The sigma‐1 receptor‐TAMM41 axis modulates neuroinflammation and attenuates memory impairment during the latent period of epileptogenesis

Abstract

Background

Therapy in the latent period is favorable for retarding the process of epileptogenesis. Recently, we have discovered that the activated sigma‐1 receptor (Sig‐1R) attenuates the hippocampus pathological injury and memory impairment in the latent period of epileptogenesis. But the molecular mechanism needs further investigation.

Methods

PRE‐084 was utilized as a research tool to highly selectively activate Sig‐1R in epileptic mice. After the treatment of PRE‐084, the pro‐inflammatory cytokines, neuropathological traits, and the level of mitochondrial translocator assembly and maintenance 41 homolog (TAMM41) in the hippocampus were examined. The mode in which the Sig‐1R interacts with TAMM41 was explored. The role of TAMM41 in the protecting effect of PRE‐084 was established.

Results

PRE‐084 inhibited the growth of pro‐inflammatory cytokines, reduced the formation of gliosis, alleviated neuronal damage in the hippocampus, and attenuated memory impairment in the latent period of epileptogenesis. The protein level of TAMM41 decreased in the hippocampi of epileptic mice and increased in the PRE‐084‐treated mice. The Sig‐1R bound with TAMM41 directly, maintaining the stability of TAMM41. Knockdown of TAMM41 reversed the protective effect of PRE‐084, and overexpression of TAMM41 exhibited a similar protective action to that of PRE‐084.

Conclusion

We presented the concept of the “sigma‐1 receptor–TAMM41 axis” and proposed that augmenting this axis can attenuate neuroinflammation and memory impairment in the process of epileptogenesis.

The activated sigma‐1 receptor (Sig‐1R) interacts with TAMM41 directly, then stabilizes TAMM41, and increases the content of TAMM41. Then, the status of neuroinflammation is inhibited in the hippocampus of epileptic mice, and the memory function of epileptic mice is improved.

1. INTRODUCTION

Epileptogenesis is a process in which a physiologic normal brain shifts into an epileptic condition. The latent period of epileptogenesis is the phase from the primary insult (e.g., trauma and status epilepticus) to the occurrence of spontaneous seizures. ¹ In this phase, persistent neuroinflammation, neuronal damage, and gliosis occur, all of which promote the development of chronic epilepsy and lead to memory impairment. ² , ³ Considering that the initial epileptogenic insult is inevitable in some cases and no effective method is available to treat chronic epilepsy, therapy in the latent period is more favorable. ⁴

Sigma‐1 receptor (Sig‐1R) is uncovered in the diverse kinds of membranes (e.g., endoplasmic reticulum, nuclear envelope) in neurons and glia, ⁵ functioning as both a receptor and a chaperone. As a receptor, it is activated by endogenous physiological chemicals and extrinsic drugs through orthodox or allosteric mechanisms. ⁵ , ⁶ For instance, PRE‐084 is a highly selective Sig‐1R agonist. ⁷ SKF83959, SOMCL‐668, and E1R are novel allosteric modulators. ⁸ As a chaperone, activated Sig‐1R binds to large numbers of protein molecules (including dopamine receptors, voltage‐gated sodium channels, and binding immunoglobulin proteins), regulates their activity, and then modulates various biological processes. ⁵ Thus, it serves as a pluripotent modulator in living organisms. ⁵ Recently, we reported that SKF83959 ameliorated cognitive injury and mental abnormality in epileptic mice by activating Sig‐1R. ⁹ We also found that inhibiting the activity of GSK‐3β may be one possible mechanism of the protective action of SKF83959. ⁹

However, the precise mechanism of these Sig‐1R agonists is not completely understood. The mitochondrial translocator assembly and maintenance 41 homolog (TAMM41) is a marginal protein molecule that is located near the mitochondrial inner membrane. In 2006, Tam41 (the homolog of TAMM41 in yeast) was reported to maintain the functional integrity of the translocase of inner mitochondrial membrane 23 and facilitate mitochondrial protein import. ¹⁰ In 2018, TAMM41 was identified as a mitochondrial cytidinediphosphate‐diacylglycerol synthase that is involved in cardiolipin synthesis. ¹¹ Additionally, in 2019, Yang et al. ¹² found that TAMM41 regulates heart valve formation via the PINK1‐dependent mitophagy pathway. In recent years, research has been conducted on TAMM41's role in diseases. Mutations in TAMM41 have been found in patients with heart valve differentiation abnormalities. ¹² The level of messenger RNA (mRNA) in TAMM41 in the prefrontal cortex is lower in patients with Alzheimer's disease than in control volunteers or mild cognitive impairment patients. ¹³ Furthermore, methylation of TAMM41 is evident in the DNA from the peripheral blood of patients suffering from type 1 diabetes and renal complications. ¹⁴ Our proteome assay indicated that TAMM41 may be the main effector after the activation of Sig‐1R (L. Guo, unpublished data). Thus, we hypothesized that TAMM41 is involved in ameliorating activated Sig‐1R in the latent phase of epileptogenesis.

