Abstract
Purpose
N6-methyladenosine (m6A) modification has been implicated in ischemia–reperfusion injury in various systems and in several neurodegenerative diseases. Glaucoma is characterized by degeneration of retinal ganglion cells (RGCs) and shares similar pathologic injury characteristics with retinal ischemia–reperfusion (RIR) injury. However, the specific role of m6A modification in RIR injury is unclear, and the involvement of autophagy in RIR injury also remains controversial. Therefore, our study explored the role of m6A modification and autophagy in RIR injury.
Methods
Male wild-type C57BL/6J mice (6–8 weeks old) were used to induce RIR injury. Retinal flat-mount immunofluorescence was performed to assess RGC survival rate. Electroretinogram and optomotor response were conducted to evaluate the retinal electrophysiologic function and visual acuity. Autophagy level was reflected by Western blot and transmission electron microscope images. M6A modification levels were determined via m6A dot blot. Methyltransferase-like protein 3 (Mettl3) and forkhead box O1 (FoxO1) protein expressions were tested by Western blot. Methylated RNA immunoprecipitation–quantitative PCR was conducted to examine m6A modification level on FoxO1 mRNA. We also employed 3-methyladenine and rapamycin to regulate autophagy level in RIR injury.
Results
Inhibiting autophagy ameliorated RGC loss and preserved retinal electrophysiologic function in RIR injury. Additionally, a decrease in Mettl3-mediated m6A modification was observed in RIR injury mice. By overexpressing Mettl3 via intravitreal injection of type 2 recombinant adeno-associated virus before RIR injury, we established that Mettl3 overexpression can also ameliorate RGC loss and retinal electrophysiologic dysfunction induced by RIR injury. Furthermore, Mettl3 overexpression inhibited autophagy and reduced FoxO1 expression by upregulating m6A modifications on FoxO1 mRNA.
Conclusions
Mettl3-mediated m6A modification mitigates RGC loss and retinal electrophysiologic dysfunction by inhibiting FoxO1-mediated autophagy in RIR injury.
Keywords: glaucoma, retinal ischemia–reperfusion injury, retinal ganglion cells, m6A modification, autophagy
Glaucoma is the second leading cause of blindness worldwide, after cataracts.1 As of 2013, glaucoma had already affected 64.3 million individuals aged of 40 to 80 years, a number projected to rise to 111.8 million by 2040; therefore, this condition significantly impacts the quality of middle-aged and elderly people.2 Glaucoma is a complex, multifactorial disease characterized by progressive damage to retinal ganglion cells (RGCs), thinning of the nerve fiber layer, and visual field defects.3–5 However, glaucoma pathogenesis remains unclear. Pathologically elevated intraocular pressure (IOP) is widely recognized as a major risk factor for this disease, with damage to RGCs from IOP-induced retinal ischemia and subsequent reperfusion leading to irreversible visual impairment.
Current glaucoma management primarily focuses on reducing IOP through pharmacologic agents, laser therapy, or surgical interventions.6 However, the efficacy of these treatments is limited. Therefore, the protection of RGCs has emerged as a novel therapeutic approach to protect or delay visual impairment in patients with glaucoma; moreover, investigations into potential neuroprotective factors have received increasing attention.7
Retinal ischemia–reperfusion (RIR) injury is associated with the pathologic processes of many neurodegenerative ophthalmic diseases, such as glaucoma, retinal artery occlusion diseases, and diabetic retinopathy.8,9 It is involved in the damage that glaucoma causes to the retina, sharing similar pathologic injury characteristics with glaucoma. Besides, RIR injury in mice is also a well-acknowledged model, providing a research basis for the mechanism and treatment of neurodegenerative ophthalmic diseases like glaucoma.10
In recent years, the field of epigenetics has gained attention for its role in various diseases and pathophysiologic processes. Nevertheless, current epigenetic studies focus on DNA methylation, histone modification, and noncoding RNAs, with relatively few addressing RNA modifications. RNA modifications, a kind of posttranscriptional modifications, are chemical alterations at the ribose or base of an RNA molecule.11,12 Over 150 types of RNA modifications have been identified in mRNAs, tRNAs, ribosomal RNAs, and other noncoding RNAs. Among these, N6-methyladenosine (m6A) is the most common RNA modification.12 Although m6A modifications were discovered in the mRNA of mammalian cells in the 1970s by Desrosiers et al.,13 the function of these modifications and their corresponding mechanisms were not extensively studied due to the limitations in technology available at the time. Nonetheless, in 2011, Jia et al.14 revealed that m6A modification is reversible. Furthermore, recent advancements in technologies, such as methylated RNA immunoprecipitation (MeRIP)-seq and MeRIP–quantitative PCR (qPCR), have led to significant breakthroughs in understanding m6A modification.
In subsequent studies, three classes of enzymes that affect m6A modification have been identified: “writers” (methyltransferases) catalyze m6A modification and primarily include methyltransferase-like protein 3 (Mettl3), methyltransferase-like protein 14 (Mettl14), Wilm's tumor 1 associated protein (WTAP), and vir-like m6A methyltransferase associated (KIAA1429); “erasers” (demethylases) remove m6A modifications and include fat mass and obesity-associated protein (Fto) and alkB homolog 5 (Alkbh5); and “readers” recognize m6A modification sites and trigger various downstream physiologic activities and include the YTH domain family, IGF2BPs, the HNRNP family, and eIF3.15–20 Additionally, m6A modifications influence mRNA translation, splicing, nucleation, stability, and degradation. Notably, these processes have been implicated in a multitude of cellular physiologic activities, including autophagy and apoptosis.20
At present, research on m6A modification has primarily focused on its role in tumorigenesis, cancer progression and migration, cardiovascular system diseases, nervous system development, and neurodegenerative diseases.21–24 However, studies of the role of m6A in ophthalmic diseases remain relatively limited, with most focusing on diabetic retinopathy and ocular tumors. Meanwhile, the role of m6A in RIR injury remains unclear.25,26
Autophagy is a self-degradation process that involves the cellular removal of misfolded or aggregated proteins, damaged organelles, and intracellular pathogens.27 This dynamic recycling process eliminates intracellular detrimental substances while providing new substances for cellular activities, thereby maintaining cellular homeostasis and ensuring normal physiologic functions.28 Autophagy plays a particularly crucial role in nerve cells since these cells lack the capacity for cellular division, resulting in the accumulation of misfolded proteins, damaged organelles, and other harmful substances.28,29 While autophagy supports normal cellular activities under physiologic conditions, excessive external stimuli can result in autophagy dysregulation, leading to cell death.30 However, its specific role in RIR injury remains controversial. Some research proposes that autophagy is inhibited during the first 1 day after RIR injury, while there are also contrary opinions that autophagy is activated after RIR injury.31–36 Some researchers claim activating autophagy is neuroprotective in RIR injury, but others believe suppressing it is beneficial.31–36 In accordance with these, autophagy participates in RIR injury and plays an important role, although its effects are not definite.
Recently, more and more studies have demonstrated that m6A modification engages in the regulation of autophagy. It participates in many phases of autophagy, such as autophagy initiation, autophagosome assembly, and lysosomal function.37 Additionally, its influences on autophagy are not single. Depending on the different RNA targeted, it can not only promote autophagy but also inhibit autophagy.38–40
Therefore, in this study, we employed high IOP to induce RIR injury. Using this model, our study aimed to explore the role of RNA m6A modification and autophagy in RGCs in the context of RIR injury.
