Indole-3-carbinol prevented tumor progression and potentiated PD1ab therapy by upregulating PTEN in colorectal cancer

Abstract

Purpose

Colorectal cancer (CRC) is among the most common malignant tumors worldwide, posing a significant threat to human health. Most patients with CRC are refractory to existing treatment regimens, such as immune checkpoint blockades (ICBs), yielding unsatisfactory outcomes. This study aimed to explore the effect and mechanism of a natural product, indole-3-carbinol (I3C), in CRC pathogenesis and immunotherapy.

Methods

A series of in vitro experiments, such as the cell counting kit-8 and wound healing assays, were used to assess the proliferative, colony-formating and migratory capacity of human CRC cells after I3C treatment. In vivo experiment, xenograft growth assay was conducted to verify the effect of I3C on CRC. Hematoxylin–eosin (HE) staining was utilized to evaluated the toxic effect of I3C. Immunohistochemical staining was used to detect CD8⁺ T cell infiltration. Subcutaneous CRC models constructed in immunocompetent mice were used to test the effects of I3C treatment in combination with PD1ab therapy. The Human Protein Atlas (HPA) database, cell transfection, and quantitative real-time polymerase chain reaction (RT-qPCR) experiments were used to explore the mechanism of I3C in CRC.

Results

I3C significantly inhibited CRC cell proliferation, colony formation, and migration capacity in vitro and in vivo. The result of HE staining indicated that I3C exert no significant toxic effect on heart, liver and kidney. HPA data analysis and RT-qPCR results demonstrated that PTEN expression was lower in CRC tissues than in normal tissues or cells. Besides, I3C exerted antitumor activity and promoted CD8⁺ T cell infiltration by upregulating PTEN expression. Consequently, I3C, in conjunction with PD1ab therapy, synergistically enhanced the antitumor effect on CRC in immunocompetent mice.

Conclusions

These findings suggested that by upregulating PTEN expression, the natural product I3C strongly prevented tumor progression and exerted no systematic toxicity in the major organs such as heart, kidney and liver. Furthermore, I3C significantly enhanced PD1ab therapeutic effect in CRC, highlighting its role as a candidate preventive or therapeutic compound for CRC therapy, especially in combination with PD1ab therapy. Further clinical trial should be conducted in the future.

Supplementary Information

The online version contains supplementary material available at 10.1007/s12672-025-01887-8.

Introduction

Colorectal cancer (CRC) is among the most common malignant tumors worldwide and poses a significant threat to human health. According to the survey results of the International Agency for Research on Cancer of the World Health Organization in 2020, there were 19.29 million new cancer cases worldwide in 2020, among which the number of new cases of CRC was 1.93 million, ranking third in the number of new cases. In 2020, there will be 9.96 million cancer deaths worldwide, among which the number of CRC deaths will be 940,000, ranking second [1]. Despite significant improvements in early screening, most CRC cases are still diagnosed at an advanced stage. For many years, the only approved first- and second-line treatment options for CRC have been surgical intervention and chemotherapy regimens combined with anti-epidermal growth factor receptor or vascular endothelial growth factor antibodies when indicated, and treatment regimens remain unsatisfactory. For advanced metastatic CRC, the 5-year survival rate after diagnosis is about 10% [2]. Therefore, new treatment options are urgently required to improve the survival rate of patients.

Immune checkpoint inhibitors are a promising therapeutic strategy to stimulate the patient's antitumor immunity. Targeting programmed cell death protein 1 (PD1) antibodies, pabolizumab and nebuliumab were approved as monotherapies or in combination with the anti-cytotoxic T lymphocyte-associated protein 4 (CTLA4) antibody ipilimumab in patients with CRC with high microsatellite instability (MSI-H)/mismatch repair gene deficiency (dMMR) [3]. PD1 is expressed on T cells and binds to tumor and immune cells to express two receptors, PD-L1 and PD-L2. The binding of PD1 and PD-L1 can inhibit the activation of effector T cells and induce T cell failure. Blocking this pathway with anti-PD1/PD-L1 antibodies can reactivate T cells to restore their effector functions, thus enhancing antitumor immunity [4]. Many CRCs are characterized by mismatch repair gene integrity (pMMR) and microsatellite stabilization (MSS). Microsatellites are regions of the genome with multiple short tandem DNA repeats, which are prone to insertion or deletion of DNA bases during DNA replication due to slippage and errors of DNA polymerase, resulting in MSI-H [5]. Because the MMR system is vital for identifying and correcting these errors, MMR system defects increase and accumulate frameshift mutations that produce large amounts of immunogenic neoantigens that excite T cells and recruit T cells in tumors. Among patients with metastatic colorectal cancer (mCRC), pMMR/MSS cancer accounts for 95% of mCRC cases [6]. Compared to dMMR/MSI-H, tumors with the pMMR/MSS phenotype typically exhibit a lower tumor mutation load and fewer tumor-infiltrating lymphocytes, resulting in immune tolerance and evasion of the tumor microenvironment [7]. This type of single-agent immunotherapy has a poor response [8]. Consequently, identifying new drugs combined with immunotherapy to enhance antitumor efficacy is particularly urgent and important.