In this study, we utilized PRE‐084 to specifically activate Sig‐1R and observed the corresponding pathological changes in the C57BL/6J mouse model of epileptogenesis. Then, we investigated the pattern in which Sig‐1R interacts with TAMM41 and explored TAMM41's efficacy in the protective activity of activated Sig‐1R.

2. MATERIALS AND METHODS

2.1. Drugs and antibodies

Kainic acid, PRE‐084, and cycloheximide were obtained from Sigma‐Aldrich Chemical Co. A bicinchoninic acid protein assay kit and a protein immunoprecipitation assay kit were purchased from Beyotime Biotechnology Company. The source and dilution of the antibodies are presented in Table 1.

TABLE 1.

Source and dilution of antibodies.

Antibody	Abbreviation	Category number	Research Resource Identifier	Company	Dilution
Anti‐glial fibrillary acidic protein	Anti‐GFAP	3670	AB_561049	Cell Signaling Technology, Danvers, MA, USA	1:300 (IF, WB)
Anti‐ionized calcium‐binding adapter molecule	Anti‐Iba1	019–19 741	AB_839504	Wako Chemicals, Wako, Osaka, Japan	1:300 (IF, WB)
Anti‐microtubule‐associated protein‐2	Anti‐MAP‐2	17 490‐1‐AP	AB_2137880	Proteintech, Chicago, IL, USA	1:300 (IF, WB)
Anti‐sigma‐1 receptor	Anti‐sig1R	ab53852	AB_881796	San Francisco, CA, USA	1:1000 (WB)
Anti‐TAMM41		A8374	AB_2772518	Abclonal, Wuhan, Hubei Province, China	1:300 (IF) 1:1000 (WB)

Abbreviations: GFAP, glial fibrillary acidic protein; Iba1, ionized calcium binding adapter; IF, immunofluorescene; MAP‐2, microtubule‐associated protein‐2; TAMM41, translocator assembly and maintenance 41 homolog; WB, Western blot.

TAMM41 small interfering RNA (siRNA, Tamm41‐585: 5′‐CCUCAUGCUACCUGAAAGCUUTT‐3′, 5′‐AAGCUUUCAGGUAGCAUGAGGTT‐3′) and the corresponding scramble siRNA (as the negative control [NC]) were obtained from Santa Cruz Biotechnology (Shanghai) Co., Ltd. Adeno‐associated viruses containing the TAMM41 coding sequence (pHBAAV‐CMV‐MCS‐3flag‐T2A‐ZsGreen, abbreviation: AAV‐TAMM41) and the vector virus (AAV‐CON) were obtained from Hanbio Company. The Sig‐1R knockdown HEK293T cell line (sh‐Sig1‐R) and the control cell line (sh‐control) were provided by Prof. Zhen (Soochow University, China). The HEK293T cells that stably overexpress Sig‐1R (Sig‐1R‐OE) and the NC cell line (Sig‐1R‐NC) were constructed using lentivirus in our laboratory. ¹⁵

2.2. Animal

Male C57BL/6J mice (age: 6–8 weeks and weight: 18–22 g) were supplied by Central Animal House, Xuzhou Medical University, and housed in the specific pathogen‐free room. Five mice were reared in a plastic cage (330 × 215 × 200 mm) with a metal cover. Each cage contained a polycarbonate shelter to enrich the cage environment. The illumination time was set from 7:00 a.m. to 7:00 p.m. The relative humidity was 50%–70%, and the room temperature was 21–23°C. The air was exchanged every 20 min. Animals were provided food and water ad libitum. Chemical administration and behavioral experiments were performed from 9:00 a.m. to 6:00 p.m.

2.3. Epilepsy model and drug treatment

A post‐status‐epilepticus (SE) epilepsy model was used in our study. Based on a previously described method, ¹⁶ low‐dose kainic acid was repeatedly administered intraperitoneally (every 30 min; 24 mg kg⁻¹ for the first time and 10 mg kg⁻¹ subsequently) until a seizure was triggered successfully. After each kainic acid administration, the seizures were scored using the published scales that were graded into six levels. ¹⁷ , ¹⁸ The seizure score of each mouse was defined by the maximal score. Only animals that exhibited level 4–5 seizures that lasted for at least 5 min were regarded as being invoked successfully. Two hours after the animals were invoked, diazepam (10 mg kg⁻¹) was injected intraperitoneally to terminate SE. PRE‐084 (5 mg kg⁻¹) was injected intraperitoneally the next day.