Materials and Methods
Animals
Male wild-type C57BL/6J mice (6–8 weeks old) were purchased from the Animal Laboratory Center of Wuhan University and housed in a standard air-conditioned barrier system (23 ± 2°C, light/dark cycle, 12/12 hours) with adequate food and water. All mice were randomly assigned to cages for 7 days of acclimatization before subsequent experiments. All surgical procedures and experimental interventions performed in this study were performed in strict accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the National Institutes of Health guidelines. This study was approved by the Ethics Committee of the Renmin Hospital of Wuhan University.
Animal Model of RIR Injury
The RIR injury model was developed based on previous studies.41–43 Briefly, mice were anesthetized via intraperitoneal injection of 1% pentobarbital sodium, followed by adequate pupil dilation with tolbutamide and corneal surface anesthesia with proparacaine hydrochloride. Subsequently, a 32-gauge insulin needle attached to a 0.9% saline infusion system was inserted into the anterior chamber of the eye from the periphery of the cornea. Saline was elevated to a height of 1.5 m to increase the anterior chamber pressure to 110 mm Hg for 1 hour. A pale iris and loss of the fundus red light reflex were observed, indicating the development of retinal ischemia. The needle was then removed, returning the IOP to normal levels. Finally, an antibiotic eye ointment was administered to prevent infection. Alternatively, the control group underwent appropriate sham surgical procedures. Excluding individuals with infection or intraoperative hemorrhage, the remaining mice were euthanized at 1, 3, and 7 days after modeling, and their eyeballs were obtained for further experiments.
Intravitreal Injection and Experimental Interventions
In accordance with previous studies,43,44 a glass needle was manufactured using a dual-stage glass micropipette puller (Narishige Scientific Instrument Lab, Setagaya City, Japan) and mounted on a programmable nanoliter injector (Nanoject III; Drummond Scientific Company, Broomall, PA, USA), after which the drug was aspirated. Following anesthesia, the temporal sclera was fully exposed, and the drug was slowly injected into the vitreous cavity by inserting the glass needle 1 to 2 mm behind the corneoscleral rim, avoiding blood vessels. The needle was then removed slowly to prevent leakage, and an antibiotic eye ointment was applied.
Four weeks before eyeball harvesting, type 2 recombinant adeno-associated virus (1 µL, ≥5.00 × 1012 vg/mL, rAAV-EF1a-Mettl3-2a-EGFP-WPRE-hGH pA; BrainVTA, Wuhan, China) or the corresponding control virus (1 µL, ≥5.00 × 1012 vg/mL, rAAV-EF1a-EGFP-WPRE-hGH pA; BrainVTA) was injected into the vitreous cavity.42 The autophagy inhibitor 3-methyladenine (3-MA; 1 µL, 50 mM; HY-19312, MedChemExpress, Monmouth Junction, NJ, USA) or the autophagy activator rapamycin (Rapa; 2 µL, 1 mM; HY-10219, MedChemExpress) was injected into the vitreous cavity 1 day before RIR injury.45 3-MA was solubilized directly in PBS, while Rapa was dissolved in dimethyl sulfoxide (DMSO) before being diluted with 40% polyethylene glycol 300 (PEG300), 5% Tween-80, and 45% saline before use.
Additionally, the forkhead box O1 (FoxO1) inhibitor AS1842856 (AS; 10 mg/(kg·d); HY-100596, MedChemExpress) was administered via intraperitoneal injection. The AS powder was initially dissolved in DMSO and then diluted with 40% PEG300, 5% Tween-80, and 45% saline at the time of use. AS or the corresponding solvent was intraperitoneally injected into mice for 4 consecutive days, starting 1 day before modeling. The specific medication procedures are shown in Figure 1.
Figure 1.
The medication procedure conducted in the study.
Retinal Flat-Mount Immunofluorescence Staining and Quantification of RGCs
The POU domain class 4 transcription factor 1 (Brn3a) is a reliable biomarker for the identification and quantification of RGCs in control and optic nerve–injured retinas.46 Therefore, it was selected for RGC counting in the present study.
Fresh eyeballs were fixed in 4% paraformaldehyde (PFA) for 60 minutes at room temperature, after which the retinas were dissected. The retinas were then blocked in 5% BSAT (5% BSA, 0.2% Triton X-100 in PBS) overnight at 4°C and incubated with anti-Brn3a antibodies (1:1000; 411003, Synaptic Systems, Göttingen, Germany) for 48 hours at 4°C. After washing with PBS, retinas were incubated with Alexa Fluor 594–conjugated donkey anti-rabbit IgG antibodies (1:1000; 711-585-152, Jackson ImmunoResearch Labs, West Grove, PA, USA) overnight at 4°C, then washed again with PBS. Retinas were transferred to glass slides, cut into four flaps along a radial pattern centered on the optic nerve head, and flattened to give a four-leaf clover shape. An antifluorescence quencher was then dropped onto the tissues, and slides were covered with coverslips. Retinal flat-mount images were captured using an orthogonal fluorescence microscope (BX53; Olympus, Tokyo, Japan), and RGCs were counted using Adobe Photoshop 2023 v24.0.0 (Adobe Systems, San Jose, CA, USA), as previously described.47 The survival rate of RGCs in each group was calculated based on the average number of RGCs in the control group.
Scotopic Full-Field Flash Electroretinogram
All mice were dark-adapted overnight. This procedure was performed in a temperature-controlled environment with dim red light illumination to avoid interference with dark adaptation. The pupils of the anesthetized mice were fully dilated, and mice were placed on the experimental platform with both eyes fully exposed at the same level. The tail electrode was clamped to the tails of mice, the subcutaneous electrode was sterilized with an alcohol cotton ball before being inserted under the skin between the two ears at the back of the neck, and the corneal electrodes were lightly placed on the central tip of the cornea, at a tangent to the cornea. A small number of saline drops were applied to keep the cornea moist. The experimental platform was then moved into a Ganzfeld full-field stimulator (Chongqing IRC Medical Equipment Co., Ltd., Chongqing, China), and the a- and b-wave amplitudes at a stimulation intensity of 3.0 cd·s/m2 were recorded using a RetiMINER visual electrophysiologic apparatus (Chongqing IRC Medical Equipment Co., Ltd.) with the dark red light turned off.
Optomotor Response
According to previous study,45 MATLAB software (MathWorks, Natick, MA, USA) and a virtual optomotor system were used to measure the visual acuity of mice. After dark adaption for 4 hours, the mice were transferred to the platform in the center of the device, with four LED screens around. The rotating vertical gratings with different spatial frequencies were displayed on the screens in turn. When the mice perceived gratings, they usually stopped moving their bodies and tracked the moving grating along the direction of grating rotation with a reflective head movement. With the increase of spatial frequency of gratings, it is more difficult for mice to perceive the rotation of grating. The highest spatial frequency that mice could perceive was recorded as the visual acuity.
Western Blot Analysis
Fresh retinas were harvested in PBS and lysed in freshly prepared lysis buffer comprising RIPA lysate, 50× protease inhibitor cocktail, phenylmethanesulfonyl fluoride, phosphatase inhibitor A solution, and phosphatase inhibitor B solution. The tissue lysate was then fragmented via sonication on ice, and the protein supernatant was collected by centrifugation. This procedure was conducted on ice to prevent protein degradation.