Naturally derived indole compounds have exhibited great anticancer potential because of their availability and low toxicity. Indole alkaloids such as vincristine and vincristine have been widely used to treat tumor diseases [9, 10]. The indole-based protein kinase inhibitors sunitinib (approved for metastatic renal cell carcinoma) and enzatolin are based on natural indole lead derivative crossbracts [11–13]. Moreover, indole is an essential dietary compound. Indole alkaloid derivatives of Brassica, including indole glucosides, indole-3-carbinol (I3C), and 3,3′-diindolemethane, have depicted significant anticancer activity [14–16]. As a natural compound that has attracted much attention recently, I3C is a metabolite of cruciferous vegetables [17]. It has been proven to have inhibitory effects on various tumors, including lung [18], prostate [19], and breast cancers [20]. Most tumor studies have focused on binding I3C to the aromatic receptor, estrogen receptor (ER), Sp1, Nrf-2, NFκB, and other transcription factors in tumor cells. Regulation of epigenetics, such as DNA methyltransferases, histone deacetylases, and non-coding RNAs (miRNAs and lncRNAs), regulates tumor suppressor genes and causes apoptosis [21–25]. However, the effect of I3C on the tumor microenvironment, specifically the tumor immune microenvironment and in ICBs therapy, is rarely reported.

In conclusion, the role of I3C in the tumor immune microenvironment and cancer therapy, specifically in ICBs for treating CRC, remains largely unknown. As a result, in this study, we aimed to investigate the mechanism of action of I3C in CRC progression and ICBs therapy.

Materials and methods

Chemicals and reagents

I3C was obtained from MedChemExpress (HY-N0170, USA). A stock solution of I3C was prepared by dissolving it in dimethyl sulfoxide and then stored in an ultracold storage freezer.

Cell culture

The murine CRC cell lines CT26 and MC38 and human CRC cell lines RKO, HT29, LOVO, and SW620 were procured from KeFan Biotech Biological Technology Co., Ltd. and were obtained from the American Type Culture Collection. FHC was procured from Meisen Biological Technology Co., Ltd. MC38 and CT26 cells were cultured in Dulbecco's modified Eagle medium (DMEM). HT29, RKO, and SW480 cells were cultured in Roswell Park Memorial Institute-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin. FHC was grown in DMEM supplemented with 20% FBS. All cell lines were examined using mycoplasma testing, with negative results. Cells were grown in an incubator at 37 ℃ under 5% CO₂ for 2 h.

Cell proliferation assays

A cell counting kit-8 (CCK-8) assay was used to assess cell proliferation capacity. First, 1 × 10⁴ cells were placed into each well of 96 well plates with five replicate wells per group. For half-maximal inhibitory concentration (IC₅₀) calculation, the culture medium was discarded after 48 h of treatment. A mixture (cultured medium: CCK-8 kit, 9:1) was added to each well, and the plates were placed in an incubator at 37 °C under 5% CO_2. for 2 h. The optical density of each well was measured at 450 nm using a multiscan MK3 microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The cell number was determined using light microscopy (DMI6000B, Leica, Heidelberg, Germany). GraphPad Prism software (version 9.0; La Jolla, CA, USA) was used to calculate IC₅₀ values.

Colony formation assay

Briefly, 600 cells were seeded in each well of a 6-well plate and incubated at 37 °C under 5% CO₂ for 24 h. The culture medium was replaced with a complete medium containing I3C. After 10–14 days, when the colonies became apparent, they were fixed with 4% paraformaldehyde and stained with Giemsa dye for 30 min. The number of stained colonies was counted using ImageJ software.

