Abstract
Background and aim
The escalation of fungal infections is driving an increase in disease and mortality rates. In particular, the emergence of Candida auris (C. auris), which shows powerful resistance to the antifungal drug fluconazole, is becoming a global concern. Furthermore, several biological hurdles need to be overcome by candidate therapeutics because C. auris has the ability to form biofilm. Therefore, this study aimed to investigate the antifungal and anti-biofilm effects of plumbagin, a natural extract, against fluconazole-resistant C. auris (FRCA).
Experimental procedure
The minimum inhibitory concentrations (MICs) of fluconazole and plumbagin were determined against clinically isolated C. auris. Inhibition of biofilm formation and eradication effects of plumbagin against FRCA were confirmed through minimum biofilm inhibition concentration (MBIC) and minimum biofilm eradication concentration (MBEC) assays. Additionally, the inhibition of metabolic activity in biofilm cells was verified through quantification by XTT reduction assay and visualization by confocal laser scanning microscopy (CLSM). The relative expression levels of the azole resistant gene ERG11, the efflux pump gene CDR1, and the extracellular matrix gene KRE6, were measured.
Results and conclusion
Plumbagin exhibits antifungal efficacy against C. auris and has been shown to effectively inhibit both the formation and eradication of biofilms produced by FRCA. Furthermore, the metabolic activity inhibition in biofilm cells was both quantified and visually observed. The downregulation of all genes (ERG11, CDR1, and KRE6) by plumbagin was confirmed. Taken together, this study demonstrates that plumbagin has antifungal and anti-biofilm efficacy against FRCA, indicating its potential as an alternative to antifungal agents and a valuable resource in combating FRCA infections.
Keywords: Antifungal, anti-Biofilm, Plumbagin, Fluconazole-resistant Candida auris, Efflux pump, Extracellular matrix
Graphical abstract
1. Introduction
Fungal infections pose a serious global threat due to their ability to spread and colonize the tissues of immunocompromised patients.1 At least 150 million fungal infections and 1.5 million deaths annually are reported.2 The majority of fungal-related deaths are attributed to four genera: Candida, Cryptococcus, Aspergillus, and Pneumocystis.3 Surprisingly, around 700,000 cases of candidiasis are caused by Candida species each year. The mortality rate for this disease is 23 %, which is the highest among fungal diseases in the USA.4 Within Candida species, Candida albicans and Candida auris are classified as critical pathogens on the Fungal Priority Pathogens List (FPPL) announced by the World Health Organization (WHO) in 2022.5
Candida auris (C. auris) was first discovered in 2009 and has rapidly emerged as a significant global pathogen within just 15 years. C. auris is known for its ability to colonize both human skin and abiotic surfaces, facilitating transmission between patients.6 This colonization is closely related to biofilm formation. Biofilm is a microbial aggregate formed by the attachment of a large number of bacteria to biotic or abiotic surfaces and is characterized by the secretion of extracellular polymeric substances (EPS).7,8 Biofilm formation enables evasion of the host immune response, promoting fungal persistence and spread. This process ultimately contributes to antifungal drug resistance.9,10
Because they create biofilms, the majority of C. auris strains are inherently resistant to most antifungal agents, with particularly high resistance to fluconazole, ranging from 87 % to 100 %.5 Unfortunately, despite the pathogenicity, there are currently few strategies available for treating fluconazole-resistant C. auris (FRCA).
Earlier studies have reported that plumbagin, a medicinal plant extract, has outstanding antifungal and antibacterial effects against Candida albicans and Staphylococcus aureus.11,12 Plumbagin is a naturally occurring naphthoquinone isolated from the roots of Plumbago zeylanica L and has been shown to possess a number of therapeutic activities including anticancer, anti-inflammatory, antioxidant, and antifungal properties.13, 14, 15, 16
Despite the fact that plumbagin has been shown to have antifungal effects, its efficacy against FRCA has not been studied in detail. Therefore, we aimed to investigate the antifungal and anti-biofilm effects of plumbagin against FRCA specifically, and its potential as a treatment strategy for fungicide-resistant bacteria.
2. Materials and methods
2.1. Organism, growth conditions, and reagents
The eight clinical isolates used in this study were provided by the National Culture Collection for Pathogens (NCCP) and Korea Biobank Network (KBN). These strains were sub-cultured on Sabouraud dextrose agar (SDA; Difco, Becton, Dickinson and Company, Sparks, MD), then inoculated in Sabouraud dextrose broth (SDB; Difco, Becton, Dickinson, and Company) and cultured at 37 °C. To ensure accurate diagnosis, the matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and internal transcribed spacer (ITS) gene sequence of the C. auris strains used in this study were analyzed, confirming its identity as C. auris (Fig. S1 and Fig. S2). Fluconazole and plumbagin were purchased from TCI (Ltd., Tokyo, Japan) and Sigma-Aldrich (St. Louis, MO), respectively. Both compounds were dissolved in dimethyl sulfoxide (DMSO), and the final concentration of DMSO did not exceed 2 % in any experiment. Regarding the use of clinical samples, this study was approved by the International St. Mary's Hospital, Catholic Kwandong University College of Medicine in Korea (IS21EISI0040).
