CircTNPO3 promotes hepatocellular carcinoma progression by sponging miR‐199b‐5p and regulating STRN expression

Abstract

Hepatocellular carcinoma (HCC) is the most common primary liver tumor, which seriously threatens human health. CircTNPO3 was up‐regulated in HCC tissues. However, the regulatory mechanism of circTNPO3 in HCC was still unclear. We aimed to investigate the circTNPO3 function in the development of HCC. qRT‐PCR and Western blot examined gene and protein levels. CCK8, EdU, flow cytometry, and Transwell assays were used to detect cell viability, proliferation, apoptosis, and invasion abilities. Dual‐luciferase reporter and RIP assays determined the relationship between circTNPO3, miR‐199b‐5p, and striatin (STRN). The effect of CircTNPO3 on HCC progress was investigated in vivo. CircTNPO3 and STRN were significantly increased, while miR‐199b‐5p was repressed in HCC tissues or cells. Afterward, miR‐199b‐5p was negatively correlated with STRN. circTNPO3 was positively correlated with STRN. Knockdown of circTNPO3 inhibited cell viability, proliferation, invasion, and promoted apoptosis, while circTNPO3 overexpression had the opposite results. Furthermore, miR‐199b‐5p inhibition could eliminate the regulatory effect of sh‐circTNPO3 on the proliferation and apoptosis in HCC cells. CircTNPO3 positively regulated STRN expression by targeting miR‐199b‐5p. MiR‐199b‐5p suppressed HCC progression by inhibiting STRN expression. Tumor formation in nude mice showed that knockdown of circTNPO3 significantly inhibited tumor growth and suppressed ki‐67 levels. CircTNPO3 promoted HCC progression through regulating STRN expression by sponging miR‐199b‐5p, which provided a strategy for HCC treatment.

1. INTRODUCTION

Hepatocellular carcinoma (HCC) is the most common primary liver tumor, characterized by high morbidity and mortality, ranking fourth in global cancer‐related mortality and posing a severe threat to human health. ¹ , ² Hepatitis virus infection is a significant cause of chronic liver disease, including cirrhosis and HCC. ³ HCC usually occurs in the context of chronic liver disease. It is an invasive disease with a poor prognosis. ⁴ The pathogenesis of liver cancer is complex, and its occurrence and metastasis are closely related to polygene mutations and transcriptome classification. ⁵ It is also related to abnormal cell proliferation, cell signaling pathways, and neovascularization. ⁶ Despite advances in HCC treatment, the mortality rate is high because of ineffective treatment. Therefore, it has a significant meaning in elucidating HCC occurrence and development mechanism and finding markers and therapeutic targets for early diagnosis.

Circular RNA (circRNA) is an endogenous non‐coding RNA that contains a highly conserved sequence. In recent years, circRNAs have attracted more and more attention in human tumor studies. CircRNAs are also related to the occurrence and development of HCC. It was reported that circRNA‐103809 facilitated HCC development through the miR‐1270/PLAG1 Like Zinc Finger 2 axis. ⁷ Jiang et al. reported that circATP5H could promote hepatitis B virus (HBV) replication and expression by regulating the miR‐138‐5p/TNFAIP3 axis, which suggested a new biomarker for HBV‐related HCC treatment. ⁸ In addition, N6‐methyladenosine modification of circ‐ARL3 facilitated HBV‐associated HCC through sponging miR‐1305. ⁹ A previous study showed that hsa_circ_0001741 (circTNPO3) was significantly up‐regulated in HCC tissues. In addition, circRNA can play an essential role in disease development by absorbing miRNA through sponges. ¹⁰ A growing number of evidence suggest that competing endogenous RNAs (ceRNA) regulatory networks are involved in HCC biological processes, including cancer cell growth, epithelial‐mesenchymal transformation (EMT), metastasis, and chemotherapy resistance. ¹¹ We predicted by bioinformatics software there were potential binding sites between circTNPO3 and miR‐199b‐5p. Therefore, we wanted further to explore circTNPO3 and miR‐199b‐5p roles in HCC progress.