Cell migration assay

A wound healing assay was performed to assess the migration ability of CRC cells treated with I3C. First, CRC cells were seeded at a density of 2 × 10⁶ cells/well in 6-well plates. When the cells were grown into a monolayer, a scratch wound was created by utilizing a small pipette tip. At different time points after treatment, three random microscopic fields (× 200) were selected and photographed to assess the migration ability of the cells. ImageJ software was used to calculate the wound healing area, and GraphPad Prism software (version 9.0) was used to calculate the ratio of cell migration.

Quantitative real-time polymerase chain reaction (RT-qPCR)

After I3C treatment, the cells were collected, and total RNA was extracted using TRIzol Reagent (Cwbio, China). The SYBR® Green Premix Pro Taq HS qPCR Kit was used to detect PTEN mRNA levels, and GAPDH was used as an internal control. The primer sequences for PTEN amplification were as follows: Forward Primer: TTTGAAGACCATAACCCACCAC. Reverse Primer: ATTACACCAGTTC GTCCCTTTC. The primer sequences used for GAPDH amplification were as follows: Forward Primer: CTGGGCTACACTGAGCACC; Reverse Primer: AAGTGGTCGTTGAGGGCAATG. The quantitative results were determined using the ΔΔCT method.

RNA interference and lentivirus transfection

Human PTEN small interfering RNA was bought from Ribobio. The sequences are listed as follows: AGGCGCTATGTGTATTATTAT(Ribobio, Guangzhou, China). RKO cells were transfected with siRNA using Lipofectamine 2000 (Invitrogen, USA) following the provided guidelines. The murine shRNA sequences targeting PTEN (shPTEN) are listed as follows: GCAGATAAT GACAAGGAGTAT (The full senquence is attached in the Supplementary Table 1, Vector name: LV-U6 > shPTEN-PGK > EG2P/T2A/Puro). First, using Lipo-fectamine 2000 and OpitiMEM, package tool cells HEK293 were successfully transfected with the plasmid for 24 h. The medium was then replaced with DMEM supplemented with 10% FBS. After 48 h, the supernatants containing the targeted recombinant lentiviruses were collected and filtered. Furthermore, the lentiviruses were transfected into CRC cells. The efficiency of PTEN knockdown was examined using qPCR.

Animal study

All animal studies followed NIH guidelines for animal handling. The procedure was permitted by the Animal Care and Use Committee of Heyuan People's Hospital (approval number: YXYJLL-2022S21).

First, 0.5 × 10⁶ RKO cells or CT26 cells per mouse were subcutaneously injected into the left dorsal flanks of mice. When the subcutaneous tumor approached 50–100 mm³ in 7–8 days, mice were kept on 0.25 mg anti-PD-1 or hamster IgG isotype control (BioXCell), injected every two days (total dose of 1 mg per mouse intraperitoneally). Tumor length, base diameter (A), and perpendicular value (B) were measured using a slide caliper. The tumor mass was calculated using the following formula: 0.5 × A × B². The mice were sacrificed when the tumor approached approximately 1000 mm³ (less than 1500 mm³) or when ulceration was evident. Cachexia occurred approximately 2–3 weeks after the cell injection.

Western blot analysis

Briefly, the treated cells were lysed with RIPA buffer and protease inhibitors. The BCA method was utilized to determine the protein concentrations. Finally, total proteins were separated by SDS-PAGE and transferred to PVDF membranes. Specific primary and secondary antibodies were subsequently used to block and incubate the blots. The related antibodies were listed as follows:

GAPDH (1:2000, Cat#TA-08, ZSbio, China); PTEN(1:2000, Cat#ab267787, ABCM, USA).

Immunohistochemistry

Primary antibodies against CD8 (1:1000, ab209775, ABCAM) were incorporated following the manufacturer's instructions. Incubation with the secondary antibody (anti-rabbit IgG, 1:2000 dilution, #7074; Cell Signaling, Danvers, MA, USA, 1 h, 37 °C) was conducted after washing with PBS.