2.2. Minimum inhibitory concentration assay
The minimum inhibitory concentrations (MICs) were determined for the purpose of confirming both the susceptibility to fluconazole and the antifungal effect of plumbagin against clinical isolates. MIC assay was performed by slightly modifying the broth microdilution method suggested by the European Committee on Antimicrobial Susceptibility Testing (EUCAST).17 Fungal suspensions (1 × 106 CFU/mL) were dispensed into 96-well plates (BD Falcon™, Franklin Lakes, NJ) with plumbagin and incubated at 37 °C for 24 h. After 24 h, the absorbance of the plate was measured at a wavelength of 600 nm using a Multiskan GO plate reader (Thermo Fisher Scientific, Waltham, MA, USA). In this study, MIC was defined as the concentration that inhibited the growth rate by 98 % compared to the control group.
2.3. Minimum biofilm inhibition concentration assay
The minimum biofilm inhibition concentration (MBIC) assay was conducted, with some modifications, to evaluate the effect of plumbagin on biofilm formation.18 Fungal suspensions (1 × 106 CFU/mL) with various concentrations of plumbagin (0.0625, 0.125, 0.25, 1, 2 μg/mL) were dispensed into 96-well plates, and the plates incubated at 37 °C for 24 h. After completely removing the supernatant, plates were washed twice with phosphate-buffered saline (PBS). After drying in a 60 °C dry oven for 1 h to remove moisture, the plates were stained with 0.5 % crystal violet. After staining, plates were washed twice with sterilized distilled water (SDW). Then, after drying in an oven for 30 min, 30 % acetic acid was added and incubated at room temperature for 20 min. The 30 % acetic acid mixture was then transferred to new 96-well plates to measure absorbance at a wavelength of 595 nm.
2.4. Minimum biofilm eradication concentration assay
A minimum biofilm eradication concentration (MBEC) assay was performed, as previously described with some modifications, to confirm the effect of plumbagin on eradicating preformed biofilm.19 In contrast to MBIC, only fungal suspensions (1 × 106 CFU/mL) were dispensed into 96-well plates. After incubation at 37 °C for 24 h, the supernatant was removed, and the plate washed twice with PBS. Afterwards, plumbagin at different concentrations was added, and the plate cultured again at 37 °C for 24 h. The cultured plate was washed twice with PBS, and the subsequent staining process followed that of MBIC.
2.5. XTT reduction assay
The metabolic activity in biofilm cells was quantified through the XTT [2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] reduction assay.20 After washing the biofilm twice with PBS, it was treated with varying concentrations of plumbagin (0.0625, 0.125, 0.25, 1, 2 μg/mL) and cultured at 37 °C for 24 h. Then, the remaining biofilm was washed twice with PBS, and the metabolic activity measured using XTT Cell Proliferation Assay kits (ATCC, Manassas, VA). The frozen XTT reagent and activation reagent were thawed, mixed at a 50:1 (v/v) ratio, and then 50 μl dispensed into each well. Plates were then incubated in the dark for 3 h before the absorbance was measured at 475 nm and 650 nm using a Multiskan GO plate reader (Thermo Fisher Scientific, Waltham, MA, USA).
2.5.1. Confocal laser scanning microscopy
Confocal laser scanning microscopy (CLSM) was conducted to visualize the metabolic activity of biofilm cells. The fungal suspensions (1 × 106 CFU/mL) were dispensed into 24-well glass-bottom imaging plates (Eppendorf AG, Hamburg, Germany) and incubated at 37 °C for 24 h.21 After removing the cultured suspension, plumbagin was administered, and plates cultured again at 37 °C for 24 h. The remaining biofilm was washed with 0.85 % NaCl and stained using the LIVE/DEAD™ BacLight™ Bacterial Viability Kit (Thermo Fisher Scientific, Waltham, MA, USA). Staining followed the manufacturer's protocol and was carried out in a dark room. The stained plates were observed using a Zeiss LSM-710 confocal laser microscope (Carl Zeiss, Thornwood, NY, USA) with a × 40 lens. The wavelengths used for detecting SYTO9 (green) and PI (red) were 525 and 640 nm, respectively. All images were acquired with ZEN software version 2.5 (Carl Zeiss, Thornwood, NY, USA).
2.6. RNA isolation and quantitative polymerase chain reaction (qPCR)
After culturing FRCA treated with 0.0625–1 μg/mL of plumbagin until the log phase, the cultured suspension was centrifuged at 10,000 rpm for 15 min at 4 °C to obtain pellets. Tris-EDTA buffer and proteinase K were added to pellets, and RNA was extracted and purified using NucleoSpin RNA Mini Kits (Macherey-Nagel, Düren, Germany) following the manufacturer's instructions. The concentration and purity of the extracted RNA were measured using the μDrop™ plate (Thermo Fisher Scientific, Waltham, MA, USA). The extracted RNA was then synthesized into cDNA using ReverTraAce™ qPCR RT Master Mix with gDNA remover (TOYOBO, Japan) according to the manufacturer's protocol. Relative gene expression levels were measured using TOPreal™ qPCR 2X PreMix (SYBR Green with high ROX) (Enzynomics, Daejeon, Korea) on the StepOnePlus™ Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The qPCR cycling protocol consisted of an initial denaturation step at 95 °C for 10 min, followed by 40 cycles involving denaturation at 95 °C for 10 s, primer annealing for 15 s, and extension at 72 °C for 30 s. Additionally, a melting-curve step (95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s) was incorporated at the conclusion of the qPCR procedure.22 The sequences and annealing temperatures of the genes used in this study are presented in Table 1. RNA expression levels of target genes were normalized to the expression level of the housekeeping gene ACT1, using the 2−ΔΔCT formula.