MicroRNA (miRNA), a single‐stranded small molecule RNA, is involved in cell proliferation and apoptosis and is associated with many diseases, especially tumors. It was reported that the overall survival is poor in patients with low miR‐199b‐5p expression, and miR‐199b‐5p overexpression inhibited HCC cell migration and invasion. ¹² In addition, Zhou et al. found that miR‐199b‐5p reduced TGF‐β1‐induced EMT of HCC. ¹³ Striatin (STRN) is a critical member of the striatin family. Studies showed that STRN was increased in HCC tissues and cells, which regulated cell migration and invasion in HCC. ¹⁴ Through bioinformatics analysis, we found that there were binding sites between miR‐199b‐5p and STRN. However, the regulatory mechanism of miR‐199b‐5p and STRN in HCC is unclear.

Based on the above background, we investigated the function of the circTNPO3/miR‐199b‐5p/STRN axis in HCC occurrence and development. We found that knockdown of circTNPO3 inhibited cell proliferation and invasion through sponging miR‐199b‐5p and regulating STRN expression in HCC. This paper will enhance our understanding of the pathogenesis of HCC and provide new strategies for HCC treatment.

2. MATERIALS AND METHODS

2.1. Database prediction

The expression levels of circTNPO3 and STRN in HCC tissues were predicted using GEPIA (http://gepia.cancer-pku.cn/detail.php?gene=&clicktag=boxplot###) and miR‐199‐5p expression was predicted by UALCAN (http://ualcan.path.uab.edu/index.html) database.

2.2. Cell culture

Human normal liver cells HL‐7702 (#CL‐0111) and Human HCC cells, including Huh7 (#CL‐0120) and HepG2 (#CL‐0103) were purchased from Procell (Wuhan, China) and cultured in DMEM medium (D5796, Sigma) containing 10% fetal bovine serum (#10099141, Gibco) and 1% Penicillin/Streptomycin (SV30010, Beyotime) with 5% CO₂ at 37°C.

2.3. Vector construction and transfection

To investigate the effect of circTNPO3 in HCC, sh‐circTNPO3 and OE‐circTNPO3 plasmids were constructed. Short hairpin targeting circTNPO3 (sh‐circTNPO3) and sh‐NC were synthesized by GenePharma. circTNPO3 sequences were connected with the LV003 vector to construct the OE‐circTNPO3 vector and the LV003 vector as a negative control. Furthermore, miR‐199b‐5p mimics, miR‐199b‐5p inhibitor, and negative control were synthesized by GenePharma. To over‐expressed STRN, STRN was subcloned into pcDNA3.1 (Invitrogen). According to the instructions, Lipofectamine 3000 reagents (Thermo Fisher Scientific) were used to transfect the above plasmids into the cells.

2.4. Quantitative real‐time PCR

Trizol (Thermo Fishier Scientific) method was performed to extract total RNA from cells and tissues. The concentration of RNA was determined by UV absorption. cDNA was obtained by cDNA reverse transcription Kit (CW2569, CWBIO). qRT‐PCR was carried out using SYBR Green qPCR Mix (Invitrogen) on ABI 7900 system. To detect the expression of miR‐199b‐5p, Taqman Advanced miRNA cDNA Synthesis Kit (A28007, Thermo Fisher Scientific) was used for reversing transcription of RNA, and synthetic cDNA was used in the next step of qPCR. After that, quantification of miRNAs expression levels was carried out by applying TaqManFast Advanced Master Mix (4444556, Thermo Fisher Scientific) and individual TaqMan Advanced miRNA Assays for miR‐199b‐5p. Primers for circTNPO3, miR‐199b‐5p, STRN, U6, and GAPDH were designed (Table 1) and synthesized by Sangon Biotech. U6 and GAPDH were used as an internal reference, and the 2^−ΔΔCt method was applied to calculate the relative expression levels in each sample.

TABLE 1.

Primer sequences used in this study

Genes	Forward primer (5′‐3′)	Reverse primer (5′‐3′)
CircTNPO3	GTCGTTCCTTACGAATTGGAGCT	GGTCTGTGCAGCAAAATAGCATG
MiR‐199b‐5p	GCCGAGCCCAGTGTTTAGACTAT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC GAACAG
STRN	TGGGGTTTGGCTTATAGTGC	AATGCGTTGTTGTGTTTCCA
GAPDH	CCAGGTGGTCTCCTCTGA	GCTGTAGCCAAATCGTTGT
U6	TTACGCCGTACTGGCAAA	GGCACACTTCAGCTTAAAATG