2.4. Brain stereotoxic injection

Sodium pentobarbital (45 mg kg⁻¹) was injected intraperitoneally to anesthetize the animals. After anesthetization, the animals were fixed in the stereotaxic frame. TAMM41 siRNA (2 nmol for each mouse, mixed with 200 μM Entranster‐in vivo) or AAV‐TAMM41 was administered to both sides of the hippocampus. The injecting volume was 0.5 μL each side of the hippocampus; the injecting velocity was 0.1 μL min⁻¹. The injecting loci coordinates were 2.5 mm (Anteroposterior, [AP]), ±1.5 mm (mediolateral), and 2.0 mm (dorsoventral) from the Bregma point. Five minutes after the infusion, the needle was pulled out. The animals were allowed to recover for at least 3 days before the other tests were performed. An equal volume of the negative‐control siRNA or AAV control was given to the control group.

2.5. Cell culture

HEK293T cells and SH‐SY5Y cells were cultured using the Dulbecco's modified Eagle's medium (DMEM) and DMEM/F12 culture medium, respectively. All media were supplemented with fetal bovine serum (v/v: 10%) and penicillin/streptomycin (final concentrations: 100 units mL⁻¹ and 100 μg mL⁻¹, individually). All cells were grown in a humidified cell incubator (5% CO₂, 37°C). In the cellular experiment, the final concentration of PRE‐084 was set at 10 μmol L⁻¹.

2.6. Western blot

The entire operating details are available in our previous study. ¹⁹ The dilution ratios are presented in Table 1. The band density was quantified using Fiji ImageJ software.

2.7. Quantitative polymerase chain reaction

The details of quantitative polymerase chain reaction are provided in our previous research. ²⁰ The 2^−∆∆Ct method was utilized to compute the fold change. Then, the fold changes were normalized to GAPDH levels. The parameter C _t represents the cycle number at which the fluorescence signal crosses the threshold. The primer sequences used are presented in Table 2.

TABLE 2.

Primer sequences used for PCR.

Gene	Forward	Reverse
GAPDH	TGTGTCCGTCGTGGATCTGA	TTGCTGTTGAAGTCGCAGGAG
iNOS	TAGGCAGAGATTGGAGGCCTTG	GGGTTGTTGCTGAC TTCCAGTC
TNF‐α	CAGG AGGGAGAACAGAAACTCCA	CCTGGTT GGCTGCTTGCTT
IL‐1β	TCCAGGATGAGGACATGAGCAC	GAACGTCAC ACACCAGCAGGTTA
GAPDH	CAGGAGGCATTGCTGATGAT	GAAGGCTGGGGCTCATTT
TAMM41	CTTCCGCAAGATCCTGTCTCACTTC	AGCATAGCATTCTTCTGGTCTGAACTC

Abbreviations: IL‐1 β, interleukin‐1β; iNOS, inducible nitric oxide synthase; TAMM41, translocator assembly and maintenance 41 homolog; TNF‐α, tumor necrosis‐α.

2.8. Immunoprecipitation

Brain tissues or cells were harvested and lysed. The protein concentrations of the lysates were measured using the Bicinchoninic Acid Assay and adjusted to 1 mg mL⁻¹. The lysates were mixed with the target antibody or rabbit IgG. The mixture was centrifuged overnight at 4°C. Then, protein A + G agarose beads were prewashed thrice using phosphate buffer solution and were added to the lysate and antibody mixture. The mixture was centrifuged for 4 h at 4°C. Then, the beads were washed five times using phosphate buffer solution at 4°C. Each wash lasted 5 min. Then, the beads were eluted with 20 μL of 2× loading buffer and subsequently were heated for 10 min at 100°C. After the process of elution, the samples in the mixture were immediately separated, and the protein interaction was examined using Western blot.

2.9. Protein degradation assay

The procedure used for the protein degradation assay has been described previously. ²¹ Briefly, cycloheximide (100 μg mL⁻¹) was injected into sh‐Sig1‐R and sh‐control cells for inhibiting protein synthesis de novo. Then, the cells were collected at the preset times (0, 2, 6, 12, and 24 h) and lysed. The expression level of TAMM41 was analyzed using Western blot, which was normalized to GAPDH. The protein turnover curve was fitted using a one‐phase decay equation: ${\text{Amount}}_t={\text{Amount}}_0{\mathrm{e}}^{-\mathit{kt}}$. Amount _t refers to the relative TAMM41 amount at time t, Amount₀ is the relative TAMM41 amount at time 0, k is the decay constant, and t is the time point.

2.10. Immunofluorescence

The procedures used for immunofluorescence are available in our published research. ²⁰ On the eighth day after epilepsy induction, the animals were perfused with 4% paraformaldehyde. The dilution of primary antibodies (anti‐TAMM41, anti‐MAP‐2 [microtubule‐associated protein‐2], anti‐GFAP [glial fibrillary acidic protein], and anti‐Iba1 [ionized calcium binding adapter]) is presented in Table 1. The secondary antibodies were diluted to 1:300. The immunofluorescence images were obtained, and the number of positive cells in the whole slice was counted manually by an experimenter in a double‐blind manner.