Table 1.
qPCR primers used in this study.
| Target gene | Primer sequence (5′-3′) | Annealing temp. (°C) | Reference |
|---|---|---|---|
| ACT1 | F: TCCTCTCAGTCGTCCGCTAT | 58 | 48 |
| R: CTTCATGGAAGATGGGGCTA | |||
| CDR1 | F: GCCAGGTTTCTGGATTTTCA | 55 | 48 |
| R: GGCCACAAGTTTGACCACTT | |||
| KRE6 | F: ATCACGATCGACATGGGCTC | 55 | 49 |
| R: TCAACGACAACGAAAACGGC | |||
| ERG11 | F: GTGCCCATCGTCTACAACCT | 56 | 48 |
| R: TCTCTCTGCACAGCTCGAAA |
2.7. Statistical analysis
All data in this study are expressed as mean ± standard deviation (SD), and one-way ANOVA test was used to evaluate statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001). All graphs were created using GraphPad Prism 5.0 software (GraphPad Prism, San Diego, CA, USA).
3. Results
3.1. Minimum inhibitory concentrations on clinically isolated C. auris
We determined the fluconazole susceptibility and the antifungal effect of plumbagin against clinically isolated C. auris (Table 2). For fluconazole, C. auris NCCP32685, C. auris NCCP32684, C. auris NCCP32641, and C. auris KBN12P06708 exhibited MICs of 4–16 μg/mL. In contrast, C. auris NCCP32640, C. auris NCC32683, C. auris KBN12P07095, and C. auris KBN12P07096 showed resistance to fluconazole, with MICs greater than 128 μg/mL. Notably, plumbagin of all strains had an MIC of 1–4 μg/mL, approximately 32–64 times lower than that shown by fluconazole.
Table 2.
Minimum inhibitory concentrations (MICs) of plumbagin and fluconazole against clinically isolated C. auris strains.
| Strains | Specimens | MIC (μg/mL) |
|
|---|---|---|---|
| Plumbagin | Fluconazole | ||
| C. auris NCCP32685 | Blood | 2 | 4 |
| C. auris NCCP32684 | Blood | 4 | 16 |
| C. auris NCCP32641 | Blood | 2 | 16 |
| C. auris NCCP32640 | Ear pus | 1 | 128 |
| C. auris NCCP32683 | Blood | 2 | 256 |
| C. auris KBN12P06708 | Ear pus | 2 | 8 |
| C. auris KBN12P07095 | Ear pus | 2 | >128 |
| C. auris KBN12P07096 | Ear pus | 2 | >128 |
NCCP: National Culture Collection for Pathogens, KBN: Korea Biobank Network.
3.2. Inhibition of biofilm formation by plumbagin
The inhibitory effect of plumbagin on biofilm formation by C. auris NCCP32683 was evaluated quantitatively and qualitatively through the minimum biofilm inhibition concentration assay. In Fig. 1B, an increase in plumbagin concentration corresponded to a decrease in biofilm formation. Specifically, reductions of 30 %, 51 %, 70 %, and 80 % compared to the control group were observed at concentrations of 0.25, 0.5, 1, and 2 μg/mL, respectively.
Fig. 1.
The inhibitory effect of plumbagin on C. auris NCCP32683 biofilm. (A) Biofilm stained with 0.5 % crystal violet. (B) The stained biofilm was quantified at a wavelength of 595 nm and converted to a percentage. The error bars represent the means ± standard deviation (SD). Statistical significance is indicated by ***p < 0.001.
3.3. Eradication of preformed FRCA biofilm by plumbagin
Biofilm eradication concentration assays assessed the effectiveness of plumbagin in eliminating preformed biofilms (Fig. 2). Efficacy tended to improve with higher concentrations of plumbagin. There were no significant differences between concentrations of 0.0625–0.125 μg/mL and 0.5–1 μg/mL, however, when compared to the control group, concentrations of at 0.25 μg/mL, 0.5 μg/mL, 1 μg/mL, and 2 μg/mL showed reductions of 23 %, 62 %, 68 %, and 80 %, respectively.
Fig. 2.
The eradication effect of plumbagin on preformed biofilm of C. auris NCCP32683. (A) Anti-biofilm effects were assessed through biofilm eradication concentration (BEC) assay using 0.5 % crystal violet staining. (B) The stained biofilm was quantified at a wavelength of 595 nm and expressed as a percentage. The error bars represent the means ± standard deviation (SD). Statistical significance is indicated by ***p < 0.001.