2.5. Western blot

RIPA cracking buffer (#P0013B, Beyotime) was performed to extract proteins from cells and tissues according to instructions, and proteins were quantified according to the BCA method. The mixed SDS‐PAGE loading buffer (#MB2479, Meilunbio) was heated in boiling water for 5 min at 100°C. The proteins were adsorbed on the PVDF membranes. The membranes were blocking with 5% skim milk solution for 90 min at room temperature. The primary antibodies including cleaved caspase3 (19677‐1‐AP, 1: 2000, Proteintech), bax (Ab32503, 1: 1000, Abcam), bcl‐2 (12789‐1‐AP, 1: 1000, Proteintech), STRN (21624‐1‐AP, 1: 2000, Proteintech) and GAPDH (10494‐1‐AP, 1: 5000, Proteintech) were incubated overnight at 4°C. HRP goat anti‐mouse IgG (SA00001‐1, 1: 5000, Proteintech) and HRP goat anti‐Rabbit IgG (SA00001‐2, 1: 6000, Proteintech) were incubated for 90 min at room temperature. After ECL color exposure, Odyssey Infrared Imaging System (Li‐Cor Biosciences) detected protein bands, and GAPDH was used as an internal reference.

2.6. Cell counting kit 8 assay

Cells were digested with trypsin digestion solution, the cell suspension was prepared, and inoculated in 96‐well plates according to the density of 5 × 10³. Each group was set up with three multiple wells. According to experimental groups for complementary intervention treatment, the cells were cultured for 24 h. After corresponding incubation time, the culture medium was abandoned and replaced with 10 μl CCK8 working solution (DOJINDO) and incubated for 4 h in an incubator with 5% CO₂, at 37°C. The absorbance was measured at 450 nm using Elx800 (BioTek), and the proliferation of cells at 24, 48, and 72 h was detected.

2.7. EdU assay

After 24 h intervention, EdU DNA Proliferation in vitro Detection (C10310, RiboBio) measured Huh7 and HepG2 cells proliferation ability according to the instructions. In brief, cells were incubated in a medium containing 50 μM EdU. The cells were immobilized with 4% paraformaldehyde and 2 mg/ml glycine. Cells were stained with 1× Apollo® and 1× Hoechst33342 working fluid for 30 min at room temperature without light. After staining, cells were observed with an inverted biological microscope (DSZ2000X, Cnmicro).

2.8. Flow cytometry assay

Cells were digested and collected with trypsin without EDTA. The cells were washed with PBS twice, centrifuged for 5 min at 2000 rpm each time, and about 5 × 10⁵ cells were collected. Five hundred microliters of binding buffer, 15 μl Annexin V‐FITC (KGA108, KeyGen), and 5 μl Propidium Iodide (PI) were added and cultured for 15 min in the dark at room temperature. Flow cytometry (A00‐1‐1102, Beckman) was observed and detected within 1 h.

2.9. Transwell assay

A Transwell chamber (3428, Corning) with Matrigel Basement Membrane Matrix (354262, BD Biocoat) was applied to detect cell invasion. Cells were digested into single‐cell suspension with trypsin and resuspended in serum‐free medium to 1 × 10⁶/ml. One hundred microliters of cells and 600 μl complete medium were added to the upper and lower compartment of the Transwell chamber. After incubation at 37°C for 24 h, the cells on the upper compartment surface were wiped with wet cotton swabs, fixed with 4% paraformaldehyde, stained with 0.5% crystal purple, and observed by microscope (Olympus).

2.10. Bioinformatics prediction and dual‐luciferase reporter assay

Starbase predicted the binding sites of circTNPO3 and miR‐199b‐5p and the binding sites of miR‐199b‐5p and STRN. To verify circTNPO3 binding with miR‐199b‐5p and the binding of miR‐199b‐5p with STRN, Wild type (WT), or mutant (MUT) of circTNPO3/STRN fragment were inserted into pmirGLO vector (Promega), respectively. Co‐transfection of the recombinant vector and miR‐199b‐5p mimics or mimics NC into cells by using Lipofectamine 3000 according to the instructions. The luciferase activity was determined by the Nano‐Glo dual‐luciferase reporting method (Promega).