Proteins were separated using SDS-PAGE and electro-transferred onto a 0.22-µm polyvinylidene fluoride membrane. Subsequently, the membrane was blocked with 5% skim milk (5% skim milk powder, 0.2% Tween-20 in TBS) for 1.5 hours at room temperature, then incubated with the appropriate primary antibodies (Table 1) overnight at 4°C. After washing with TBST (0.2% Tween-20 in TBS), the membrane was incubated with horseradish peroxidase–conjugated goat anti-rabbit IgG antibodies (1:6000; HA1001, HUABIO, Hangzhou, China) for 1 hour at room temperature. Finally, bands were visualized using GelView 6000plus (Guangzhou Boluteng Biotechnology Co., Ltd., Guangzhou, China) with an ultrasensitive ECL luminescent substrate detection kit (PMK0448; Wuhan Pumeike Biology Technology Co., Ltd., Wuhan, China) and analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Table 1.
Primary Antibodies Used in Western Blot Analysis
| Antibody | Source | Catalog No. | Dilution |
|---|---|---|---|
| SQSTM1/p62 | CST | #23214 | 1:500 |
| LC3-I | MBL | PM036 | 1:1000 |
| LC3-II | |||
| Mettl3 | Proteintech | 15073-1-AP | 1:1000 |
| FoxO1 | CST | #2880 | 1:1000 |
| β-Actin | Servicebio | GB11001 | 1:6000 |
CST, Cell Signaling Technology; MBL, Medical and Biological Laboratories.
RNA Extraction and m6A Dot Blot Assay
Total RNA was extracted from the retinas using TRIzol, according to previously described methods.41 RNA concentration was determined using a K5600 Micro-Spectrophotometer (KAIAO Technology, Beijing, China).
An m6A dot blot assay was conducted in accordance with a previous study.48 In brief, the RNA was diluted to 100 ng/µL using DEPC water and denatured at 95°C for 3 minutes; then, a 2-µL sample was taken to load onto a nylon membrane. After drying, the membrane was incubated at 37°C for 30 minutes to facilitate the cross-linking of RNA to the membrane. Subsequently, excess uncrosslinked RNA was removed by washing with TBST. The membrane was then incubated with 0.02% methylene blue for 30 minutes at room temperature, after which an image was captured as the loading control. After washing, the membrane was blocked in 5% skim milk at room temperature for 1 hour. Subsequently, the membrane was incubated with anti-m6A antibodies (1:1000; HUABIO) at 4°C overnight. Using an ultrasensitive ECL luminescent substrate detection kit (PMK0448; Wuhan Pumeike Biology Technology Co., Ltd.), luminescent images were captured by a GelView 6000plus imaging system, prior to which the membrane was incubated for 1 hour with horseradish peroxidase–labeled goat anti-rabbit IgG antibodies (1:6000; HA1001, HUABIO) at room temperature.
Quantitative RT-PCR
Total RNA was extracted from the retinal tissue as described above. RNA was then reverse transcribed, and qPCR was performed using the Bio-Rad 7500 Real-Time Fluorescence PCR System (Hercules, CA, USA). Data analysis was conducted using the 2(–ΔΔCt) method. Primers used for this procedure are listed in Table 2.
Table 2.
Primers Used in the Study
| Primers | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| Mettl3 | TCTGGGCACTTGGGTGAGATTT | TTAGGGCCGCTAGAGGTAGG |
| Mettl14 | CTTGGGAGAGTATGCTTGCG | CCTTTGATCCCCATCAGGCA |
| WTAP | TCCCTCAGCGCCATTTTGTG | TGTTTCACTCAGTCGGACCTTTT |
| KIAA1429 | AGTTTGCTGAAGCGAGTGGT | CTCCACAACAGCCCATAGCA |
| Alkbh5 | TGTCGGAACCTGTGCTTTCT | GGTGCATCTAATCTTGTCTTCCTG |
| Fto | GGGACATCGAGACACCAGGA | AGGTGCCTGTTGAGCACTCT |
| FoxO1 | GTCATTTGCCACAGAACCCA | CTGGCACTTAATCTTATTCTGCCC |
| β-Actin | GAAGTCCCTCACCCTCCCAA | GGCATGGACGCGACCA |
Immunofluorescence Staining of Retinal Frozen Sections
Fresh eyeballs were fixed in 4% PFA for 1 hour, followed by the removal of the anterior eye segment and vitreous cavity contents. Gradient dehydration was then performed using 10%, 20%, and 30% sucrose solutions. Subsequently, the eyeballs were embedded in optimal cutting temperature compound, and 14-µm-thick sections were prepared using a Leica CM 1900 cryostat (Leica Microsystems, Vizla, Germany). The prepared sections were incubated with 5% BSAT for 1 hour at room temperature, then incubated overnight at 4°C with anti-Mettl3 antibodies (1:500; Proteintech, Wuhan, China). After washing, sections were incubated with Alexa Fluor 594–conjugated donkey anti-rabbit IgG antibodies (1:500; 711-585-152, Jackson ImmunoResearch Labs) for 1 hour at room temperature, after which nuclei were labeled with DAPI. Images of the frozen retinal sections were obtained using an orthogonal fluorescence microscope (BX53; Olympus).
Transmission Electron Microscopy
Fresh retinal tissues (1 mm3) were fixed in 1% osmium acid at room temperature for 2 hours in the dark and dehydrated with alcohol and acetone at room temperature, then embedded in acetone and 812 embedding agents. The embedded tissues were polymerized at 60°C for 48 hours to obtain resin blocks. Subsequently, the resin blocks were sectioned using an ultrathin microtome (PT-PC; RMC, Tucson, AZ, USA) at a thickness of 60 to 80 nm. These sections were stained with 2% uranyl acetate–saturated alcohol solution protected from light, then stained with 2.6% lead citrate solution protected from carbon dioxide. After drying overnight at room temperature, images were captured using a transmission electron microscope (HT7800; HITACHI, Tokyo, Japan).
MeRIP-qPCR
M6A immunoprecipitation was performed using the BersinBio Methylated RNA Immunoprecipitation Kit (Bes5203-2; BersinBio, Guangzhou, China), according to the manufacturer's instructions. Initially, total RNA was extracted from the retinal samples using TRIzol reagent and fragmented into ∼300-bp fragments using corresponding fragmentation reagents. Fragmented RNA samples were then divided into three groups: Input, IP, and IgG. The Input group was stored at –80°C for subsequent use. Meanwhile, the IP and IgG groups were treated with 4 µg of anti-m6A antibody and 4 µg of anti-IgG antibody, respectively, followed by incubation at 4°C for 4 hours. The immunoprecipitation complexes formed were then coincubated with blocked magnetic beads at 4°C for 1 hour. Residual RNA on the beads was digested with Proteinase K and extracted. RNA concentration was then measured with a K5600 Micro-Spectrophotometer. Finally, RNA was reverse transcribed, and the resulting cDNA was used to perform qPCR analysis using a Bio-Rad 7500 Real-Time Fluorescence PCR System. The primers used in this process were designed based on m6A sites predicted by SRAMP (http://www.cuilab.cn/sramp/).
Statistical Analysis
All data analyses were performed using GraphPad 9.0 (GraphPad Software, San Diego, CA, USA). One-way ANOVA with Tukey's post hoc test was used to determine statistical significance with P < 0.05 considered significant. For the data that did not conform to Gaussian distribution, a nonparametric test with Dunn's post hoc test was used for statistical analysis. All data were expressed as mean ± SEM.