3.4. Inhibition of FRCA metabolic activity by plumbagin
An XTT reduction assay was conducted to investigate whether plumbagin not only inhibits and eradicates biofilm but also reduces the metabolic activity of fungal cells (C. auris NCCP32683) in biofilm. In Fig. 3, it can be seen that plumbagin demonstrated significant inhibition of the metabolic activity in biofilm cells. Notably, the reduction began at 0.5 μg/mL of plumbagin and was significantly diminished by 72.5 % compared to the control group at 2 μg/mL of plumbagin.
Fig. 3.
The inhibitory effect of plumbagin on the metabolic activity of C. auris NCCP32683 in biofilm. The preformed biofilm was treated with plumbagin and assayed by XTT reagent. After measuring the absorbance at 475 nm and 650 nm, values were calculated according to the A475nm (Test) - A475nm (Blank) - A650nm (Test) formula. The error bars represent the means ± standard deviation (SD). Statistical significance is indicated by *p < 0.05, **p < 0.01, and ***p < 0.001.
3.5. CLSM visualization of metabolic activity in biofilm
To visually observe the metabolic activities of biofilm cells, confocal laser scanning microscopy (CLSM) was employed using fluorescent dyes (Fig. 4). In the control group, predominantly viable cells were identified, with almost no detectable dead cells. However, at the sub-MIC concentration of 1 μg/mL, the ratio of viable to dead cells approached 1:1, with an increase in the red fluorescence intensity of dead cells. Consequently, the distribution of viable and dead cells, along with the inhibition of metabolic activity, was visually confirmed through CLSM images of C. auris NCCP32683 biofilms treated with plumbagin.
Fig. 4.
CLSM image visualizing metabolic activity of C. auris NCCP32683 in biofilm. Fungal cultures (1 × 106 CFU/mL) exposed to plumbagin were incubated at 37 °C for 24 h, followed by staining with SYTO9 (green) and PI (red). SYTO9 fluorescence, representing live cells, was detected at wavelength of 525 nm, while PI fluorescence, indicating dead cells was detected at 640 nm. All images taken at × 40 magnification and acquired using ZEN software.
3.6. Expression levels of azole resistance, efflux pump and extracellular matrix genes in FRCA
We examined the relative gene expression levels of the azole resistance gene (ERG11), the efflux pump gene (CDR1), and extracellular matrix gene (KRE6) in FRCA (C. auris NCCP32683) using quantitative polymerase chain reaction (qPCR). Fig. 5 shows that none of the three genes exhibited a significant difference compared to the control group at 0.0625–0.25 μg/mL. However, a clear decreasing trend emerged from 0.5 to 1 μg/mL. Specifically, at the sub-MIC concentration of 1 μg/mL, the ERG11 and CDR1 genes showed reductions of 35.4 % and 30.1 %, respectively, while the KRE6 gene exhibited a significant decrease of 54.7 %.
Fig. 5.
Expression levels of efflux pump and extracellular matrix genes in C. auris NCCP32683. (A) Azole resistance gene (ERG11), (B) efflux pump gene (CDR1), and (C) extracellular matrix gene (KRE6) were analyzed. The target gene was normalized to ACT1. The error bars represent the means ± standard deviation (SD). Statistical significance is indicated by *p < 0.05, **p < 0.01, and ***p < 0.001 compared to control.
4. Discussion
Primarily as a consequence of fungal infections, morbidity and mortality rates are increasing among patients with compromised immune systems.23 Each year, 50 % of adults and up to 30 % of children who have fungal infections die from candidiasis, with most cases associated with biofilms. Moreover, biofilm infections are responsible for approximately 100,000 deaths and are considered a serious public health problem with significant economic impact.24 The number of effective antifungal agents is extremely limited, and this is largely the result of fungal resistance.25 Therefore, the need for research into the development of new antifungal agents or substitutes for existing ones is becoming increasingly apparent.26
Plumbagin is a natural extract that has demonstrated antibacterial and antifungal effects against S. aureus, C. neoformans, and P. aeruginosa.27, 28, 29 However, knowledge of its effectiveness against C. auris is currently lacking. Previous work has reported on the low toxicity of plumbagin, emphasizing that peripheral blood mononuclear cells (PBMCs) exhibit resistance to cytotoxicity at concentrations of up to 100 mM.30 Based on previous studies, we demonstrated that plumbagin exhibits antifungal efficacy against C. auris at very low concentrations and effectively inhibits both the formation and eradication of biofilms produced by FRCA.
We determined the fluconazole susceptibility and antifungal activity of plumbagin against several clinical isolates (Table 2). The MIC98 of plumbagin was 1–4 μg/mL, and for C. auris NCCP32683, which exhibited the highest fluconazole resistance (256 μg/mL), it was 2 μg/mL. Our findings indicate that plumbagin has excellent antifungal effect against FRCA.