2.11. RNA immunoprecipitation assay

The binding of miR‐199b‐5p to circTNPO3 and miR‐199b‐5p to STRN was validated using the EZMagna RIP kit (Millipore, Massachusetts, USA) according to the manufacturer's instructions. Briefly, HCC cells were lysed with RNA immunoprecipitation (RIP) lysis buffer for 30 min at 4°C and then incubated with RIP buffer containing magnetic beads coupled antibodies against Ago2 (CST) or anti‐IgG (negative control, CST). Precipitated RNA was analyzed by qRT‐PCR, and total RNA was used as input controls.

2.12. In vivo tumorigenesis

Twelve 8‐week‐old female nude mice (BALB/C, nu/nu) were provided by Hunan SJA Laboratory Animal Company Limited and randomly divided into sh‐NC and sh‐circTNPO3 (N = 5) groups. sh‐circTNPO3 and sh‐NC were transfected into HepG2 cells, then 2 × 10⁵ HepG2 cells were injected into the lower abdomen. The tumor volume was measured every 5 days. All mice were sacrificed and obtained tumor tissue for further research. All animal experiments have been approved by the Animal Ethics Committee of the First Affiliated Hospital, Hengyang Medical School, University of South China.

2.13. Immunohistochemistry

The slices were roasted at 60°C for 12 h and dewaxed into water. One percentage of periodate acid was added and left for 10 min at room temperature. Ki‐67 (ab16667, 1:200, Abcam) was incubated overnight at 4°C. The secondary antibody was incubated at 37°C for 30 min. DAB (ZLI‐9018, ZSG‐BIO) was applied for color development, and hematoxylin was re‐stained for 5–10 min. Then, the dye was washed with distilled water. PBS was applied to return blue. Alcohol (60–100%) was wielded for dehydration. Neutral gum was adopted for sealing. Microscopes were employed for observation.

2.14. TUNEL

TUNEL Apoptosis Detection Kit (KGA704, KeyGen) measured tissue apoptosis. The slices were baked at 60°C for 60 min, sliced, and dewaxed into water. The sections were immersed in the 1% periodate acid‐blocking solution and closed at room temperature (15–25°C) for 12 min. One hundred microliters of proteinase K working solution was added to each sample and reacted at 37°C for 20 min. The slices were immersed in PBS and rinsed three times, 5 min each time. Biotin (IH0125, Leagene Biotechnology) was sealed, marked with HRP, colored with DAB (ZLI‐9018, ZSG‐BIO), sealed with buffer glycerin and observed under the light microscope.

2.15. Statistical analysis

Graphpad Prism8.0 was used for data statistics. Measurement data were expressed as mean ± standard deviation (SD) and repeated at least three times. Student's t test was used to analyze data between the two groups. One‐way ANOVA was employed to compare the data multiple groups. Kaplan–Meier method was used to analyze the survival rate of circTNPO3. Pearson Correlation Coefficient analyzed the correlation between circTNPO3 and STRN. p < 0.05 was considered that it was significant.

3. RESULTS

3.1. Knockdown of circTNPO3 inhibited proliferation and invasion of hepatocellular carcinoma cells

First, we analyzed the expression levels of circTNPO3, miR‐199‐5p, and STRN in HCC tissues by GEPIA and UALCAN databases. The results showed that circTNPO3 and STRN were increased, and miR‐199b‐5p expression was decreased in HCC tissues (Figure 1A–C). Low expression of circTNPO3 had higher survival rates (Figure 1D). Furthermore, circTNPO3 was positively correlated with STRN (Figure 1E). Subsequently, we also detected the expression of circTNPO3 in HCC cell lines. The results showed that circTNPO3 was increased in HCC cells compared with normal liver cells HL‐7702 (Figure 2A). To study the circTNPO3 effect in HCC, sh‐circTNPO3 and OE‐circTNPO3 cell lines were constructed. The results showed that knockdown of circTNPO3 significantly inhibited circTNPO3 expression, and circTNPO3 expression increased after overexpression, indicating successful transfection (Figure 2B). Compared with the sh‐NC group, knockdown of circTNPO3 inhibited the cell viability (Figure 2C). EdU incorporation assays also indicated circTNPO3 silencing reduced HepG2 and Huh7 cell growth (Figure 2D). Moreover, flow cytometry assays revealed that HepG2 and Huh7 cell apoptosis rates were enhanced by circTNPO3 silencing (Figure 2E). Furthermore, we performed transwell to detect HepG2 and Huh7 cells invasion, knocking down circTNPO3 repressed the invasion ability (Figure 2F). However, overexpression of circTNPO3 had the opposite effect on the proliferation and apoptosis in HCC cells (Figure 2C–F). In addition, knockdown of circTNPO3 significantly increased bax and cleaved caspase3 expression and reduced bcl‐2 level. However, after circTNPO3 overexpression, bax and cleaved caspase3 expression decreased, while bcl‐2 level increased (Figure 2G). In conclusion, knockdown of circTNPO3 significantly repressed HCC cells proliferation, and invasion, and promoted apoptosis.