Results
RIR Injury Induces RGC Loss and Retinal Electrophysiologic Dysfunction by Activating Autophagy
To investigate the impact of RIR injury on RGCs and retinal electrophysiologic function, we quantified surviving RGCs using immunofluorescence staining for Brn3a in retinal flat mounts at 1, 3, and 7 days post-RIR injury (Fig. 2A). Notably, these results indicated a gradual decline in the survival rate of RGCs over time following RIR injury (Fig. 2B). Furthermore, retinal electrophysiologic function analysis via electroretinogram (ERG) at 1, 3, and 7 days post-RIR injury demonstrated a gradual decrease in both a-wave and b-wave amplitudes over time (Figs. 2C–E). These findings suggest that RIR injury results in RGC loss and retinal electrophysiologic function impairment.
Figure 2.

RIR injury induces RGC loss and retinal electrophysiologic dysfunction by activating autophagy. (A) Representative images of retinal flat-mount immunofluorescence staining of Brn3a (magnification ×400; scale bar: 50 µm). (B) The quantification analysis of the RGC survival rate in each group (n = 5). (C) Schematic diagrams of ERG waveforms of each group at the stimulation intensity of 3.0 cd·s/m2. (D, E) The bar charts illustrated the variability of the a- and b-wave amplitudes at the stimulation intensity of 3.0 cd·s/m2 in each group (n = 5). (F–H) Representative protein bands for p62, LC3, and β-actin of the control, RIR1, RIR3, and RIR7 groups; the bar charts represent the protein levels of p62 and the ratio of LC3-II/LC3-I in the above groups, respectively (n = 3). (I) The bar charts represent the visual acuity of the control, RIR3, RIR + 3-MA, and RIR3 + PBS groups, respectively (n = 5). (J) Schematic diagram of the virtual optomotor system for optomotor response detection. CON represents the control group; RIR1, RIR3, and RIR7 indicate 1, 3, and 7 days after RIR injury, respectively. All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns, not significant.
Autophagy, a crucial physiologic process, has been implicated in various neurodegenerative diseases.49 Microtubule-associated protein light chain 3 (LC3) and SQSTM1/p62 serve as typical biomarkers of autophagy. LC3 is a mammalian protein, similar to Atg8 found in yeast, and exists in two forms: LC3-I and LC3-II. Notably, LC3-I is typically observed in the cytoplasm. However, during autophagy induction, LC3-I can bind to phosphatidylethanolamine to form the LC3–phosphatidylethanolamine conjugate LC3-II; this conjugate is located in the membranes of autophagic vesicles and participates in subsequent autophagic processes.50 Thus, the ratio of LC3-II to LC3-I is indicative of autophagic activity. In contrast, the level of p62, an autophagy substrate, decreases with increasing autophagic activity.51 Therefore, in the present study, we examined the LC3-II/LC3-I ratio and p62 level in the retina at 1, 3, and 7 days post-RIR injury. Notably, our findings revealed that LC3-II/LC3-I gradually increased (Figs. 2F, 2H) and p62 level gradually decreased (Figs. 2F, 2G), suggesting that RIR injury activates autophagy.
To determine if autophagy contributed to RGC loss and retinal dysfunction in RIR injury, we intravitreally injected the autophagy inhibitor 3-MA into the RIR3 group (3 days post-RIR injury) before modeling. We observed that 3-MA reversed RGC loss and retinal electrophysiologic dysfunction induced by RIR injury (Figs. 2A–E). Although the visual acuity of mice injected 3-MA also increased slightly compared with the RIR3 group, there was no significant statistical difference between them (Fig. 2I). Ultimately, these results suggest that RIR injury activates autophagy, thereby causing RGC loss and retinal electrophysiologic dysfunction.
Mettl3-Mediated m6A Modification Decreases After RIR Injury
M6A modifications have been linked to various neurodegenerative diseases and ischemia–reperfusion injuries.12,22 In the present study, m6A dot blot revealed a reduction in m6A levels following RIR injury (Figs. 3A, 3B). Subsequently, we employed quantitative RT-PCR analysis to screen for the “writers” and “erasers” that affected m6A levels (Figs. 3C–H). Notably, our results indicated that only Mettl3 exhibited a significant decrease in mRNA levels following RIR injury (Fig. 3C). Subsequent Western blot analysis further demonstrated that Mettl3 protein expression levels were consistent with the changes observed at the mRNA level (Figs. 3I, 3J).
Figure 3.
Mettl3-mediated m6A modification decreases after RIR injury. (A, B) m6A dot blot indicates m6A modification was decreased in the RIR1, RIR3, and RIR7 groups comparable with the control group (n = 3). Methylene blue staining served as a loading control. (C–H) The bar charts represent the quantitative RT-PCR results of Mettl3, Mettl14, WTAP, KIAA1429, Alkbh5, and Fto, which indicate only Mettl3 significantly decreased after RIR injury (n = 4). (I) Representative protein bands for Mettl3 and β-actin of each group. (J) The bar charts indicate the protein level of Mettl3 decreased following RIR injury (n = 3). CON represents the control group; RIR1, RIR3, and RIR7 indicate 1, 3, and 7 d after RIR injury, respectively. All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns, not significant.
Mettl3 Overexpression Ameliorates RGC Loss and Retinal Electrophysiological Dysfunction in RIR Injury Via Autophagy Inhibition
To explore the role of Mettl3-mediated m6A modification in RIR injury, we constructed rAAV2–Mettl3 to upregulate Mettl3 expression. Immunofluorescence staining of retinal cryosections 4 weeks after intravitreal injection of rAAV2–Mettl3 confirmed successful transfection into the ganglion cell layer, inner plexiform layer, inner nuclear layer, and outer plexiform layer of the retina, and the outer nuclear layer was infiltrated to a small extent as well (Fig. 4A). The upregulated Mettl3 was also observed simultaneously (Fig. 4A). Western blot further verified that rAAV2–Mettl3 transfection successfully upregulated Mettl3 expression in the retina (Figs. 4B, 4C). Meanwhile, upregulated m6A modification levels were also detected after intravitreal injection of rAAV2–Mettl3 (Figs. 4D, 4E).
Figure 4.
Intravitreal injection of rAAV2–Mettl3 upregulates the protein of Mettl3 successfully. (A) Retinal frozen sections in the CON, CON + rAAV2–Mettl3, and CON + rAAV2-EGFP groups were stained with Mettl3 (red) and DAPI (blue) (magnification ×200; scale bar: 50 µm). (B, C) Representative bands of Mettl3 and β-actin; quantitative analysis of Mettl3/β-actin in CON, CON + rAAV2–Mettl3, and CON + rAAV2-EGFP groups (n = 3). (D, E) Representative image of m6A dot blot with the methylene blue staining serving as a loading control; the bar charts demonstrate that the intravitreal injection of rAAV2–Mettl3 increased the m6A modification of retina successfully (n = 3). All data are presented as mean ± SEM. *P < 0.05,**P < 0.01, ***P < 0.001; ns, not significant.
Notably, mice intravitreally injected with rAAV2–Mettl3 before RIR injury exhibited significantly higher RGC survival rates than those in untransfected mice (Figs. 5A, 5B). ERG also demonstrated that the a- and b-wave amplitudes in rAAV2–Mettl3 mice were significantly elevated (Figs. 5C–E), indicating that Mettl3 overexpression protected RGCs and retinal electrophysiologic function. Subsequently, Western blot analysis of autophagy-related biomarkers LC3 and p62 revealed that rAAV2–Mettl3 treatment inhibited autophagy activation induced by RIR injury (Figs. 5G–I). Additionally, ultrastructural examination of RGCs using transmission electron microscopy similarly indicated the suppressive effects of Mettl3 overexpression on autophagy (Figs. 6A–C). The changes of visual acuity were consistent with ERG, but there were no significant statistical differences between each group (Fig. 5F). Therefore, we postulate that Mettl3 overexpression may reduce RGC loss and enhance retinal electrophysiologic function by inhibiting autophagy.