C. auris forms biofilms, and these biofilms show higher antifungal resistance compared to planktonic cells.31 Based on these characteristics, we quantified the biomass of biofilms using MBIC and MBEC assays to determine the efficacy of plumbagin against this feature of the pathogen (Fig. 1, Fig. 2). MBIC and MBEC are generally higher than the minimum inhibitory concentration and minimum bactericidal concentration, respectively. They serve as crucial indicators for determining the efficacy of antifungal agents against biofilms.32,33 Previous study reported that 128 μg/mL of plumbagin inhibited biofilm formation by 85 %, 66 %, and 52 % in E. coli, S. aureus, and K. pneumoniae, respectively.34 In contrast, our study found that plumbagin exhibited an 80 % inhibition rate against C. auris biofilms at a much lower concentration of 2 μg/mL. These variations highlight the unique susceptibility of different microbial species to plumbagin and underscore its potential as an effective agent against biofilms, particularly in the case of C. auris, which has a notably high biofilm-forming ability.34
Viable cells, dead cells, and extracellular matrix can be stained with crystal violet. This indicates that the crystal violet assay has advantages in measuring biofilm abundance but does not measure functional biofilms.35 So, we used the XTT reduction assay to investigate the metabolic activity of biofilm cells.36 Recognized for its linear correlation with cell numbers, this assay is a dependable method for quantifying metabolic activity in biofilm cells.37 Previous study showed that the metabolic activity of biofilms formed by C. albicans ATCC 90028 is reduced when exposed to fluconazole, but this activity is not completely eradicated even at concentrations higher than MIC.38 In contrast, our study demonstrated that plumbagin effectively reduces the metabolic activity of biofilms from a resistant strain with an MIC of 256 μg/mL to fluconazole by more than 70 % (Fig. 3).
To visually inspect the decline in metabolic activity within biofilms, we performed confocal laser scanning microscopy (Fig. 4). CLSM is a high-resolution technology and invaluable for quantifying biofilm viability.39 According to the CLSM images, we verified that the expression of SYTO9, marking intact cell membranes of live bacteria, decreased with increasing plumbagin concentration. Simultaneously, the proportion of PI, which specifically stains bacteria with damaged cell membranes, increased. Considering these results alongside the XTT analysis, we successfully demonstrated suppression of the metabolic activity of biofilm cells by plumbagin.
Biofilm-related resistance in fungal pathogens is complex and is mainly contributed by various resistance mechanisms involving changes in drug targets, efflux pump overexpression, and biofilm formation.40 The major component of the fungal cell membrane is ergosterol. The ERG11 gene, which synthesizes it, is associated with azole resistance. In Candida spp., the biosynthesis of ergosterol is regulated by the ERG11 gene, which converts lanosterol to ergosterol.41 Resistant strains were found to have decreased sensitivity to azoles due to mutations and overexpression of the ERG11 gene.42
Biofilm is a microbial aggregate formed by the attachment of a large number of microorganisms, enabling evasion of the host immune response and promoting fungal persistence and spread. This process ultimately contributes to antifungal drug resistance. Efflux pumps identified in Candida species belong to the ATP-binding cassette (ABC) superfamily and the major facilitator superfamily (MFS).43 Among them, CDR1, a gene related to the ABC superfamily, plays a crucial role in promoting azole drug resistance. Furthermore, CDR1 gene is upregulated during biofilm formation, particularly in the early stages, which contributes to resistance.44 A previous study reported that a deficiency in the CDR1 gene can reduce the MIC of itraconazole and fluconazole by 64-128-fold.45 Additionally, the KRE6 gene contributes to the generation of extracellular matrix (ECM) in biofilms, leading to resistance against disinfectants and osmotic pressure, and delaying drug diffusion through biofilms.45,46 KRE6 gene provides stability and drug sequestration during mature biofilm formation, protecting against environmental stressors.47
Based on these findings, we examined the relative expression levels of the ERG11, CDR1, and KRE6 genes and confirmed their decrease (Fig. 5). Comparing the expression levels between the group treated with 1 μg/mL plumbagin and the control group, the CDR1 and ERG11 genes were similarly repressed, while KRE6 gene was significantly more repressed than both genes. In summary, plumbagin reduces KRE6, implicated in drug diffusion and osmotic resistance, more than the CDR1 and ERG11 genes which is associated with drug resistance. Downregulating the expression the three genes may help inhibit biofilm development, suggesting a potential strategy for addressing antifungal drug resistance.
However, a limitation of this study was that the effects of plumbagin were only demonstrated in vitro. Therefore, further in vivo studies and clinical trials are necessary to assess the long-term safety and optimal administration methods of plumbagin. Also, additional investigations are required on the potential for resistance mutation and drug-resistant microbes isolated form humans, as well as on beneficial microbes in the body.
5. Conclusion
This study aimed to determine the antifungal and the anti-biofilm effects of the naphthoquinone plant extract plumbagin, against fluconazole-resistant Candida auris (FRCA). Against the clinically isolated strain (C. auris NCCP32683) exhibiting strong resistance, plumbagin showed a 98 % inhibitory effect at the relatively low concentrations of 1–4 μg/mL. We verified the inhibitory and eradication effects of plumbagin on biofilm formation and evaluated both the quantitative and visual inhibition of metabolic activity in biofilm cells. We also validated the inhibitory effect of plumbagin on gene expression associated with the azole-resistance (ERG11), the efflux pump (CDR1), and the extracellular matrix (KRE6). These results suggest that plumbagin is an alternative to antifungal agents which have limited efficacy, and an effective treatment strategy for FRCA.