FIGURE 1.

circTNPO3 and STRN were up‐regulated, and miR‐199b‐5p was down‐regulated in HCC tissues. (A–C) the expression levels of circTNPO3, miR‐199‐5p, and STRN in HCC tissues by the public domain database. (D) Kaplan–Meier method was used to analyze the survival rate of circTNPO3. (E) Pearson correlation coefficient analyzed the correlation between circTNPO3 and STRN. HCC, hepatocellular carcinoma

FIGURE 2.

Knockdown of circTNPO3 inhibited proliferation and invasion of HCC cells. (A) circTNPO3 expression in HL‐7702, Huh7, and HepG2 cells was detected by qRT‐PCR. sh‐circTNPO3 and OE‐circTNPO3 vectors are constructed and transfected into Huh7 and HepG2 cells. (B) circTNPO3 expression in Huh7 and HepG2 cells. (C) CCK‐8 measured cell viability of Huh7 and HepG2 cells at 24, 48, and 72 h. (D) Huh7 and HepG2 cell proliferation were assessed by EdU. (E) The apoptosis of Huh7 and HepG2 cells was detected by flow cytometry. (F) Transwell tested Huh7 and HepG2 cells invasion ability. (G) Western blot measured cleaved caspase3, bax, and bcl‐2 protein expression. The data were expressed as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001. HCC, hepatocellular carcinoma

3.2. CircTNPO3 directly targeted miR‐199b‐5p and regulated its expression

To explore the relationship between circTNPO3 and miR‐199b‐5p, qRT‐PCR assay was performed. MiR‐199b‐5p expression was decreased in HCC cells compared with normal liver cells (Figure 3A). Then, miR‐199b‐5p mimics were transfected into Huh7 and HepG2 cells. qRT‐PCR results showed that compared with mimics NC group, overexpression of miR‐199b‐5p elevated miR‐199b‐5p level (Figure 3B). As indicated in Figure 3C, Starbase prediction showed that there were binding sites between miR‐199b‐5p and circTNPO3. Compared with mimics NC, the luciferase activity of circTNPO3‐WT decreased after adding miR‐199b‐5p mimics, while the luciferase activity of circTNPO3‐MUT was unchanged (Figure 3D). RIP experiments verified the target‐binding relationship between miR‐199b‐5p and circTNPO3. Ago2 antibody was able to pull down both endogenous circTNPO3 and miR‐199b‐5p (Figure 3E). These results indicated that circTNPO3 directly targeted miR‐199b‐5p and negatively regulated its expression.

FIGURE 3.

CircTNPO3 directly targeted miR‐199b‐5p and regulated its expression. (A) qRT‐PCR tested miR‐199b‐5p expression in HL‐7702, Huh7, and HepG2 cells. (B) miR‐199b‐5p expression in Huh7 and HepG2 cells was examined by qRT‐PCR. (C) Starbase predicted binding sites of circTNPO3 with miR‐199b‐5p. (D) Detection of luciferase activity. (E) RIP experiments verified the target‐binding relationship between miR‐199b‐5p and circTNPO3. The data were expressed as mean ± SD. **p < 0.01, ***p < 0.001. RIP, RNA immunoprecipitation