Statistical analyses

Statistical analysis was performed using a Student t-test or two-way analysis of variance using the Statistical Package for the Social Sciences software (version 25.0) for Mac. Unless otherwise specified, error bars represent the standard error of the mean. ns, non-significance; *P < 0.05; **P < 0.01; ***P < 0.001. Differences were considered statistically significant at P < 0.05.

Results

I3C significantly inhibited the proliferation, colony-forming, and migration capacity of CRC cells

The results of the in vitro experiments indicated that I3C possessed a remarkable activity that prevented the proliferation, colony formation, and migration capacity of CRC cells. Initially, we performed the CCK-8 assay to assess the possible cytotoxicity of I3C against the murine CRC cell lines MC38 and CT26 and drew dose–response curves. The results indicated that I3C depicted concentration-dependent antiproliferative effects, and the IC₅₀ values were calculated (Fig. 1A–B). We also examined the possible cytotoxicity of I3C against the human CRC cell line RKO, and concentration-dependent antiproliferative effects were observed (Fig. 1C). The IC₅₀ values are displayed in Fig. 1D. Considering that the IC₅₀ values of I3C were 133.4 µM, 198.8 µM, 184.5 µM for MC38, CT26, and RKO, and the I3C exert toxic effect on intestinal epithelial cell FHC when exceed 100 µM (Fig. 1E), we selected the 100 µM as the reference concentration to perform other experiments. The result of CCK-8 detection revealed that I3C at 100 μM inhibited CT26 and RKO cell growth in a time depend manner(Fig. 1F–G). The colony formation assay results indicated that I3C highly inhibited the colony formation of CT26 (Fig. 1H–I). Furthermore, I3C at 100 μM depicted a strong preventive effect on CT26 (Fig. 1J–K). Collectively, I3C significantly inhibited the proliferation, colony formation, and migration of CRC cells.

Fig. 1.

I3C inhibited the proliferation, colony-forming and migration capacity of CRC cell. A–C The dose–response detection of I3C on MC38 (A), CT26 (B), and RKO cells C (N = 3); D The IC50 values of I3C for MC38, CT26, or RKO; E CCK-8 detection of the FHC cells after I3C treatment for 48 h (N = 3); F–G CCK-8 detection of the CT26 and RKO cells after I3C treatment (N = 3); H–I I3C (100 μM) inhibited the colony formation of CT26 cells (N = 3); J–K I3C (100 μM) suppressed the migration ability of CT26 cells(N = 3). The one-way ANOVA test was used to analyze the data of CCK-8 detection F–G. The Student t-test was used to analyze the data of colony formation assay (I) and cell migration assay (K)

I3C exhibited a strong preventive effect on CRC and exerted no significant toxic effect in vivo

Next, we performed an in vivo experiment to verify the inhibitory effect of I3C. Using a murine subcutaneous CT26 CRC model, we found that, compared to the control group, the I3C group significantly suppressed tumor growth in a dose dependent manner in vivo (Figs. 2A–C), and the weight of mice showed no significant change(Fig. 2D). Since the dose of 25 mg/kg of I3C showed better inhibition on tumor growth in vivo, we decided to use this dose of I3C to perform other in vivo experiment. A similar outcome was observed in another murine subcutaneous MC38 CRC model, the result also indicated that I3C significant inhibited MC38 tumor growth (Figs. 2E–H). In addition, we collected and photographed the organ slices after I3C treatment with optical microscopy, the result demonstrated that I3C at the dose of 25 mg/kg exerted no systematic toxicity in the major organs such as heart, kidney and liver (Fig. 2I). The result of organ index (Organ Index (%) = [(the weight of the organ) / (the weight of the mice)] × 100%) also supported the robust safety of I3C treatment in vivo(Fig. 2J–L).

Fig. 2.

I3C showed a strong preventive effect on CRC in vivo. A–C The image, growth curve and weight of CT26 tumors grafteded on BALB/c mice after receiving I3C(10 mg/kg or 25 mg/kg, ip, every other day) treatment (N = 2); D Weight of BALB/c mice after I3C treatment (N = 2); E–G The image, growth and weight of MC38 tumors implanted on C57BL/6c mice after receiving I3C(25 mg/kg, ip, every other day) treatment(N = 2); H Weight of C57BL/6c mice after I3C treatment; (I)HE staining of heart, kidney and liver after receiving I3C(25 mg/kg, ip, every other day) treatment(N = 2); J–L Organ index (Organ Index (%) = [(the weight of the organ)/(the weight of the mice)] × 100%) calculated after receiving I3C(25 mg/kg, ip, every other day) treatment(N = 2). scale bar, 100 μm. The Student t-test was used to analyze the data weight of tumor (C,G) and organ index (J–L). Repeated measures ANOVA was used to analyze the data of tumor volume (B,F) and weight of mice (D,H)