2.11. Behavior test

The behavioral tests comprised an object location test (OLT), a novel object recognition test (NORT), and a pattern separation test (PST). They were conducted in a double‐blind manner from the fifth to the eighth day after the induction of epilepsy. Only one behavioral test was performed each day. The experimental process is described in a previous study. ²² To evaluate the animals' memory function, the recognition index, which is the percentage of the new‐object exploring time in the whole exploring duration, was calculated. ¹⁹

2.12. Statistical analysis

Data were expressed as mean ± standard error of the mean. For comparing the differences between the two groups, Student's t‐test was used. For more than two groups, one‐way analysis of variance followed by Tukey's multiple comparison test was performed. Statistical significance was set at p < 0.05. Data were analyzed using GraphPad Prism software (version 8.0, GraphPad Software, Inc.).

3. RESULTS

3.1. PRE‐084 prevents the increase in pro‐inflammatory cytokines, reduces hippocampal neuron damage, and ameliorates memory impairment

The processes employed for epilepsy induction, drug treatment, behavioral testing, and biochemical assay are shown in Figure 1A. Based on the published work, ²³ maximum brain injury occurs on the seventh day in C57 mice. Thus, we focused on the change around the seventh day after SE.

FIGURE 1.

Effect of PRE‐084, a Sig‐1R (sigma‐1 receptor) agonist, on the inflammatory mediators in the hippocampus and in memory impairment. (A) Experimental diagram depicting epilepsy inducement, drug treatment, and testing processes. (B–D) Recognition indices in the NORT, OLT, and PST. (E–G) The inflammatory mediator mRNA (messenger RNA) levels in the hippocampus. Epilepsy was induced by intraperitoneal injection of kainic acid. PRE‐084 (5 mg kg⁻¹) was administered intraperitoneally the day after the inducement of epilepsy. The behavior tests were performed from the fourth to the seventh day (n = 10 in each group). The mRNA expression levels of TNF‐α, IL‐1β, and iNOS were quantified using qPCR (quantitative polymerase chain reaction) on the eighth day (n = 6 in each group). Data were expressed as mean ± SEM (standard error of the mean) and analyzed using one‐way ANOVA (analysis of variance) followed by Tukey's multiple comparison tests. *p < 0.05; **p < 0.01; and ***p < 0.001. TNF‐α, tumor necrosis‐α, IL‐1β, interleukin‐1β, iNOS, inducible nitric oxide synthase; OLT, object location test; NORT, novel object recognition test; PST, pattern separation test.

As hippocampal impairment is the main pathological characteristic of epileptogenesis, we first tested the memory function of epileptic mice. For these behavioral tests, the recognition indices in the epilepsy group were lower, compared with the control group, whereas the recognition indices in the epilepsy + PRE‐084 group were higher, compared with the epilepsy group (Figure 1B–D).

Neuroinflammation is a main characteristic and contributor of epilepsy and accompanied cognitive dysfunction. We also examined the important pro‐inflammatory molecules. Compared with those in the control group, the mRNA quantities of tumor necrosis‐α (TNF‐α), interleukin‐1β (IL‐1β), and inducible nitric oxide synthase (iNOS) were significantly higher in the epilepsy group (Figure 1B–D). In contrast, these values were significantly lower in the epilepsy + PRE‐084 group than in the epilepsy group (Figure 1E–G).

Gliosis formation and neuronal damage in the hippocampus are the main pathological characteristics of epileptogenesis. Gliosis consists of activated astrocytes (GFAP⁺) and microglia (Iba1⁺). In this study, the quantities of GFAP⁺ astrocytes (including the total hippocampus, the dentate gyrus [DG], and the CA1 area) were higher in the epilepsy group compared with the control group (Figure 2A,D). For Iba⁺ microglia, a similar change was observed (Figure 2B,E). The expression of MAP‐2 marks the extent of neuron damage. ²⁴ Compared with the control group, the numbers of MAP‐2⁺ neurons in the total hippocampus and DG were lower in the epilepsy group (Figure 2C,F). In contrast, the quantities of GFAP⁺ astrocytes and Iba1⁺ microglia were lower in the epilepsy + PRE‐084‐treated group compared with the epilepsy group (Figure 2A,D for astrocytes; Figure 2B,E for microglia). The numbers of MAP‐2⁺ neurons were higher in the epilepsy + PRE‐084 group compared with the epilepsy group (Figure 2C,F). These findings indicated that RPE‐084 can alleviate neuroinflammation, formation of gliosis, neuron damage, and cognitive memory impairment in the latent period of epileptogenesis. Combining our recent published study, ⁹ our findings suggested that activating Sig‐1R is an effective antiepileptogenesis strategy.