3.3. Knockdown of miR‐199b‐5p reversed circTNPO3 silencing effect on HCC cells proliferation and apoptosis

To further study the circTNPO3 effect in HCC development through miR‐199b‐5p, we co‐transfected with sh‐circTNPO3 and miR‐199b‐5p inhibitor into Huh7 and HepG2. As shown in Figure 4A, compared with inhibitor NC, miR‐199b‐5p expression was decreased after miR‐199b‐5p inhibition. In function, knockdown of circTNPO3 inhibited cell viability, while miR‐199b‐5p inhibitor and sh‐circTNPO3 co‐transfected improved cell viability (Figure 4B). CircTNPO3 silencing suppressed cell proliferation, while promoting proliferation after co‐transfection with miR‐199b‐5p inhibitor (Figure 4C). Flow cytometry analysis showed that knockdown of circTNPO3 promoted cell apoptosis, while miR‐199b‐5p inhibitor reversed the promoting effect of sh‐circTNPO3 on cell apoptosis (Figure 4D). Furthermore, knockdown of circTNPO3 significantly inhibited cell invasion, while miR‐199b‐5p inhibitor reversed the effect of sh‐circTNPO3 (Figure 4E). Then, Western blot results showed that knockdown of circTNPO3 increased bax and cleaved caspase3 expression, but suppressed bcl‐2 level. However, after co‐transfection of sh‐circTNPO3 and miR‐199b‐5p inhibitor, bax and cleaved caspase3 expression were inhibited, while the level of bcl‐2 increased (Figure 4F). These results suggest that knockdown of miR‐199b‐5p reversed circTNPO3 silencing effect on cell proliferation and apoptosis in HCC.

FIGURE 4.

Knockdown of miR‐199b‐5p reversed circTNPO3 silencing effect on HCC cells proliferation and apoptosis. miR‐199b‐5p inhibitor and sh‐circTNPO3 alone or co‐transfected into Huh7 and HepG2 cells. (A) qRT‐PCR detected miR‐199b‐5p expression in Huh7 and HepG2 cells. (B) CCK‐8 tested cell viability of Huh7 and HepG2 cells at 24, 48, and 72 h. (C) EdU detected Huh7 and HepG2 cells proliferation. (D) Flow cytometry measured Huh7 and HepG2 cells apoptosis. (E) Transwell examined Huh7 and HepG2 cells invasion ability. (F) Western blot assessed cleaved caspase3, bax, bcl‐2 protein expression. The data were expressed as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001. HCC, hepatocellular carcinoma

3.4. CircTNPO3 might positively regulate the expression of STRN through miR‐199b‐5p

Starbase showed miR‐199b‐5p had binding sites with STRN (Figure 5A). Dual‐luciferase reporter assay results verified that miR‐199b‐5p inhibited luciferase activity in the STRN‐WT group but not the STRN‐MUT group (Figure 5B). RIP experiments verified the target‐binding relationship between miR‐199b‐5p and STRN. Ago2 antibody was able to pull down both endogenous miR‐199b‐5p and STRN (Figure 5C). Then, results of qRT‐PCR and Western blot showed that knockdown of circTNPO3 inhibited STRN expression, whereas the expression of STRN increased after co‐transfection with sh‐circTNPO3 and miR‐199b‐5p inhibitor (Figure 5D,E). These results indicated that circTNPO3 may positively regulate the expression of STRN through miR‐199b‐5p.

FIGURE 5.

CircTNPO3 might positively regulate STRN expression through miR‐199b‐5p. (A) Starbase predicted binding sites of miR‐199b‐5p and STRN. (B) Detection of luciferase activity. (C) RIP experiments verified the target‐binding relationship between miR‐199b‐5p and STRN. (D) and (E) STRN mRNA and protein levels expression in Huh7 and HepG2 cells were detected by qRT‐PCR and Western blot. The data were expressed as Mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001. RIP, RNA immunoprecipitation

3.5. miR‐199b‐5p suppressed the progression of hepatocellular carcinoma by inhibiting STRN expression

To study the STRN function in HCC, we constructed an OE‐STRN vector. Compared with the negative control group, STRN expression in the OE‐STRN group was increased (Figure 6A,B). Subsequently, CCK‐8 results displayed that miR‐199b‐5p overexpression reduced cell viability while STRN overexpression eliminated the effect of miR‐199b‐5p (Figure 6C). EdU detection revealed that overexpression of STRN offset the decrease of cell proliferation by miR‐199b‐5p mimics treatment (Figure 6D). Besides, miR‐199b‐5p overexpression promoted cell apoptosis, while STRN overexpression reversed the enhancing effect of miR‐199b‐5p on cell apoptosis (Figure 6E). In addition, miR‐199b‐5p overexpression significantly inhibited cell invasion, while STRN overexpression reversed the inhibitory of miR‐199b‐5p (Figure 6F). Moreover, miR‐199b‐5p overexpression increased bax and cleaved caspase3 expression and reduced bcl‐2 level. However, after co‐transfection of miR‐199b‐5p mimics and OE‐STRN, bax and cleaved caspase3 expression decreased, while bcl‐2 level enhanced (Figure 6G). Therefore, miR‐199b‐5p suppressed HCC progression by inhibiting STRN expression.