I3C directly inhibited CRC cell growth by upregulating PTEN

Recently, a research reported that I3C could restore the function of PTEN and playing a direct role in killing prostate tumors[26]. PTEN is a cancer suppressor gene that induces cell death or immune evasion [27, 28]. However, it remains largely uncertain whether PTEN participates in the antitumor mechanism of I3C. Therefore, we hypothesized and explored whether PTEN played a key role in I3C antitumor activity. First, utilizing the Human Protein Atlas (HPA) web tools, we found that PTEN expression was lower in colon tumor tissues than in normal tissues (Fig. 3A). The qPCR results confirmed that compared to normal colonic epithelial cells FHC, CRC cell lines such as LOVO, RKO, HT29, and SW620 possessed lower expression of PTEN (Fig. 3B). The RKO possesd lowest expression of PTEN and we chose it as the representitave human CRC cell line to explore the role of PTEN in I3C anti-tumor effect. Additionally, I3C decreased PTEN expression in the murine CRC cell line CT26 and the human CRC cell line RKO in a concentration-dependent manner in proten level (Fig. 3C–D). After PTEN was successfully knocked down in the CT26 and RKO cells (Fig. 3E), Qpcr detection was conducted to assess the PTEN mRNA expression upon adding I3C. The result demonstrated that compared with the control group, I3C treatment increased PTEN expression. When compared with I3C treatment group, PTEN expression of the I3C + shPTEN group was significantly decreased in the CT26 cells (Fig. 3F). A similar outcome was observed in the human CRC cell line RKO (Fig. 3G). A CCK-8 assay was conducted to assess cell viability upon adding I3C. The results indicated that compared with the control group, PTEN knockdown promoted cell growth, whereas I3C treatment inhibited cell growth. When compared with the I3C treatment group, the viability of the I3C + shPTEN group was significantly increased in CT26 cells(Fig. 3H). A similar outcome was observed in the human CRC cell line RKO (Fig. 3I). In conclusion, these results suggest that I3C inhibits CRC progression by upregulating PTEN expression.

Fig. 3.

I3C directly inhibited CRC cell growth by upregulating PTEN. A IHC analysis of PTEN protein expression downloaded from the HPA (www.proteinatlas.org), scale bar, 200 μm; B RT-qPCR detection of PTEN mRNA level in FHC and CRC cell lines(N = 3); C WB detection of PTEN protein level in CT26 cells after I3C treatment(N = 3); D WB detection of PTEN protein level in RKO cells after I3C treatment(N = 3); E RT-qPCR detection of PTEN mRNA level in CT26 and RKO cells after knocking down(N = 3); F–G RT-qPCR detection of PTEN mRNA level in CT26 F and RKO after I3C treatment and PTEN knock down (N = 3). H–I CCK-8 assay was used to assess CT26 (H) and RKO (I) cell viability after I3C treatment and PTEN knock down (N = 3). The Student t-test was used to analyze the data of RT-qPCR detection (B,E,F,G) and cell survival (H–I)

I3C increased CD8⁺ T cell infiltration and sensitized ICBs therapy to CRC by upregulating PTEN

Some scholars have recently reported that I3C can significantly increase intestinal cytotoxic T-cell infiltration in mice and reduce intestinal citrobacter infection [29]. Besides, the previous in vivo results indicated that I3C might exert an antitumor effect by modulating the tumor's immune environment. Thus, in this study, we firstly investigated the effect of I3C on CD8⁺ T cell infiltration using immunohistochemistry. The results indicated that compared with the control group, I3C treatment increased the number of CD8⁺ T cells while the PTEN knockdown was reduced. When compared with the shPTEN group, the I3C + shPTEN group significantly increased the infiltration of CD8⁺ T cells (Fig. 4A–B). In other words, the decreasing effect of PTEN knockdown was neutralized by I3C treatment. Since CD8⁺ T cells in the tumor immune environment are associated with the therapeutic effect of ICBs, we assessed the possible synergistic effect of I3C on ICBs using a murine subcutaneous CT26 CRC model (Fig. 4C). The results indicated that compared with the control group, I3C and PD1ab treatment alone significantly inhibited tumor growth. The combination treatment displayed the strongest inhibition (Fig. 4D–E). I3C may increase the infiltration of CD8⁺ T cells and potentiate PD1ab therapy in CRC by upregulating PTEN expression.

