TABLE 1.
Primers used for PCRb
| Primers | Primer sequence (5′−3′) | Positions | Amplicon size (bp) | References |
|---|---|---|---|---|
| P1F | CAGGTCGACGATTATGCCCTTAG | 1–23 | 2344 | This study |
| P1R | CACAGTATRCCTTGYAACAC | 2325–2344 | This study | |
| E2F | TGGTGGCCTTATGAGAC | 2169–2185 | 1361 | (11) |
| P7R | CCCATCATCACTATTTCACC | 3510–3529 | (11) | |
| P2F | ACTTTGAATTTGGACTYTGCC | 2655–2685 | 1836 | This study |
| P2R | TATRACYTTYCTGTGCATRTAGTAC | 4466–4490 | This study | |
| P3F | TAAGYTGYGTYAGYAGYAAATGG | 4405–4427 | 1710 | This study |
| P3R | GCTATRAATTCYTCTATTGGGTG | 6153–6175 | This study | |
| P4F | GTTAAGGTAGGRAAGAAYGAAGAG | 5598–5621 | 2176 | This study |
| P4R | GGTAATTCCAAGTYTTRTATGTGTA | 7749–7773 | This study | |
| P5F | CYCTGGCAACCTACACATAC | 7738–7757 | 2070 | This study |
| P5R | CTACCTCCTTYACWATYCTTG | 9787–9807 | This study | |
| P6F | GGCTCAAGAARTTCCATRTC | 9378–9397 | 2591 | This study |
| P6R | CATAAGCAGDACYTTCAACC | 11950–11969 | This study | |
| P7F | GTTATGGGAGTTGGGACGGA | 11889–11908 | 334 | This study |
| J2 | ACAGCTAAAGTGCTKWGTGC | 12243–12223a | (12) |
a
The positions of J2 relative to the reference sequence of the NADL strain was described previously (12).
b
R:(A/G), W:(A/T), D:(A/G/T), and Y:(C/T).