Figure 5.
Mettl3 overexpression ameliorates RGC loss and retinal electrophysiologic dysfunction in RIR injury via autophagy inhibition. (A) Representative images of retinal flat-mount immunofluorescence staining of Brn3a (magnification ×400; scale bar: 50 µm). (B) The quantification analysis of the RGC survival rate in each group (n = 5). (C) Schematic diagrams of ERG waveforms of different groups at the stimulation intensity of 3.0 cd·s/m2. (D, E) The bar charts illustrate the variability of the a- and b-wave amplitudes at the stimulation intensity of 3.0 cd·s/m2 in each group (n = 5). (F) There were no significant statistical differences in visual acuity between each group after the intravitreal injection of rAAV2–Mettl3 and Rapa (n = 5). (G–L) Representative protein bands for p62, LC3, and β-actin; the bar charts represent the protein levels of p62 and the ratio of LC3-II/LC3-I of each group (n = 3). All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns, not significant.
Figure 6.
Intravitreal injection of rAAV2–Mettl3 inhibits autophagy in RIR injury. Ganglion cells within the RIR3 group exhibited an increase in the number of autophagosomes and autolysosomes compared with the CON and CON + rAAV2–Mettl3 groups. N, nuclei of RGCs; Nu, nucleolus; #, rough endoplasmic reticulum; *, mitochondria; @, lysosome; &, multivesicular body; red rectangle, Golgi apparatus; blue arrow, autolysosome; red arrow, autophagosome.
To confirm this hypothesis, we coinjected rAAV2–Mettl3 and the autophagy activator Rapa into RIR injury model mice. Autophagy inhibited by rAAV2–Mettl3 in RIR injury mice was successfully elevated by Rapa (Figs. 5J–L). Meanwhile, our findings indicated that the protective effects of Mettl3 overexpression of RGCs and retinal electrophysiologic function were attenuated by Rapa (Fig. 5A–E). Thus, Mettl3 overexpression protected against RGC loss and retinal electrophysiologic function impairment in RIR injury by inhibiting autophagy.
Mettl3 Overexpression Attenuates RIR Injury–Induced FoxO1 Elevation
Mettl3 has been found to inhibit autophagic activity; however, its precise mechanism remains unclear. Nonetheless, previous studies have indicated that FoxO1 may act as a potential mediator between Mettl3 and autophagy.52,53 FoxO1 is one of the earliest discovered members in the FoxO subgroup of the forkhead box protein family. It shuttles between the cytoplasm and nucleus and functions as a transcription factor to promote cellular autophagy.52,54 Notably, members of the forkhead box protein family have also been found to undergo posttranscriptional regulation via m6A modification.55–57
In the present study, FoxO1 protein expression levels significantly increased post-RIR injury (Figs. 7A, 7B). Nonetheless, intravitreal injection of rAAV2–Mettl3 suppressed this RIR injury–induced increase in FoxO1 protein levels (Figs. 7C, 7D).
Figure 7.
Mettl3 overexpression attenuates RIR injury–induced FoxO1 elevation. (A, B) Representative protein bands for FoxO1 and β-actin of the CON, RIR1, RIR3, and RIR7 groups; the bar charts represent the protein levels of FoxO1 of each group (n = 3). (C, D) Representative protein bands for FoxO1 and β-actin of the CON, CON + rAAV2–Mettl3, RIR3, RIR3 + rAAV2–Mettl3, and RIR3 + rAAV2-EGFP groups; the bar charts indicate the protein levels of FoxO1 of each group (n = 3). (E) The result of MeRIP-qPCR indicated m6A modification on FoxO1 mRNA of the RIR3 group was less compared with the CON and RIR3-rAAV2–Mettl3 groups (n = 3). All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ****P < 0.0001; ns, not significant.
Using SRAMP, we predicted the m6A modification sites in the 3′-UTR region of FoxO1 mRNA. Primers designed based on these predictions were then used in the MeRIP-qPCR assay. These results revealed reduced m6A modification of FoxO1 mRNA after RIR injury, which was reversed by rAAV2–Mettl3 injection (Fig. 7E). Overall, these findings suggest that Mettl3 overexpression may suppress FoxO1 protein expression by increasing m6A modification of FoxO1 mRNA.
FoxO1 Inhibition Alleviates RGC Loss and Retinal Electrophysiologic Dysfunction in RIR Injury by Inhibiting Autophagy
To verify whether Mettl3-mediated autophagic suppression operates through the downregulation of FoxO1 expression, we intraperitoneally administered the FoxO1 inhibitor AS to the RIR injury model mice. Similar to Mettl3 overexpression, the FoxO1 inhibitor enhanced RGC survival (Figs. 8A, 8B) and increased the ERG a- and b-wave amplitudes (Figs. 8C–E) post-RIR injury. There was also a slight increase in visual acuity in the RIR3 + AS group with no significant statistical differences (Fig. 8F). Concurrently, FoxO1 inhibition attenuated the elevation of the LC3-II/LC3-I ratio observed after RIR injury (Figs. 8G, 8I), upregulated p62 protein levels (Figs. 8G, 8H), and inhibited autophagy activation. Overall, these findings indicate that both Mettl3 overexpression and FoxO1 inhibition confer similar protective effects against RIR injury, with the same underlying mechanism of action. Therefore, we conclude that Mettl3 overexpression inhibits FoxO1-mediated autophagy activation and, thereby, protects against RGC loss and retinal electrophysiologic dysfunction induced by RIR injury.
Figure 8.
FoxO1 inhibitor alleviated RGC loss and visual dysfunction by inhibiting autophagy in RIR injury. (A) Representative images of retinal flat-mount immunofluorescence staining of Brn3a (magnification ×400; scale bar: 50 µm). (B) The quantification analysis of the RGC survival rate of the CON, RIR3, RIR3 + AS, and RIR3 + DMSO groups (n = 5). (C, D) The bar charts illustrate the variability of the a- and b-wave amplitudes at the stimulation intensity of 3.0 cd·s/m2 of the above groups (n = 5). (E) Schematic diagrams of ERG waveforms of different groups at the stimulation intensity of 3.0 cd·s/m2. (F) The bar charts represent the visual acuity of the control, RIR3, RIR + AS, and RIR3 + DMSO groups, respectively (n = 5). (G–I) Representative protein bands for p62, LC3, and β-actin; the bar charts represent the protein levels of p62 and the ratio of LC3-II/LC3-I of each group (n = 3). All data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ****P < 0.0001; ns, not significant.
Discussion
In this study, we induced RIR injury by constructing a high-IOP mouse model to explore the underlying pathophysiologic mechanisms of glaucoma. Specifically, we assessed RGC survival, a- and b-wave amplitudes in ERG, visual acuity, and autophagy-related biomarkers LC3 and p62 after RIR injury. Our results demonstrated that RIR injury activated autophagy, caused RGC loss, and resulted in retinal electrophysiologic dysfunction. Notably, inhibiting autophagy with 3-MA reversed RGC damage and retinal electrophysiologic dysfunction caused by RIR injury. Meanwhile, a decrease in m6A level was observed following RIR injury. Furthermore, we established that a decrease in Mettl3 expression was the key factor responsible for this decrease in m6A modification. Thus, we constructed a rAAV2–Mettl3 transfection model and demonstrated that Mettl3-mediated m6A modification of FoxO1 mRNA protects against RGC loss and retinal electrophysiologic dysfunction in RIR injury by inhibiting autophagy.