Fig. 4.

I3C increased CD8⁺ T cells infiltration and sensitized ICBs therapy to CRC by upregulating PTEN. A–B Representative images (A) and quantitative analysis (B) of CD8⁺ T cells in each group, scale bar, 100 μm (N = 2); C–E The scheme, image, growth curve and weight of CT26 tumors receiving I3C and PD1 treatment (N = 2). The Student t-test was used to analyze the data of CD8⁺ T cells (B) and weight of tumor (E); Repeated measures ANOVA was used to analyze the data of tumor volume (D)

Discussion

In this study, I3C suppressed the proliferation, colony formation, and migration of CRC cells in vitro and in vivo. Besides, I3C exerted a higher antitumor effect in immunocompetent mice than in T cell-deficient mice. Consequently, we also found that by driving CD8⁺ T cell infiltration, I3C sensitized ICBs therapy to CRC by upregulating PTEN expression. Mechanically, upregulating PTEN expression may be the key part of direct inhibition and immune modulation. To the best of our knowledge, this is the first study to explore the activity of I3C in the tumor immune environment and ICBs therapy further. In summary, these findings suggested that I3C is a promising therapeutic or preventive agent for ICBs therapy of CRC.

I3C is a bioactive phytochemical abundant in cruciferous vegetables that possesses strong potential to prevent cancer progression, such as adeno gastric carcinoma [30], liver cancer [31], and lung cancer [32]. Cancer research on I3C has primarily focused on its antitumorigenic action and the direct inhibition of cancer proliferation. For example, a recent study reported that I3C promotes apoptosis and inhibits metastasis of esophageal squamous cell carcinoma by downregulating the Wnt/β-catenin signaling pathway[33]. In CRC, I3C was reported to have dual effects on the promotion and progression of colon carcinogenesis. A report described that I3C significantly increased tumor volume and cell proliferation in the 1,2-dimethylhydrazine-induced colon carcinogenesis model [34]. However, other reports have argued that I3C inhibits the proliferation of colorectal carcinoma cells by activating the apoptotic signaling pathway [35–37]. The role of I3C in CRC progression is complex and uncertain. In this study, I3C suppressed the proliferation, colony formation, and migration of murine and human CRC cells in vitro and in vivo. These findings corroborated its antitumorigenic activity and might provide evidence to support I3C as a potential agent for preventing CRC progression.

PTEN is a multifunctional protein that exerts biological activities in cancer progression, including regulation of cell proliferation, migration, cell adhesion to surrounding tissues, new blood vessel formation, and modulation of the tumor immune environment [38]. Restoration of PTEN function and expression is a potential strategy for CRC prevention [39]. A previous report described that I3C could restore the function of PTEN and play a direct role in killing prostate tumors. In this report, the researchers found that through binding to the ubiquitin E3 ligase WWP1 (WW domain–containing ubiquitin E3 ligase 1) targeting PTEN and inhibiting its activity, I3C reactivated the dimerization, membrane recruitment and function of PTEN [26]. Aronchik[40] et al. reported that I3C disruption of NEDD4-1 ubiquitination activity triggers the stabilization of PTEN and increased PTEN protein levels to induce an anti-proliferative response in melanoma. Wang [41] et al. found that I3C inhibited hepatocellular carcinoma growth via microRNA-21-mediated upregulation of PTEN. Totally, the previous reports suggested that the way how I3C exert anti-tumor effect via PTEN is different and complex in various types of cancer. In this study, PTEN expression was lower in CRC cells than in normal intestinal epithelial cells. Additionally, I3C could significantly upregulate PTEN expression. After PTEN knockdown, the inhibitory effect of I3C was neutral in vitro and in vivo.