FIGURE 2.

Effect of PRE‐084 on gliosis and neuron damage in mouse hippocampus in the latent period of epileptogenesis. (A) Typical images of GFAP⁺ astrocytes. (B) Typical images of Iba1⁺ microglia. (C) Typical images of MAP‐2⁺ neurons. (D) Quantification of GFAP⁺ astrocytes in the hippocampal, DG, and CA1 regions. (E) Quantification of microglia in the hippocampal, DG, and CA1 regions. (F) Quantification of MAP‐2⁺ neurons in the total hippocampal, DG, and CA1 regions. The representative characteristics are marked with arrows. Epilepsy was induced by kainic acid injection, and the mice were killed on the eighth day. PRE‐084 (5 mg kg⁻¹) was administered intraperitoneally the day after the inducement of epilepsy. DG, dentate gyrus; GFAP, glial fibrillary acidic protein; Iba1, ionized calcium binding adapter; MAP‐2, microtubule‐associated protein‐2. Data were expressed as mean ± SEM (standard error of the mean) and analyzed using one‐way ANOVA (analysis of variance) followed by Tukey's multiple comparison tests. *p < 0.05; **p < 0.01; and ***p < 0.001. Each group comprised three mice.

3.2. The protein expression of TAMM41 is regulated by Sig‐1R

Next, we examined the changes in TAMM41 in the epilepsy model and the effect of PRE‐084 on the TAMM41 expression. The protein level of TAMM41 in the epilepsy group was lower compared to the control group, whereas the protein expression of TAMM41 in the epilepsy + PRE‐084‐treated group was higher compared with the epilepsy group (Figure 3A,B). Similarly, the protein level of TAMM41 in PRE‐084‐treated HEK‐293T cells was significantly higher compared with the PRE‐084‐free HEK‐293T cells (Figure 3C,D).

FIGURE 3.

The protein expression of TAMM41 (translocator assembly and maintenance 41 homolog) is regulated by Sig‐1R (sigma‐1 receptor). (A) Protein levels of TAMM41 in the control, epilepsy, and epilepsy + PRE‐084 groups (n = 6 independent experiments). (B) Statistical graph of (A). (C) Protein levels of TAMM41 in the HEK293T cells with and without PRE‐084 treatment (n = 3 independent experiments). (D) Statistical graph of (C). (E) Protein levels of TAMM41 and Sig‐1R in the Sig‐1R‐OE and Sig‐1R‐NC cells (n = 3 independent experiments). (F and G) Statistical graph of (E). (H) Protein levels of TAMM41 and Sig‐1R in the sh‐Sig‐1R cell line and sh‐control cell line (n = 3 independent experiments). (I and J) Statistical graph of (H). Epilepsy was induced by kainic acid injection, and the mice were killed on the eighth day. PRE‐084 (5 mg kg⁻¹) was administered intraperitoneally the day after the inducement of epilepsy. The final concentration of PRE‐084 was 10 μmol L⁻¹ in the cellular experiments. Data were expressed as mean ± SEM (standard error of the mean) and analyzed using one‐way ANOVA (analysis of variance) followed by Tukey's multiple comparison tests (B) or analyzed using Student's t‐test (D, F, G, I, and J). *p < 0.05; **p < 0.01, ***p < 0.001; and ****p < 0.0001. sh‐Sig‐1R, sigma‐1 receptor knockdown HEK293T cell line; sh‐control, the control cell corresponding to the sh‐Sig‐1R cell line; Sig‐1R‐OE, sigma‐1 receptor‐overexpressing HEK293T cell line; Sig‐1R‐NC, the control cell corresponding to the Sig‐1R‐OE cell line.

Overexpression is another Sig‐1R activating pathway. Thus, we observed the effect of Sig‐1R overexpression on the protein level of TAMM41. We found that TAMM41 levels were significantly higher in Sig‐1R‐overexpressing (OE) HEK293T cells than in Sig‐1R‐NC HEK‐293T cells (Figure 3E–G). In contrast, the level of TAMM41 was significantly lower in the Sig‐1R knockdown (sh‐Sig‐1R) HEK293T cells than in the sh‐control HEK293T cells (Figure 3H–J).

3.3. Sig‐1R stabilizes TAMM41 protein

We then examined the pattern of action of Sig‐1R and TAMM41. Notably, colocalization of Sig‐1R and TAMM41 was observed in HEK293T and SH‐5H5Y cells (Figure 4A). Immunoprecipitation tests demonstrated that Sig‐1R interacted with TAMM41 in HEK293T cells and SH‐SY5Y cells (Figure 4B). In the protein degradation assay, the decay constant (k) was significantly larger in sh‐Sig‐1R cells than in sh‐control cells (Figure 4C,D). The difference in TAMM41 mRNA expression was insignificant between the Sig‐1R‐OE and sig‐1R‐NC cell lines (Figure 4E). Therefore, we proposed that Sig‐1R directly binds to TAMM41 and stabilizes TAMM41 at the posttranslational level.