Notably, although the flash ERG results showed that the retinal electrophysiologic function improved after intervention, there was no significant statistical difference in the visual acuity improvement. On the one hand, this may be caused by the great differences among individuals in the behavioral experiments of mice and the relatively small sample size. On the other hand, scotopic full-field flash ERG mainly reflects the electrophysiologic functions of photoreceptors and bipolar cells, but the formation of vision depends on not only the electrophysiologic functions of photoreceptors and bipolar cells but also the normal operation of the whole visual pathway, so the improvement of visual acuity is not necessarily completely consistent with the results of flash ERG. At the same time, although it was found that m6A modification increased the survival rate of RGCs in this model, whether the function of RGCs has been significantly improved needs further study. In addition, this study confirmed that the protective effect of Mettl3-mediated m6A modification in RIR injury can be achieved by inhibiting FoxO1-mediated autophagy, but relatively speaking, the disappearance of this protective effect after using the FoxO1 agonist is more powerful and rigorous, supporting evidence for this conclusion. It is a unfortunate that we did not find a suitable FoxO1 agonist.
Autophagy is a complex pathophysiologic process implicated in glaucoma-induced retinal damage. Changes in autophagy levels vary significantly in the different glaucoma models and at different time points.58 In chronic high-IOP models, autophagy levels often exhibit a biphasic increasing trend, peaking in the early stage of injury before gradually decreasing and then increasing again in the late stage of injury.59 In addition, autophagy has been found to exert different effects on RGC survival at different stages of chronic high-IOP injury.59 In acute high-IOP-induced RIR injury, autophagy levels initially increase and then decrease during the initial 48 hours of reperfusion; however, the exact peak time differs between studies.33,60 Nevertheless, some research has indicated that autophagy is consistently upregulated during the first 7 days after reperfusion.34 In the present study, autophagy levels progressively increased at 1, 3, and 7 days post-RIR injury; however, we did not detect any dynamic changes in autophagy during the first 48 hours after modeling. To better understand the dynamic change process of autophagy after RIR injury, it is necessary to further shorten the time gradient to detect autophagy levels in the follow-up work.
Many RNA modifications have been identified in the past few decades, including m6A, N1-methyladenosine, 5-methylcytosine, 5-hydroxymethylcytosine, N7-methylguanosine, and N4-acetylcytidine. M6A is the most common RNA modification, accounting for 80% of all RNA modifications in eukaryotes and existing across 25% of the human transcript. This RNA modification has been implicated in various physiologic processes, including RNA degradation, nucleation, and splicing.61,62
Jin et al.63 were the first to highlight the regulatory role of m6A modification in autophagy. Meanwhile, the current study revealed that Mettl3-mediated m6A modification protects RGCs against RIR injury by inhibiting autophagy via FoxO1. Previous studies have indicated that m6A modification influences autophagy through two distinct mechanisms: directly regulating autophagy-related gene expression and affecting autophagy-related signaling pathways. However, this regulation of autophagy by m6A modification is not unidirectional; m6A modification can either activate or inhibit autophagy depending on the specific genes targeted by m6A modification and the recognition of m6A sites on related molecules by different m6A readers.64
Current studies on m6A modification in ischemia–reperfusion have primarily focused on the heart, kidney, and liver, demonstrating that m6A modification exacerbates ischemia–reperfusion injury in these organs; however, some studies have reported conflicting results.65–69 In the nervous system, m6A methylation levels have been demonstrated to change dynamically over time during ischemia–reperfusion injury; initially, m6A levels increase in the early stages before showing a significant decrease after a prolonged period of reperfusion.70 Disturbances in m6A modification and its associated proteins have been linked to various neurodegenerative diseases.22 Notably, reduced m6A level has been observed in Parkinson disease, with upregulation of Mettl14 offering protection against this disease.71 Meanwhile, overexpression of Fto reduces m6A levels, thereby promoting neuronal apoptosis.72 Similarly, reduced m6A modification has been observed in Alzheimer disease models and patients; moreover, Mettl3 knockdown has been found to induce neuronal synaptic deficits and neuronal death.73,74 Glaucoma, characterized by RGC degeneration and death partly due to RIR injury, has not been extensively studied in the context of m6A modification.75 Our study revealed a decrease in m6A level in the retina post-RIR injury. Conversely, Mettl3 upregulation, which increased m6A level, protected RGCs against high IOP-associated degenerative lesions.
Overall, our study revealed that Mettl3 overexpression reduces RGC loss and retinal dysfunction following RIR injury. This protective effect of Mettl3 likely results from increased m6A modification of FoxO1 mRNA, thereby downregulating FoxO1 protein expression and inhibiting autophagy. These findings offer new insight into the epigenetic mechanisms underlying glaucoma and provide novel approaches for future investigations into glaucomatous neuroprotection.
Acknowledgments
The authors thank Xiao Zhang, Xingyu Yang, and Ningzhi Zhang for their excellent technical supports and Editage (www.editage.cn) for English language editing.
Supported by the National Natural Science Foundation of China (No. 81271025 and 81860170).
Disclosure: F. Zhu, None; J. Feng, None; Y. Pan, None; L. Ouyang, None; T. He, None; Y. Xing, None
References
- 1. Kingman S. Glaucoma is second leading cause of blindness globally. Bull World Health Organ. 2004; 82: 887–888. [PMC free article] [PubMed] [Google Scholar]
- 2. Tham Y-C, Li X, Wong TY, Quigley HA, Aung T, Cheng C-Y.. Global prevalence of glaucoma and projections of glaucoma burden through 2040. Ophthalmology. 2014; 121: 2081–2090. [DOI] [PubMed] [Google Scholar]
- 3. Zeng Z, You M, Fan C, Rong R, Li H, Xia X.. Pathologically high intraocular pressure induces mitochondrial dysfunction through Drp1 and leads to retinal ganglion cell PANoptosis in glaucoma. Redox Biol. 2023; 62: 102687. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Fard MA, Afzali M, Abdi P, Yasseri M, Ebrahimi KB, Moghimi S.. Comparison of the pattern of macular ganglion cell-inner plexiform layer defect between ischemic optic neuropathy and open-angle glaucoma. Invest Opthalmol Vis Sci. 2016; 57: 1011–1016. [DOI] [PubMed] [Google Scholar]
- 5. Kang JM, Tanna AP. Glaucoma. Med Clin North Am. 2021; 105: 493–510. [DOI] [PubMed] [Google Scholar]
- 6. Jayaram H, Kolko M, Friedman DS, Gazzard G.. Glaucoma: now and beyond. Lancet. 2023; 402: 1788–1801. [DOI] [PubMed] [Google Scholar]
- 7. Guymer C, Wood JPM, Chidlow G, Casson RJ.. Neuroprotection in glaucoma: recent advances and clinical translation. Clin Exp Ophthalmol. 2018; 47: 88–105. [DOI] [PubMed] [Google Scholar]