Authorship statement
Hye-Won Jin was responsible for the design and conceptualization of the study, data curation, investigation, validation, visualization, and writing-original draft. Yong-Bin Eom was responsible for the design and conceptualization of the study, funding acquisition, project administration, resources, supervision, validation, writing-review & editing. All authors contributed to the manuscript writing and approved the final submitted manuscript.
Data availability statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
This study was supported by the Soonchunhyang University research fund and a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) [NRF-2023R1A2C1003486].
Footnotes
Peer review under responsibility of The Center for Food and Biomolecules, National Taiwan University.
Supplementary data to this article can be found online at https://doi.org/10.1016/j.jtcme.2024.06.005.
LIST OF ABBREVIATIONS
Abbreviations
- (C. auris)
Candida auris
- (FRCA)
Fluconazole-resistant C. auris
- (MICs)
minimum inhibitory concentrations
- (MBIC)
minimum biofilm inhibition concentration
- (MBEC)
minimum biofilm eradication concentration
- (CLSM)
confocal laser scanning microscopy
- (FPPL)
fungal priority pathogens list
- (WHO)
world health organization
- (EPS)
extracellular polymeric substances
- (NCCP)
National Culture Collection for Pathogens
- (SDA)
sabouraud dextrose agar
- (SDB)
sabouraud dextrose broth
- (MALDI-TOF)
matrix-assisted laser desorption ionization time-of-flight mass spectrometry
- (ITS)
internal transcribed spacer
- (DMSO)
dimethyl sulfoxide
- (KBN)
korea biobank network
- (EUCAST)
European committee on antimicrobial susceptibility testing
- (PBS)
phosphate-buffered saline
- (SDW)
sterilized distilled water
- (SD)
standard deviation
- (PBMC)
peripheral blood mononuclear cell
- (qPCR)
quantitative polymerase chain reaction
Appendix A. Supplementary data
The following are the Supplementary data to this article:
figs1.
figs2.
References
- 1.Martins-Santana L., Rezende C.P., Rossi A., Martinez-Rossi N.M., Almeida F. Addressing microbial resistance Worldwide: Challenges over Controlling Life-Threatening fungal infections. Pathogens. 2023;12(2):293. doi: 10.3390/pathogens12020293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Loh J.T., Lam K.-P. Fungal infections: immune defense, immunotherapies and vaccines. Adv Drug Deliv Rev. 2023;196 doi: 10.1016/j.addr.2023.114775. [DOI] [PubMed] [Google Scholar]
- 3.Brown G.D., Denning D.W., Gow N.A., Levitz S.M., Netea M.G., White T.C. Hidden killers: human fungal infections. Sci Transl Med. 2012;4(165):165rv113. doi: 10.1126/scitranslmed.3004404. 165rv113. [DOI] [PubMed] [Google Scholar]
- 4.Patel G.P., Simon D., Scheetz M., Crank C.W., Lodise T., Patel N. The effect of time to antifungal therapy on mortality in Candidemia associated septic shock. Am J Therapeut. 2009;16(6):508–511. doi: 10.1097/MJT0B013e3181a1afb7. [DOI] [PubMed] [Google Scholar]
- 5.Coordination G., Alastruey-Izquierdo A., Organization W.H., Organization W.H. WHO fungal priority pathogens list to guide research, development and public health action. Organización Mundial de la Salud (OMS) 2022 [Google Scholar]
- 6.Chowdhary A., Jain K., Chauhan N. Candida auris genetics and emergence. Annu Rev Microbiol. 2023;77:583–602. doi: 10.1146/annurev-micro-032521-015858. [DOI] [PubMed] [Google Scholar]
- 7.Tuon F.F., Suss P.H., Telles J.P., Dantas L.R., Borges N.H., Ribeiro V.S.T. Antimicrobial treatment of Staphylococcus aureus biofilms. Antibiotics. 2023;12(1):87. doi: 10.3390/antibiotics12010087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Michaelis C., Grohmann E. Horizontal gene transfer of antibiotic resistance genes in biofilms. Antibiotics. 2023;12(2):328. doi: 10.3390/antibiotics12020328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Horton M.V., Nett J.E. Candida auris infection and biofilm formation: going beyond the surface. Curr Clin Microbiol. 2020;7:51–56. doi: 10.1007/s40588-020-00143-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chao Y., Marks L.R., Pettigrew M.M., Hakansson A.P. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease. Front Cell Infect Microbiol. 2015;4:194. doi: 10.3389/fcimb.2014.00194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Nair S.V., Baranwal G., Chatterjee M., et al. Antimicrobial activity of plumbagin, a naturally occurring naphthoquinone from Plumbago rosea, against Staphylococcus aureus and Candida albicans. Int J Med Microbiol. 2016;306(4):237–248. doi: 10.1016/j.ijmm.2016.05.004. [DOI] [PubMed] [Google Scholar]