FIGURE 4.

The interaction of Sig‐1R (sigma‐1 receptor) with TAMM41 (translocator assembly and maintenance 41 homolog). (A) Colocalization of Sig‐1R with TAMM41 in HEK293T and SH‐SY5Y cells. (B) Immunoprecipitation images showing the direct interaction between Sig‐1R and TAMM41 in HEK293T and SH‐SY5Y cells. The band of TAMM41 is marked with red arrows. (C) Representative images showing the turnover of TAMM41 in the sh‐Sig‐1R cell line. (D) Summarized chart of independent turnover studies (n = 3 independent experiments). (E) mRNA (messenger RNA) level of TAMM41 in the Sig‐1R‐NC cell line and the Sig‐1R‐OE cell line (n = 4 independent experiments). In the turnover test, cycloheximide (100 μg mL⁻¹) was added to inhibit de novo synthesis of proteins. Protein levels of TAMM41 were examined using Western blot at the indicated times. The mRNA level of TAMM41 was measured using qPCR (quantitative polymerase chain reaction). Data were expressed as mean ± SEM (standard error of the mean) and analyzed using Student's t‐test. The decay curves were fitted using an exponential decay equation in which k represents the decay constant. sh‐Sig‐1R, sigma‐1 receptor knockdown HEK293T cell line; sh‐control, the control cell corresponding to the sh‐Sig‐1R cell line; Sig‐1R OE, sigma‐1 receptor‐overexpressing HEK293T cell line; Sig‐1R‐NC, the control cell corresponding to the Sig‐1R‐OE cell line.

3.4. Knockdown of TAMM41 reverses the protective action of PRE‐084

Next, the role of TAMM41 in the protective effects of PRE‐084 was examined. The process of epilepsy induction, siRNA delivery, drug treatment, behavioral tests, and biochemical assays is shown in Figure 5A. In this study, all mice were epileptic and were treated with PRE‐084. The protein level of TAMM41 was successfully knocked down by TAMM41 siRNA (Figure 5B,C). TAMM41‐siRNA group demonstrated higher mRNA levels of TNF‐α, IL‐1β, and iNOS compared with the NC‐siRNA group (Figure 5D–F). The recognition indices in the OLT, NORT, and PST were lower in the TAMM41‐siRNA group compared with the NC‐siRNA group (Figure 5G–I).

FIGURE 5.

Knockdown of TAMM41 (translocator assembly and maintenance 41 homolog) reversed the anti‐inflammatory and memory‐improving action of PRE‐084. (A) Experimental schematic showing epilepsy induction, drug treatment, siRNA (small interfering RNA) delivery, and testing processes. (B) Western blot image indicating that protein expression was knocked down by TAMM41 siRNA (n = 6 in each group). (C) Summarized results from (B). (D–F) mRNA (messenger RNA) levels of inflammatory mediators in the hippocampus. (G–I) Recognition indices in the OLT, NORT, and PST. Epilepsy was induced by kainic acid injection. PRE‐084 (5 mg kg⁻¹) was administered intraperitoneally the day after the inducement of epilepsy. Behavior tests were performed from the fifth to the eighth day (n = 10 in each group). mRNA expression levels of TNF‐α, IL‐1β, and iNOS were quantified using qPCR (quantitative polymerase chain reaction) on the eighth day (n = 6 in each group). Data were expressed as mean ± SEM (standard error of the mean) and analyzed using Student's t‐test. *p < 0.05; **p < 0.01; ***p < 0.001, and ****p < 0.0001. IL‐1β, interleukin‐1β; iNOS, inducible nitric oxide synthase; NORT, novel object recognition test; OLT, object location test; PST, pattern separation test; TNF‐α, tumor necrosis‐α.

The TAMM41‐siRNA group exhibited a higher number of astrocytes (marked as GAFP⁺) compared with the NC‐siRNA group (Figure 6A,D). Similar tendency was found for the number of Iba1⁺ cells (Figure 6B,E). In contrast, the number of MAP‐2⁺ neurons was significantly lower in the TAMM41‐siRNA group compared with the NC‐siRNA group (Figure 6C,F). These results showed that TAMM41 knockdown reversed the protective action of PRE‐084.

FIGURE 6.