- 8. Coucha M, Elshaer SL, Eldahshan WS, Mysona BA, El-Remessy AB.. Molecular mechanisms of diabetic retinopathy: potential therapeutic targets. Middle East African J Ophthalmol. 2015; 22: 135–144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Tanito M, Kaidzu S, Takai Y, Ohira A.. Association between systemic oxidative stress and visual field damage in open-angle glaucoma. Sci Rep. 2016; 6: 25792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Osborne NN, Casson RJ, Wood JP, Chidlow G, Graham M, Melena J.. Retinal ischemia: mechanisms of damage and potential therapeutic strategies. Prog Retin Eye Res. 2004; 23: 91–147. [DOI] [PubMed] [Google Scholar]
- 11. Han D, Xu MM.. RNA modification in the immune system. Annu Rev Immunol. 2023; 41: 73–98. [DOI] [PubMed] [Google Scholar]
- 12. Yao W, Han X, Ge M, et al.. N6-methyladenosine (m6A) methylation in ischemia–reperfusion injury. Cell Death Dis. 2020; 11(6): 478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Desrosiers R, Friderici K, Rottman F.. Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells. Proc Natl Acad Sci USA. 1974; 71: 3971–3975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Jia G, Fu Y, Zhao X, et al.. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol. 2011; 7: 885–887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Wang X, Huang J, Zou T, Yin P.. Human m(6)A writers: two subunits, 2 roles. RNA Biol. 2017; 14: 300–304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Meyer KD, Jaffrey SR.. Rethinking m(6)A readers, writers, and erasers. Annu Rev Cell Dev Biol. 2017; 33: 319–342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Fu Y, Dominissini D, Rechavi G, He C.. Gene expression regulation mediated through reversible m⁶A RNA methylation. Nat Rev Genet. 2014; 15: 293–306. [DOI] [PubMed] [Google Scholar]
- 18. Schöller E, Weichmann F, Treiber T, et al.. Interactions, localization, and phosphorylation of the m(6)A generating METTL3-METTL14-WTAP complex. RNA (New York, NY). 2018; 24: 499–512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Zaccara S, Ries RJ, Jaffrey SR.. Reading, writing and erasing mRNA methylation. Nat Rev Mol Cell Biol. 2019; 20: 608–624. [DOI] [PubMed] [Google Scholar]
- 20. Liu L, Li H, Hu D, et al.. Insights into N6-methyladenosine and programmed cell death in cancer. Molecular Cancer. 2022; 21(1): 32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Yin H, Chen L, Piao S, et al.. M6A RNA methylation-mediated RMRP stability renders proliferation and progression of non-small cell lung cancer through regulating TGFBR1/SMAD2/SMAD3 pathway. Cell Death Different. 2023; 30: 605–617. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Zhang N, Ding C, Zuo Y, Peng Y, Zuo L.. N6-methyladenosine and neurological diseases. Mol Neurobiol. 2022; 59: 1925–1937. [DOI] [PubMed] [Google Scholar]
- 23. Song H, Feng X, Zhang H, et al.. METTL3 and ALKBH5 oppositely regulate m6A modification of TFEB mRNA, which dictates the fate of hypoxia/reoxygenation-treated cardiomyocytes. Autophagy. 2019; 15: 1419–1437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Xu Y, Song M, Hong Z, et al.. The N6-methyladenosine METTL3 regulates tumorigenesis and glycolysis by mediating m6A methylation of the tumor suppressor LATS1 in breast cancer. J Exp Clin Cancer Res. 2023; 42: 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Li B, Wang Z, Zhou H, Zou J, Yoshida S, Zhou Y.. N6-methyladenosine methylation in ophthalmic diseases: from mechanisms to potential applications. Heliyon. 2024; 10(1): e23668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Ni Y, Zhang H, Chu L, Zhao Y.. m6A modification—association with oxidative stress and implications on eye diseases. Antioxidants. 2023; 12(2): 510. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Glick D, Barth S, Macleod KF.. Autophagy: cellular and molecular mechanisms. J Pathol. 2010; 221: 3–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Mizushima N, Komatsu M.. Autophagy: renovation of cells and tissues. Cell. 2011; 147: 728–741. [DOI] [PubMed] [Google Scholar]
- 29. Boya P, Esteban-Martínez L, Serrano-Puebla A, Gómez-Sintes R, Villarejo-Zori B. Autophagy in the eye: development, degeneration, and aging. Prog Retin Eye Res. 2016; 55: 206–245. [DOI] [PubMed] [Google Scholar]
- 30. Liu S, Yao S, Yang H, Liu S, Wang Y.. Autophagy: regulator of cell death. Cell Death Dis. 2023; 14: 648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Russo R, Varano GP, Adornetto A, et al.. Rapamycin and fasting sustain autophagy response activated by ischemia/reperfusion injury and promote retinal ganglion cell survival. Cell Death Dis. 2018; 9: 981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Russo R, Berliocchi L, Adornetto A, et al.. Calpain-mediated cleavage of Beclin-1 and autophagy deregulation following retinal ischemic injury in vivo. Cell Death Dis. 2011; 2: e144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Piras A, Gianetto D, Conte D, Bosone A, Vercelli A.. Activation of autophagy in a rat model of retinal ischemia following high intraocular pressure. PLoS One. 2011; 6: e22514. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Wei T, Kang Q, Ma B, Gao S, Li X, Liu Y.. Activation of autophagy and paraptosis in retinal ganglion cells after retinal ischemia and reperfusion injury in rats. Exp Ther Med. 2015; 9: 476–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Wang X, Wu Y.. Protective effects of autophagy inhibitor 3-methyladenine on ischemia-reperfusion-induced retinal injury. Int Ophthalmol. 2020; 40: 1095–1101. [DOI] [PubMed] [Google Scholar]
- 36. Zhang L, Gao M, Zhao Y, et al.. N-acetylserotonin alleviates retinal autophagy via TrkB/AKT/Nrf2 signaling pathway in retinal ischemia-reperfusion injury rats. Ophthalmic Res. 2024; 67: 125–136. [DOI] [PubMed] [Google Scholar]
- 37. Wang F, Liao Q, Qin Z, et al.. Autophagy: a critical mechanism of N(6)-methyladenosine modification involved in tumor progression and therapy resistance. Cell Death Dis. 2024; 15: 783. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Chen Y, Wu Y, Fang L, et al.. METTL14-m6A-FOXO3a axis regulates autophagy and inflammation in ankylosing spondylitis. Clin Immunol (Orlando, Fla). 2023; 257: 109838. [DOI] [PubMed] [Google Scholar]
- 39. Liang J, Cai H, Hou C, et al.. METTL14 inhibits malignant progression of oral squamous cell carcinoma by targeting the autophagy-related gene RB1CC1 in an m6A-IGF2BP2-dependent manner. Clin Sci (London, England: 1979). 2023; 137: 1373–1389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Zhao J, Zhao Z, Ying P, et al.. METTL3-mediated m(6) A modification of circPRKAR1B promotes Crohn's colitis by inducing pyroptosis via autophagy inhibition. Clin Transl Med. 2023; 13: e1405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Feng J, Ji K, Pan Y, Huang P, He T, Xing Y.. Resveratrol ameliorates retinal ischemia-reperfusion injury by modulating the NLRP3 inflammasome and Keap1/Nrf2/HO-1 signaling pathway. Mol Neurobiol. 2024; 61(10): 8454–8466. [DOI] [PubMed] [Google Scholar]
- 42. Li Z, Xie F, Yang N, et al.. Krüppel-like factor 7 protects retinal ganglion cells and promotes functional preservation via activating the Akt pathway after retinal ischemia-reperfusion injury. Exp Eye Res. 2021; 207: 108587. [DOI] [PubMed] [Google Scholar]