FIGURE 6.

miR‐199b‐5p suppressed HCC progression by inhibiting STRN expression. (A) and (B) STRN mRNA and protein levels expression in Huh7 and HepG2 cells were tested by qRT‐PCR and Western blot. (C) CCK‐8 detected cell viability of Huh7 and HepG2 cells at 24, 48, and 72 h. (D) EdU measured Huh7 and HepG2 cells proliferation. (E) Huh7 and HepG2 cells apoptosis was detected by flow cytometry. (F) Huh7 and HepG2 cells invasion ability was detected by transwell. (G) Western blot tested cleaved caspase3, bax, and bcl‐2 protein expression. The data were expressed as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001. HCC, hepatocellular carcinoma

3.6. Knockdown of circTNPO3 suppressed hepatocellular carcinoma progression through miR‐199b‐5p/STRN axis in vivo

We have studied the role of circTNPO3 and miR‐199b‐5p/STRN in HCC in vitro, and then we constructed tumor formation in nude mice in vivo to study the circTNPO3 role in HCC. Compared with the sh‐NC group, knockdown of circTNPO3 suppressed tumor growth. In the sh‐circTNPO3 group, tumor volume and weight were reduced (Figure 7A–C). Compared with the sh‐NC group, knockdown of circTNPO3 suppressed circTNPO3 and STRN levels and increased miR‐199b‐5p expression. Meanwhile, the knockdown of circTNPO3 significantly inhibited the expression level of Ki‐67 (Figure 7D–F). In addition, knockdown of circTNPO3 significantly promoted cell apoptosis compared with the sh‐NC group (Figure 7G). So knockdown of circTNPO3 suppressed HCC progression by mediating the miR‐199b‐5p/STRN axis.

FIGURE 7.

Knockdown of circTNPO3 suppressed HCC progression through miR‐199b‐5p/STRN axis in vivo. Tumor formation in nude mice was randomly divided into sh‐NC and sh‐circTNPO3 groups with 5 mice per group. (A) Tumor representative images of each group. (B) Detection of tumor volume. (C) Detection of tumor weight. (D) circTNPO3, miR‐199b‐5p, and STRN expression were examined by qRT‐PCR. (E) IHC tested Ki‐67 expression. (F) Western blot measured STRN expression. (G) TUNEL detected tumor cell apoptosis. The data were expressed as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001. HCC, hepatocellular carcinoma

4. DISCUSSION

HCC, the most common primary liver cancer, exhibits high molecular phenotypic heterogeneity and is a major cause of cancer‐related death. ¹⁵ , ¹⁶ HCC incidence was 9.82/1000 person‐years in males and 3.82/1000 in females. ¹⁷ However, due to the complex pathogenesis of liver cancer, there is still lacking active and effective treatment. In this study, knockdown of circTNPO3 inhibited HCC cell proliferation and invasion by inhibiting STRN expression by miR‐199b‐5p. This is the first report of the circTNPO3/miR‐199b‐5p/STRN axis in HCC occurrence and development.

As biomarkers or targets for intervention, circRNAs can provide new insights into diagnosis and treatment of disease. It was reported that knockout of circ‐ARL3 suppressed hepatitis B virus⁺ HCC cells proliferation and invasion. ⁹ Lu et al. found that knockdown of circRNA DOCK1 repressed proliferation, invasion, and migration of hepatocarcinoma cells by regulating the miR‐654‐5p/SMAD2 axis. ¹⁸ In addition, Jia et al. found that circNFATC3 suppressed tumor growth and reduced lung metastasis in mice xenotransplantation. ¹⁹ In vivo, Wu et al. found that knockdown of circRASGRF2 inhibited hepatocarcinoma cells proliferation and migration. ²⁰ It was reported that circTNPO3 regulated paclitaxel resistance in ovarian cancer cells through the miR‐1299/NEK2 pathway. ²¹ But the role of circTNPO3 in HCC development was poorly understood. The public domain database showed the expression of circTNPO3 was upregulated in HCC. In present study, knockdown of circTNPO3 inhibited HCC cell proliferation and invasion in vitro and in vivo. This is the first time to report circTNPO3 function on cell proliferation, invasion, and apoptosis in HCC, suggesting that circTNPO3 is involved in HCC progression and plays an important role in HCC.