I3C was previously reported to exert significant effects on vital immune cells such as macrophages, dendritic cells(DCs) and T cells in various diseases. For example, Mohammadi [42] et al. reported that I3C possessed anti-inflammatory effects on macrophages of SLE patients including promoting overexpression of M2 markers (CD163) and downregulation of M1 markers (CD86). Benson [43] proved that I3C suppressed the production of pro-inflammatory mediators including tumor necrosis factor-α, interleukin (IL)-1β, IL-6, IL-12 of DCs. Liu [44] et al. found that I3C had a dose-dependent effect on T cell activation in the human T lymphocyte Jurkat cell line. Wu [29] et al. reported that I3C can significantly increase intestinal cytotoxic T-cell infiltration in mice and reduce intestinal citrobacter infection. Totally, the effect of I3C on macrophages and DCs seems to be anti-inflammatory. However, the effect of I3C on T cells seems to be pro-inflammatory, which is consistent with our findings. In this study, we further found that I3C significantly increased the number of CD8⁺ T cells in tumor tissues. Besides, we found that PTEN knockdown reduced the number of CD8⁺ T cells and eliminated I3C promoting effect. In conclusion, these findings suggest that PTEN may play a tumor suppressor role and mediate the effects of I3C in CRC. The detailed studies about how I3C increases PTEN expression should be conducted in the next stage.

ICBs remain a promising therapeutic strategy designed to stimulate the patient's antitumor immunity in CRC. Targeting PD1 antibodies, pabolizumab, and nebuliumab were approved as monotherapies or in combination with the CTLA4 antibody ipilimumab in patients with CRC with MSI-H/dMMR [3]. However, many patients with CRC are characterized by pMMR and MSS. Among patients with mCRC, pMMR/MSS cancer accounts for 95% of all mCRC cases [6]. Compared to dMMR/MSI-H, tumors with the pMMR/MSS phenotype typically exhibit a lower tumor mutation load, leading to a low T cell infiltration in the tumor microenvironment. Most patients with CRC were refractory to ICBs, yielding unsatisfactory outcomes [45]. In this study, we used the cell line CT26, which possesses the pMMR/MSS phenotype, to construct a subcutaneous tumor model [46]. The results revealed that I3C inhibited CT26 tumor growth, increased CD8⁺ T cell infiltration, and enhanced PD1ab therapeutic effect by upregulating PTEN expression.

PI3K is a downstream protein of PTEN and has been reported to played a vital role in various cellular processes and contributes to the occurrence and progression of tumors [47]. Besides, PI3K is recently reported to be closely related to antitumor immunity. Different subtypes of PI3K are distributed in cancer cells (PI3Kα and PI3kβ) and immune cells (PI3kδ and PI3kγ). Many studies have depicted that the inhibition of PI3K in antitumor immunity depends on the inhibition of PI3Kβ, PI3kγ, or PI3kδ [28, 48–50]. For example, Bergholz [51] et al. reported that the PI3Kβ isoform had been demonstrated to play an important role in PTEN-deficient breast tumors. By suppressing STAT3 signaling and upregulating expression of immune stimulatory molecule such as CD80, pharmacological inhibition or genetic inactivation of PI3Kβ led to a robust anti-tumor immune response that abrogated tumor growth in syngeneic immunocompetent mice. Jiang [52] et al. reported that PI3Kα-specific inhibitor markedly activates immune microenvironment by regulating the PD-1/L1-related pathways and significantly enhances the anti-tumor efficacy of PD-1 blockade in cervical cancer. However, whether I3C inhibited CRC progression through PTEN/PI3K pathway and which PI3K isoform plays key role in I3C anti-tumor effect, due to the limited time and funds required for this research, further studies should be conducted in the future.

Author contributions

H.C. and B.G. and L.L. and J.L. wrote the main manuscript text. M.S. and Y.Z. prepared Figs. 1–4. Y.J. revised the main manuscript. All authors reviewed the manuscript.

Funding

This work was supported by the Guangdong Medical Research Foundation (No. B2023252).

Data availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Competting interests

The authors declare no conflict of interest.

Ethics approval and consent to participate

All animal studies followed NIH guidelines for animal handling. The maximal tumor size/burden is 1500 mm³ in animal study which was permitted by the Animal Care and Use Committee of Heyuan People's Hospital. The maximal tumor size/burden in present study is not exceeded 1500 mm³.The procedure was permitted by the Animal Care and Use Committee of Heyuan People's Hospital (approval number: YXYJLL-2022S21).

Informed consent

Not applicable.