- 43. Luo J, He T, Yang J, Yang N, Li Z, Xing Y.. SIRT1 is required for the neuroprotection of resveratrol on retinal ganglion cells after retinal ischemia-reperfusion injury in mice. Graefes Arch Clin Exp Ophthalmol. 2020; 258: 335–344. [DOI] [PubMed] [Google Scholar]
- 44. Yang J, Yang N, Luo J, et al.. Overexpression of S100A4 protects retinal ganglion cells against retinal ischemia-reperfusion injury in mice. Exp Eye Res. 2020; 201: 108281. [DOI] [PubMed] [Google Scholar]
- 45. Xie F, Li Z, Yang N, et al.. Inhibition of heat shock protein B8 alleviates retinal dysfunction and ganglion cells loss via autophagy suppression in mouse axonal damage. Invest Opthalmol Vis Sci. 2022; 63(6): 28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Nadal-Nicolás FM, Jiménez-López M, Sobrado-Calvo P, et al.. Brn3a as a marker of retinal ganglion cells: qualitative and quantitative time course studies in naive and optic nerve-injured retinas. Invest Opthalmol Vis Sci. 2009; 50: 3860–3868. [DOI] [PubMed] [Google Scholar]
- 47. Ouyang L, He T, Xing Y.. Park7 protects retinal ganglion cells and promotes functional preservation after optic nerve crush via regulation of the Nrf2 signaling pathway. Graefes Arch Clin Exp Ophthalmol. 2023; 261: 3489–3502. [DOI] [PubMed] [Google Scholar]
- 48. Chen Y, Peng C, Chen J, et al.. WTAP facilitates progression of hepatocellular carcinoma via m6A-HuR-dependent epigenetic silencing of ETS1. Mol Cancer. 2019; 18: 127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Dou C, Zhang Y, Zhang L, Qin C.. Autophagy and autophagy-related molecules in neurodegenerative diseases. Anim Models Exp Med. 2023; 6: 10–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Tanida I, Ueno T, Kominami E.. LC3 and autophagy. Methods Mol Biol (Clifton, NJ). 2008; 445: 77–88. [DOI] [PubMed] [Google Scholar]
- 51. Moscat J, Diaz-Meco MT.. p62 at the crossroads of autophagy, apoptosis, and cancer. Cell. 2009; 137: 1001–1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Cheng Z. The FoxO-autophagy axis in health and disease. Trends Endocrinol Metab. 2019; 30: 658–671. [DOI] [PubMed] [Google Scholar]
- 53. Feng Y, Yuan P, Guo H, et al.. METTL3 mediates epithelial-mesenchymal transition by modulating FOXO1 mRNA N(6)-methyladenosine-dependent YTHDF2 binding: a novel mechanism of radiation-induced lung injury. Adv Sci. 2023; 10: e2204784. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Xing Y-Q, Li A, Yang Y, Li X-X, Zhang L-N, Guo H-C. The regulation of FOXO1 and its role in disease progression. Life Sci. 2018; 193: 124–131. [DOI] [PubMed] [Google Scholar]
- 55. Shen X, Zhong J, Yu P, Liu F, Peng H, Chen N.. YTHDC1-dependent m6A modification modulated FOXM1 promotes glycolysis and tumor progression through CENPA in triple-negative breast cancer. Cancer Sci. 2024; 115(6): 1881–1895. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Hao W, Dian M, Zhou Y, et al.. Autophagy induction promoted by m(6)A reader YTHDF3 through translation upregulation of FOXO3 mRNA. Nat Commun. 2022; 13: 5845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Zhuang X, Liu T, Wei L, Gao J.. Overexpression of FTO inhibits excessive proliferation and promotes the apoptosis of human glomerular mesangial cells by alleviating FOXO6 m6A modification via YTHDF3-dependent mechanisms. Front Pharmacol. 2023; 14: 1260300. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Liton PB, Boesze-Battaglia K, Boulton ME, et al.. Autophagy in the eye: from physiology to pathophysiology. Autophagy Rep. 2023; 2(1): 2178996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Zhang M-L, Zhao G-L, Hou Y, et al.. Rac1 conditional deletion attenuates retinal ganglion cell apoptosis by accelerating autophagic flux in a mouse model of chronic ocular hypertension. Cell Death Dis. 2020; 11(9): 734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Produit-Zengaffinen N, Pournaras CJ, Schorderet DF.. Autophagy induction does not protect retina against apoptosis in ischemia/reperfusion model. Adv Exp Med Biol. 2014; 801: 677–683. [DOI] [PubMed] [Google Scholar]
- 61. Zheng HX, Zhang XS, Sui N.. Advances in the profiling of N(6)-methyladenosine (m(6)A) modifications. Biotechnol Adv. 2020; 45: 107656. [DOI] [PubMed] [Google Scholar]
- 62. Weng Y-L, Wang X, An R, et al.. Epitranscriptomic m6A regulation of axon regeneration in the adult mammalian nervous system. Neuron. 2018; 97: 313–325.e316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Jin S, Zhang X, Miao Y, et al.. m(6)A RNA modification controls autophagy through upregulating ULK1 protein abundance. Cell Res. 2018; 28: 955–957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Chen T, Zheng L, Luo P, et al.. Crosstalk between m6A modification and autophagy in cancer. Cell Biosci. 2024; 14: 44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Wang L, Wang J, Yu P, et al.. METTL14 is required for exercise-induced cardiac hypertrophy and protects against myocardial ischemia-reperfusion injury. Nat Commun. 2022; 13: 6762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. Wang JN, Wang F, Ke J, et al.. Inhibition of METTL3 attenuates renal injury and inflammation by alleviating TAB3 m6A modifications via IGF2BP2-dependent mechanisms. Sci Transl Med. 2022; 14: eabk2709. [DOI] [PubMed] [Google Scholar]
- 67. Chen J, Xu C, Yang K, et al.. Inhibition of ALKBH5 attenuates I/R-induced renal injury in male mice by promoting Ccl28 m6A modification and increasing Treg recruitment. Nat Commun. 2023; 14: 1161. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Cheng P, Han H, Chen F, et al.. Amelioration of acute myocardial infarction injury through targeted ferritin nanocages loaded with an ALKBH5 inhibitor. Acta Biomater. 2022; 140: 481–491. [DOI] [PubMed] [Google Scholar]
- 69. Du YD, Guo WY, Han CH, et al.. N6-methyladenosine demethylase FTO impairs hepatic ischemia-reperfusion injury via inhibiting Drp1-mediated mitochondrial fragmentation. Cell Death Dis. 2021; 12: 442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Si W, Li Y, Ye S, et al.. Methyltransferase 3 mediated miRNA m6A methylation promotes stress granule formation in the early stage of acute ischemic stroke. Front Mol Neurosci. 2020; 13: 103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. He H, Zhang Q, Liao J, et al.. METTL14 is decreased and regulates m(6) A modification of α-synuclein in Parkinson's disease. J Neurochem. 2023; 166: 609–622. [DOI] [PubMed] [Google Scholar]
- 72. Chen X, Yu C, Guo M, et al.. Down-regulation of m6A mRNA methylation is involved in dopaminergic neuronal death. ACS Chem Neurosci. 2019; 10: 2355–2363. [DOI] [PubMed] [Google Scholar]
- 73. Castro-Hernández R, Berulava T, Metelova M, et al.. Conserved reduction of m(6)A RNA modifications during aging and neurodegeneration is linked to changes in synaptic transcripts. Proc Natl Acad Sci USA. 2023; 120: e2204933120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74. Zhao F, Xu Y, Gao S, et al.. METTL3-dependent RNA m(6)A dysregulation contributes to neurodegeneration in Alzheimer's disease through aberrant cell cycle events. Mol Neurodegener. 2021; 16: 70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75. Feng L, Wang C, Zhang C, Zhang W, Song W.. Role of epigenetic regulation in glaucoma. Biomed Pharmacother. 2023; 168: 115633. [DOI] [PubMed] [Google Scholar]