In hepatitis B virus‐related HCC, abnormally regulated miRNAs have potential as biomarkers and therapeutic targets. ²² As one of the most widely studied miRNAs, miR‐199b‐5p played an important role in diabetic nephropathy, oral cancer, prostate cancer, and other diseases. ²³ , ²⁴ , ²⁵ Wang et al. found low expression of miR‐199b‐5p in HCC might be mediated by up‐regulation of HIF1α expression, which was negatively correlated with HCC patient's survival rate and directly correlated with the degree of malignancy of HCC patients. ²⁶ Furthermore, Li et al. reported that miR‐199b‐5p played an anti‐tumor role in HCC via targeting JAG1. ¹² In this study, miR‐199b‐5p overexpression reduced the growth of the tumor. Another study has shown that circRNAs can act as the sink of miRNA and control the function of miRNA. ²⁷ Starbase prediction and dual‐luciferase reporter assay results revealed that there were binding sites between miR‐199b‐5p and circTNPO3. Moreover, circTNPO3 directly targeted miR‐199b‐5p and negatively regulated its expression. Further studies showed that knockdown of miR‐199b‐5p reversed circTNPO3 silencing effect on HCC cells proliferation and apoptosis. Therefore, targeting circTNPO3/miR‐199b‐5p might be a new approach for HCC treatment.

Striatin is a 780 amino acid protein with four protein–protein interaction domains including a caveolin‐binding domain, a coiled‐coil domain, a Ca²⁺‐calmodulin (CaM)‐binding domain, and a Tryptophan‐Aspartate (WD)‐repeat domain. ²⁸ STRN is a protein encoded by the STRN gene in humans and is an important member of the striatin family, including STRN, STRN3 (SG2NA), and STRN4 (ziedin). ²⁹ The striatin family of proteins themselves functions as a link to the tumor due to their involvement in regulating the activity of multiple protein kinases that play a role in tumor progression. The STRN‐ALK fusion protein was identified as a potential therapeutic target for lung adenocarcinoma, thyroid papillary carcinoma, etc. ³⁰ , ³¹ Moreover, striatin is a novel cell–cell junctional protein that functions to maintain correct cell adhesion and may have a role in establishing the relationship between adherens junctions and tight junctions that is fundamental for epithelial cell–cell adhesion. ³² STRN has great therapeutic potential due to its interaction with dynamic partners involved in apoptosis. ³³ Serine/threonine‐protein kinase 25 has been reported to interact with STRN in HCC to regulate energy storage and EMT through reprogramming of lipid metabolism. ³⁴ However, the function of STRN alone in regulating the biological functions of HCC remains unclear. STRN was up‐regulated in HCC and regulated cell invasion and migration by promoting the EMT process as a tumor promoter. ¹⁴ MiRNAs usually pair in the 3′‐untranslated region of mRNA and play a role after transcription in regulating mRNA expression. ³⁵ miR‐199b‐5p plays a tumor‐suppressive role in HCC by directly targeting JAG1. ¹² In addition, miR‐199b‐5p directly targeted N‐cadherin to attenuate TGF‐β1‐induced EMT in HCC. ¹³ Our study indicated that STRN was a target gene of miR‐199‐5p. Meanwhile, miR‐199b‐5p inhibited hepatoma cells proliferation and invasion and promoted cell apoptosis by inhibiting STRN expression. And this is the first time we reported miR‐199b‐5p/STRN role in HCC, suggesting miR‐199b‐5p could suppress HCC progress by regulating STRN expression.

In conclusion, our findings suggest that knockdown of circTNPO3 suppresses the progression of HCC by mediating the miR‐199b‐5p/STRN axis in vivo and in vitro. Our study provides a theoretical basis for HCC pathogenesis, and also provides new targets and strategies for the treatment of HCC.

CONFLICTS OF INTEREST

All authors declare no conflict of interest.

Liu J, Liu B. CircTNPO3 promotes hepatocellular carcinoma progression by sponging miR‐199b‐5p and regulating STRN expression. Kaohsiung J Med Sci. 2023;39(3):221–233. 10.1002/kjm2.12631