Knockdown of TAMM41 (translocator assembly and maintenance 41 homolog) reversed the gliosis‐inhibition and neuron‐protective actions of PRE‐084. (A) Typical images of GFAP⁺ astrocytes. (B) Typical images of Iba1⁺ microglia. (C) Typical images of MAP‐2⁺ neurons. (D) Quantification of GFAP⁺ astrocytes in the hippocampal, DG, and CA1 regions. (E) Quantification of microglia in the hippocampal, DG, and CA1 regions. (F) Quantification of MAP‐2⁺ neurons in the total hippocampal, DG, and CA1 regions. The representative characteristics are marked with arrows. Epilepsy was induced by kainic acid injection, and the mice were killed on the eighth day. PRE‐084 (5 mg kg⁻¹) was administered intraperitoneally the day after the inducement of epilepsy. DG, dentate gyrus; GFAP, glial fibrillary acidic protein; Iba1, ionized calcium binding adapter; MAP‐2, microtubule‐associated protein‐2; NC‐siRNA, negative control siRNA. Data were expressed as mean ± SEM (standard error of the mean) and analyzed using Student's t‐test. *p < 0.05; **p < 0.01; and ***p < 0.001. Each group comprised three mice.

3.5. Increased expression of TAMM41 exhibited a protective effect similar to the activation of Sig‐1R

In this study, we injected AAV‐TAMM41 into the hippocampi of mice and examined the direct protective activity of TAMM41. The experimental procedure is shown in Figure 7A. In the epilepsy + AAV‐TAMM41 group, the mRNA levels of TNF‐α, IL‐1β, and iNOS were significantly higher compared with the epilepsy group (Figure 7B–D). The recognition indices in the ORT, NORT, and PST were significantly lower in the epilepsy group than those in the control group, whereas these were higher in the epilepsy + AAV‐TAMM41 group compared with the epilepsy group (Figure 7E–G). Therefore, we confirmed the direct protective activity of TAMM41. Based on these findings, we concluded that the protective action of Sig‐1R is, at least partially, due to the stabilization of TAMM41.

FIGURE 7.

Overexpression of TAMM41 (translocator assembly and maintenance 41 homolog) modulates neuroinflammation and attenuates memory impairment during the latent period of epileptogenesis. (A) Experimental diagram depicting epilepsy induction, AAV injection, and testing procedures. (B–D) The inflammatory mediator mRNA (messenger RNA) levels in the hippocampus (n = 6 in each group). (E–G) Recognition indices in the OLT, NOR, and PST (n = 10 in each group). Data were expressed as mean ± SEM (standard error of the mean) and analyzed using one‐way ANOVA (analysis of variance) followed by Tukey's multiple comparison tests. *p < 0.05; **p < 0.01; and ***p < 0.001. IL‐1β, interleukin‐1β; iNOS, inducible nitric oxide synthase; NORT, novel object recognition test; OLT, object location test; PST, pattern separation test; TNF‐α, tumor necrosis‐α.

4. DISCUSSION

In this research, we found that activating Sig‐1R can inhibit neuroinflammation and alleviate memory impairment during the latent period of epileptogenesis. We also identified a new direct target of Sig‐1R, namely TAMM41, which was stabilized by Sig‐1R and was involved in the protective activity of Sig‐1R. Based on these findings, we presented the “Sig‐1R‐TAMM41 axis” concept and proposed that augmenting the Sig‐1R‐TAMM41 axis is a feasible approach for the treatment of epileptogenesis.

Notably, Su et al. ⁵ suggested that Sig‐1R is a multiple functional modulator. It interacts with various kinds of proteins (e.g., Na⁺ ion channels, dopamine receptor‐1) and modulates their functions. In 2020, Lee et al. ²¹ reported that Sig‐1R maintains the nuclear pore proteins such as Nup358, Nup214, and Nup50. This finding suggests a novel mechanism by which Sig‐1R maintains the stability of proteins. In this research, we provided more evidence for this mechanism.

Thus far, research on the role of TAMM41 in diseases is limited, and how it is regulated remains unknown. ¹² , ¹³ , ¹⁴ Our study suggests that TAMM41 is involved in the process of epilepsy because its protein level was reduced in the epileptic hippocampus and the overexpression of TAMM41 ameliorated pathological changes and memory impairment. Moreover, our study also proposed a regulatory pathway of TAMM41, namely via activating Sig‐1R, as activated Sig‐1R directly binds to TAMM41 and inhibits the turnover rate of TAMM41. Considering that some marketed drugs (e.g., fluvoxamine) have the potential to activate Sig‐1R, our study supports a feasible method for activating the Sig‐1R‐TAMM41 axis and provides a novel therapeutic pathway for epilepsy.

Neuroinflammation is important in the process of epilepsy and related memory impairment, ²⁵ , ²⁶ as neuroinflammation triggered by an initial injury leads to gliosis and neuron damage. ²⁷ It has been reported that TNF‐α and IL‐1β directly lead to convulsive seizures and cause memory impairment. ³ Our group has found that the anti‐inflammatory action of Sig‐1R agonists is partially attributed to the prevention of the calcineurin/GSK‐3β signal routing in cultured BV‐2 microglia. ²⁸ Here, we found that treatment with PRE‐084 or overexpression of TAMM41 suppressed the action of pro‐inflammatory cytokines, reduced the activation of microglia, and inhibited the proliferation of astrocytes. These findings suggest that augmenting the Sig‐1R‐TAMM41 axis may be an alternative route for inhibiting neuroinflammation.