- 12.Hassan S.T., Berchová‐Bímová K., Petráš J. Plumbagin, a plant‐derived compound, exhibits antifungal combinatory effect with amphotericin B against Candida albicans clinical isolates and anti‐hepatitis C virus activity. Phytother Res. 2016;30(9):1487–1492. doi: 10.1002/ptr.5650. [DOI] [PubMed] [Google Scholar]
- 13.Yin Z., Zhang J., Chen L., et al. Anticancer effects and mechanisms of action of plumbagin: review of research advances. BioMed Res Int. 2020;2020 doi: 10.1155/2020/6940953. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Liu Y., Cai Y., He C., Chen M., Li H. Anticancer properties and pharmaceutical applications of plumbagin: a review. Am J Chin Med. 2017;45(3):423–441. doi: 10.1142/S0192415X17500264. [DOI] [PubMed] [Google Scholar]
- 15.Checker R., Sharma D., Sandur S.K., Khanam S., Poduval T. Anti-inflammatory effects of plumbagin are mediated by inhibition of NF-kappaB activation in lymphocytes. Int Immunopharm. 2009;9(7-8):949–958. doi: 10.1016/j.intimp.2009.03.022. [DOI] [PubMed] [Google Scholar]
- 16.Tilak J.C., Adhikari S., Devasagayam T.P. Antioxidant properties of Plumbago zeylanica, an Indian medicinal plant and its active ingredient, plumbagin. Redox Rep. 2004;9(4):219–227. doi: 10.1179/135100004225005976. [DOI] [PubMed] [Google Scholar]
- 17.The European Committee on Antimicrobial Susceptibility Testing Breakpoint tables for interpretation of MICs for antifungal agents. 2020. http://www.eucast.org/astoffungi/clinicalbreakpointsforantifungals/
- 18.Kim H.-R., Lee D., Eom Y.-B. Anti-biofilm and anti-virulence efficacy of celastrol against Stenotrophomonas maltophilia. Int J Med Sci. 2018;15(6):617. doi: 10.7050/ijms.23924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Jang H.I., Eom Y.B. Repurposing auranofin to combat uropathogenic Escherichia coli biofilms. J Appl Microbiol. 2019;127(2):459–471. doi: 10.1111/jam.14312. [DOI] [PubMed] [Google Scholar]
- 20.Kim H.-R., Shin D.-S., Jang H.-I., Eom Y.-B. Anti-biofilm and anti-virulence effects of zerumbone against Acinetobacter baumannii. Microbiology. 2020;166(8):717–726. doi: 10.1099/mic.0.000930. [DOI] [PubMed] [Google Scholar]
- 21.Kim H.-R., Han M.-S., Eom Y.-B. Anti-bacterial and anti-biofilm effects of Equol on Yersinia enterocolitica. Indian J Microbiol. 2022;62(3):401–410. doi: 10.1007/s12088-022-01020-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kim H.-R., Rhee K.-J., Eom Y.-B. Anti-biofilm and antimicrobial effects of zerumbone against Bacteroides fragilis. Anaerobe. 2019;57:99–106. doi: 10.1016/j.anaerobe.2019.04.001. [DOI] [PubMed] [Google Scholar]
- 23.Rabaan A.A., Sulaiman T., Al-Ahmed S.H., et al. Potential strategies to control the Risk of antifungal resistance in humans: a Comprehensive review. Antibiotics. 2023;12(3):608. doi: 10.3390/antibiotics12030608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Silva S., Rodrigues C.F., Araújo D., Rodrigues M.E., Henriques M. Candida species biofilms' antifungal resistance. J Fungi. 2017;3(1):8. doi: 10.3390/jof3010008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chen L., Zhang L., Xie Y., et al. Confronting antifungal resistance, tolerance, and persistence: advances in drug target discovery and delivery systems. Adv Drug Deliv Rev. 2023 doi: 10.1016/j.addr.2023.115007. [DOI] [PubMed] [Google Scholar]
- 26.Cruz R., Wuest W.M. Beyond ergosterol: strategies for combatting antifungal resistance in Aspergillus fumigatus and Candida auris. Tetrahedron. 2023 doi: 10.1016/j.tet.2023.133268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wang Y., Kong J., Zhang X., et al. Plumbagin resurrect colistin susceptible against colistin-resistant Pseudomonas aeruginosa in vitro and in vivo. Front Microbiol. 2022;13 doi: 10.3389/fmicb.20222.1020652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Qian W., Wang W., Zhang J., et al. Exploitation of the antifungal and antibiofilm activities of plumbagin against Cryptococcus neoformans. Biofouling. 2022;38(6):558–574. doi: 10.1080/08927014.2022.2094260. [DOI] [PubMed] [Google Scholar]
- 29.Rondevaldova J., Novy P., Kokoska L. In vitro combinatory antimicrobial effect of plumbagin with oxacillin and tetracycline against Staphylococcus aureus. Phytother Res. 2015;29(1):144–147. doi: 10.1002/ptr.5237. [DOI] [PubMed] [Google Scholar]
- 30.Subramaniya B.R., Srinivasan G., Mohammed Sadullah S.S., et al. Apoptosis inducing effect of plumbagin on colonic cancer cells depends on expression of COX-2. PLoS One. 2011;6(4) doi: 10.1371/journal.pone.0018695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Du H., Bing J., Hu T., Ennis C.L., Nobile C.J., Huang G. Candida auris: Epidemiology, biology, antifungal resistance, and virulence. PLoS Pathog. 2020;16(10) doi: 10.1371/journal.ppat.1008921. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Salih M.T., Al-Ani N.F. Microbiological aspects in biofilm produced by some uropathogens isolated from patients with indwelling bladder catheters. Raf J Sci. 2013;24(1):1–16. [Google Scholar]
