidase 4/PTEN pathway in acute kidney injury of sepsis model. Drug Dev Res. 2022;83(5):1111–24. [DOI] [PubMed] [Google Scholar]
- 22. Liu T, Ling C, Tian J, Ma F. Protective effect of shikonin in myocardial ischemia/reperfusion injury in rats by inhibition of autophagy through the Hippo pathway. Biochem Biophys Res Commun. 2022;613:87–93. [DOI] [PubMed] [Google Scholar]
- 23. Liu T, Zhang Q, Mo W, Yu Q, Xu S, Li J, et al. The protective effects of shikonin on hepatic ischemia/reperfusion injury are mediated by the activation of the PI3K/Akt pathway. Sci Rep. 2017;7:44785. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Wang Z, Liu T, Gan L, Wang T, Yuan X, Zhang B, et al. Shikonin protects mouse brain against cerebral ischemia/reperfusion injury through its antioxidant activity. Eur J Pharmacol. 2010;643(2–3):211–7. [DOI] [PubMed] [Google Scholar]
- 25. Martínez-Redondo P, Vaquero A. The diversity of histone versus nonhistone sirtuin substrates. Genes Cancer. 2013;4(3–4):148–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Yang KE, Jang HJ, Hwang IH, Hong EM, Lee MG, Lee S, et al. Stereoisomer-specific ginsenoside 20(S)-Rg3 reverses replicative senescence of human diploid fibroblasts via Akt-mTOR-Sirtuin signaling. J Ginseng Res. 2020;44(2):341–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Bonkowski MS, Sinclair DA. Slowing ageing by design: the rise of NAD(+) and sirtuin-activating compounds. Nat Rev Mol Cell Biol. 2016;17(11):679–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Chen Y, Liu H, Zheng X, Wang J, Wang L, Yang J. Sirt1 ameliorates renal ischemia-reperfusion injury through suppressing endoplasmic reticulum stress-mediated autophagy. Am J Transl Res. 2022;14(5):3419–29. [PMC free article] [PubMed] [Google Scholar]
- 29. Zhang J, Wang L, Gong D, Yang Y, Liu X, Chen Z. Inhibition of the Sirt1 signaling pathway exacerbates endoplasmic reticulum stress induced by renal ischemia/reperfusion injury in type 1 diabetic rats. Mol Med Rep. 2020;21(2):695–704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Gong L, He J, Sun X, Li L, Zhang X, Gan H. Activation of sirtuin1 protects against ischemia/reperfusion-induced acute kidney injury. Biomed Pharmacother. 2020;125:110021. [DOI] [PubMed] [Google Scholar]
- 31. Huang K, Huang J, Xie X, Wang S, Chen C, Shen X, et al. Sirt1 resists advanced glycation end products-induced expressions of fibronectin and TGF-β1 by activating the Nrf2/ARE pathway in glomerular mesangial cells. Free Radic Biol Med. 2013;65:528–40. [DOI] [PubMed] [Google Scholar]
- 32. Zhao W, Huang X, Zhang L, Yang X, Wang L, Chen Y, et al. Penehyclidine hydrochloride pretreatment ameliorates rhabdomyolysis-induced AKI by activating the Nrf2/HO-1 pathway and alleviating [corrected] endoplasmic reticulum stress in rats. The. PLoS One. 2016;11(3):e0151158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Zhang GZ, Zhang K, Yang SQ, Zhang Z, Chen S, Hou BJ, et al. VASPIN reduces inflammation and endoplasmic reticulum stress of renal tubular epithelial cells by inhibiting HMGB1 and relieves renal ischemia-reperfusion injury. Eur Rev Med Pharmacol Sci. 2020;24(17):8968–77. [DOI] [PubMed] [Google Scholar]
- 34. Guo T, Jiang ZB, Tong ZY, Zhou Y, Chai XP, Xiao XZ. Shikonin ameliorates LPS-induced cardiac dysfunction by sirt1-dependent inhibition of NLRP3 inflammasome. Front Physiol. 2020;11:570441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Liu H, Wang L, Weng X, Chen H, Du Y, Diao C, et al. Inhibition of Brd4 alleviates renal ischemia/reperfusion injury-induced apoptosis and endoplasmic reticulum stress by blocking FoxO4-mediated oxidative stress. Redox Biol. 2019;24:101195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Chien LH, Wu CT, Deng JS, Jiang WP, Huang WC, Huang GJ. Salvianolic acid C protects against cisplatin-induced acute kidney injury through attenuation of inflammation, oxidative stress and apoptotic effects and activation of the CaMKK-AMPK-sirt1-associated signaling pathway in mouse models. Antioxidants. 2021;10(10):1620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Sun Y, Kang J, Tao Z, Wang X, Liu Q, Li D, et al. Effect of endoplasmic reticulum stress-mediated excessive autophagy on apoptosis and formation of kidney stones. Life Sci. 2020;244:117232. [DOI] [PubMed] [Google Scholar]