In this study, we used PRE‐084 to selectively activate Sig‐1R. PRE‐084 is an excellent tool for investigating the Sig‐1R therapeutic value. ⁷ However, Motawe et al. ²⁹ proposed that PRE‐084 may exhibit its off‐target effects when Sig‐1R expression is reduced. Here, we considered that its off‐target effect is negligible in this research, as Sig‐1R is abundant in the brain.

It has not been determined whether the protective effect of PRE‐084 is due to directly inhibiting status epilepticus. However, we assumed that this possibility was remote. Notably, the action of Sig‐1R agonists highly depends on the dose of these compounds. Our published study has indicated that only more than 20 mg kg⁻¹ of high‐potency Sig‐1R agonists (e.g., SKF10047) suppressed the hyperexcitability of neurons and the convulsive seizures in status epilepticus. ¹⁸ Our primary study also showed that 5 mg kg⁻¹ of PRE‐084 was insufficient to prevent the hyperexcitability of neurons and accompanying convulsions. Moreover, the mice exhibiting similar severity and duration of status epilepticus were chosen and divided randomly, and the status epilepticus convulsions were terminated using diazepam ahead of the PRE‐084 injection. Therefore, we propose that the action of PRE‐084 is independent of its antineuroexcitability or anticonvulsive actions in this research.

Considering that some Sig‐1R agonists may induce ataxia (e.g., (+)‐SKF10047) or hyperlocomotion (e.g., dextromethorphan and dextrorphan) in animals, ³⁰ , ³¹ it is possible that PRE‐084 exhibited a similar effect and therefore confound memory or behavioral tests. However, it should be noted that ataxia or hyperlocomotion was observed only at high doses (dextromethorphan and dextrorphan: >20 mg kg⁻¹; (+)‐SKF10047: >10 mg kg⁻¹). In addition, PRE‐084 (<30 mg kg⁻¹) does not change the locomotor activity of mice, and (+)‐SKF10047 (2.5–10.0 mg kg⁻¹, i.p.) does not induce the observed stereotyped behaviors nor locomotor hyperactivity. ³⁰ , ³² Therefore, we have excluded this possibility.

This study has some limitations. Our recent published study has shown that inhibiting calcineurin/GSK‐3β signal routing contributes to the antineuroinflammatory action of activated Sig‐1R. ⁹ , ²⁸ Here, we emphasized the role of Sig‐1R‐TAMM41 axis. Due to limited knowledge of the regulating pattern of TAMM41, whether these two pathways act independently or crosslink and act synergistically needs further investigation.

In summary, based on this research, we present the concept of the Sig‐1R‐TAMM41 axis and propose that augmentation of the Sig‐1R‐TAMM41 axis inhibits neuroinflammation and memory impairment in the process of epileptogenesis.

AUTHOR CONTRIBUTIONS

J.J. and C.G. conducted the molecular experiment. Q.W. and X.J. performed the immunofluorescence experiment. Y.W. contributed to cell culture. H.T. was involved in animal seeding and injection in vivo. Z.L. performed the behavioral tests. C.G., H.T., and Z.L. prepared Figures 1 and 6. J.J. and Q.W. prepared Figures 2 and 7. C.G. and X.J. prepared Figures 3, 4, 5. Y.W. and L.G. wrote the manuscript. All authors reviewed the manuscript.

FUNDING INFORMATION

This project was supported by grants from the National Natural Science Foundation of China (Grant Nos. 81872847 and 82173803), the Science and Technology Planning Project of Xuzhou (Grant No. KC22256), and the Science and Technology Developing Fund of The Affiliated Hospital of Xuzhou Medical University (Grant No. 2021ZA14). Support provided by the Qing Lan Project of Jiangsu Province (2022) is also appreciated.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflicts of interest to this work. Yun Wang is an editorial board member of AMEM and a coauthor of this article. To minimize bias, he was excluded from all editorial decision making related to the acceptance of this article for publication.

ETHICS STATEMENT

This study was performed in line with the “ARRIVE” guidelines (Animals in Research: Reporting In Vivo Experiments) and the Guidelines for the Care and Use of Laboratory Animals (Chinese National Research Council, 2006). Approval was granted by the Ethics Committee of Xuzhou Medical University (No. 202209S058).

Ji J, Gao C, Wang Q, et al. The sigma‐1 receptor‐TAMM41 axis modulates neuroinflammation and attenuates memory impairment during the latent period of epileptogenesis. Anim Models Exp Med. 2025;8:197‐208. doi: 10.1002/ame2.12341

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author on reasonable request.