- 33.Coenye T., Goeres D., Van Bambeke F., Bjarnsholt T. Should standardized susceptibility testing for microbial biofilms be introduced in clinical practice? Clin Microbiol Infect. 2018;24(6):570–572. doi: 10.1016/j.cmi.2018.01.003. [DOI] [PubMed] [Google Scholar]
- 34.Adusei E., Adosraku R.K., Oppong-Kyekyeku J., Amengor C.D., Jibira Y. Resistance modulation action, time-kill kinetics assay, and inhibition of biofilm formation effects of plumbagin from Plumbago zeylanica Linn. J Trop Med. 2019;2019 doi: 10.1155/2019/1250645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Xu Z., Liang Y., Lin S., et al. Crystal violet and XTT assays on Staphylococcus aureus biofilm quantification. Curr Microbiol. 2016;73:474–482. doi: 10.1007/s00284-016-1081-1. [DOI] [PubMed] [Google Scholar]
- 36.Hendiani S., Abdi A.A., Mohammadi P. 2014. Comparison of Two Methods for Quantification of Acinetobacter Baumannii Biofilm Formation. [Google Scholar]
- 37.Jin Y., Samaranayake L.P., Samaranayake Y., Yip H.K. Biofilm formation of Candida albicans is variably affected by saliva and dietary sugars. Arch Oral Biol. 2004;49(10):789–798. doi: 10.1016/j.archoralbio.2004.04.011. [DOI] [PubMed] [Google Scholar]
- 38.Silva WJd, Gonçalves L.M., Seneviratne J., Parahitiyawa N., Samaranayake L.P., Cury A.A.D.B. Exopolysaccharide matrix of developed Candida albicans biofilms after exposure to antifungal agents. Braz Dent J. 2012;23:716–722. doi: 10.1590/S0103-64402012000600016. [DOI] [PubMed] [Google Scholar]
- 39.Mountcastle S.E., Vyas N., Villapun V.M., et al. Biofilm viability checker: an open-source tool for automated biofilm viability analysis from confocal microscopy images. npj Biofilms Microbiomes. 2021;7(1):44. doi: 10.1038/s41522-021-00214-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Kean R., Delaney C., Sherry L., et al. Transcriptome assembly and profiling of Candida auris reveals novel insights into biofilm-mediated resistance. mSphere. 2018;3(4) doi: 10.1128/msphere.00334-18. 10.1128/msphere. 00334-00318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Chaabane F., Graf A., Jequier L., Coste A.T. Review on antifungal resistance mechanisms in the emerging pathogen Candida auris. Front Microbiol. 2019;10:2788. doi: 10.3389/fmicb.2019.02788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Rybak J.M., Cuomo C.A., Rogers P.D. The molecular and genetic basis of antifungal resistance in the emerging fungal pathogen Candida auris. Curr Opin Microbiol. 2022;70 doi: 10.1016/j.mib.2022.102208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Pata J., Moreno A., Wiseman B., et al. Purification and characterization of Cdr1, the drug-efflux pump conferring azole resistance in Candida species. Biochimie. 2024;220:167–178. doi: 10.1016/j.biochi.2023.12.007. [DOI] [PubMed] [Google Scholar]
- 44.Taff H.T., Mitchell K.F., Edward J.A., Andes D.R. Mechanisms of Candida biofilm drug resistance. Future Microbiol. 2013;8(10):1325–1337. doi: 10.2217/fmb.13.101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Hong H., Ximing Y., Jinghan M., et al. Candida auris infection; diagnosis, and resistance mechanism using high-throughput sequencing technology: a case report and literature review. Front Cell Infect Microbiol. 2023;13 doi: 10.3389/fcimb.2023.1211626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Mukherjee P.K., Chandra J. Candida biofilm resistance. Drug Resist Updates. 2004;7(4-5):301–309. doi: 10.1016/j.drup.2004.09.002. [DOI] [PubMed] [Google Scholar]
- 47.Pierce C.G., Vila T., Romo J.A., et al. The Candida albicans biofilm matrix: composition, structure and function. J Fungi. 2017;3(1):14. doi: 10.3390/jof3010014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Bhattacharya S., Holowka T., Orner E.P., Fries B.C. Gene duplication associated with increased fluconazole tolerance in Candida auris cells of advanced generational age. Sci Rep. 2019;9(1):5052. doi: 10.1038/s41598-019-41513-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Short B., Brown J., Delaney C., et al. Candida auris exhibits resilient biofilm characteristics in vitro: implications for environmental persistence. J Hosp Infect. 2019;103(1):92–96. doi: 10.1016/j.jhin.2019.06.006. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.