- 38. Jablonski P, Howden BO, Rae DA, Birrell CS, Marshall VC, Tange J. An experimental model for assessment of renal recovery from warm ischemia. Transplantation. 1983;35(3):198–204. [DOI] [PubMed] [Google Scholar]
- 39. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
- 40. Tang TT, Lv LL, Pan MM, Wen Y, Wang B, Li ZL, et al. Hydroxychloroquine attenuates renal ischemia/reperfusion injury by inhibiting cathepsin mediated NLRP3 inflammasome activation. Cell Death Dis. 2018;9(3):351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Dong SJ, Gao XY, Pei MX, Luo T, Fan D, Chen YL, et al. Effects and mechanism of salvianolic acid B on the injury of human renal tubular epithelial cells induced by iopromide. Front Pharmacol. 2021;12:761908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Xia DY, Yuan JL, Jiang XC, Qi M, Lai NS, Wu LY, et al. Sirt1 promotes M2 microglia polarization via reducing ROS-mediated NLRP3 inflammasome signaling after subarachnoid hemorrhage. Front Immunol. 2021;12:770744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Harwood R, Bridge J, Ressel L, Scarfe L, Sharkey J, Czanner G, et al. Murine models of renal ischemia reperfusion injury: an opportunity for refinement using noninvasive monitoring methods. Physiol Rep. 2022;10(5):e15211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Lech M, Avila-Ferrufino A, Allam R, Segerer S, Khandoga A, Krombach F, et al. Resident dendritic cells prevent postischemic acute renal failure by help of single Ig IL-1 receptor-related protein. J Immunol. 2009;183(6):4109–18. [DOI] [PubMed] [Google Scholar]
- 45. Yang L, Besschetnova TY, Brooks CR, Shah JV, Bonventre JV. Epithelial cell cycle arrest in G2/M mediates kidney fibrosis after injury. Nat Med. 2010;16(5):535–143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Finn WF. Enhanced recovery from postischemic acute renal failure. Micropuncture studies in the rat. Circ Res. 1980;46(3):440–8. [DOI] [PubMed] [Google Scholar]
- 47. Finn WF, Fernandez-Repollet E, Goldfarb D, Iaina A, Eliahou HE. Attenuation of injury due to unilateral renal ischemia: delayed effects of contralateral nephrectomy. J Lab Clin Med. 1984;103(2):193–203. [PubMed] [Google Scholar]
- 48. Wang Z, Zhang H, Xu X, Shi H, Yu X, Wang X, et al. bFGF inhibits ER stress induced by ischemic oxidative injury via activation of the PI3K/Akt and ERK1/2 pathways. Toxicol Lett. 2012;212(2):137–46. [DOI] [PubMed] [Google Scholar]
- 49. Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol. 2012;13(2):89–102. [DOI] [PubMed] [Google Scholar]
- 50. Friedlander R, Jarosch E, Urban J, Volkwein C, Sommer T. A regulatory link between ER-associated protein degradation and the unfolded-protein response. Nat Cell Biol. 2000;2(7):379–84. [DOI] [PubMed] [Google Scholar]
- 51. Oyadomari S, Mori M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 2004;11(4):381–9. [DOI] [PubMed] [Google Scholar]
- 52. Nakagawa T, Zhu H, Morishima N, Li E, Xu J, Yankner BA, et al. Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature. 2000;403(6765):98–103. [DOI] [PubMed] [Google Scholar]
- 53. Zeng M, Sang W, Chen S, Chen R, Zhang H, Xue F, et al. 4-PBA inhibits LPS-induced inflammation through regulating ER stress and autophagy in acute lung injury models. Toxicol Lett. 2017;271:26–37. [DOI] [PubMed] [Google Scholar]
- 54. Yao M, Li G, Zhou LY, Zheng Z, Sun YL, Liu SF, et al. Shikonin inhibits neuronal apoptosis via regulating endoplasmic reticulum stress in the rat model of double-level chronic cervical cord compression. Cell Biol Toxicol. 2023;39(3):907–28. [DOI] [PubMed] [Google Scholar]
- 55. Yang J, Wang Z, Chen DL. Shikonin ameliorates isoproterenol (ISO)-induced myocardial damage through suppressing fibrosis, inflammation, apoptosis and ER stress. Biomed Pharmacother. 2017;93:1343–57. [DOI] [PubMed] [Google Scholar]
- 56. Khader A, Yang WL, Kuncewitch M, Jacob A, Prince JM, Asirvatham JR, et al. Sirtuin 1 activation stimulates mitochondrial biogenesis and attenuates renal injury after ischemia-reperfusion. Transplantation. 2014;98(2):148–56. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used or analyzed during the current study could compromise the privacy of research but are available from the corresponding author (Z.S.).







